Synechococcus malate dehydrogenase

Abstract

The invention relates to the technical field of enzyme engineering, in particular to synechococcus malate dehydrogenase, and the amino acid sequence of the synechococcus malate dehydrogenase is as shown in SEQ ID NO. 1. The synechococcus MDH disclosed by the invention has double-coenzyme dependence of NADH (nicotinamide adenine dinucleotide phosphate) and NADPH (nicotinamide adenine dinucleotide phosphate) According to the method, a biological information base of the cyanobacteria MDH is enriched, and a foundation is laid for further researching the coenzyme specificity of the MDH and the system evolution relationship of the MDH.

Description

Technical Field

[0001] The invention relates to the technical field of enzyme engineering, in particular to a Synechococcus malate dehydrogenase. Background Art

[0002] Synechococcus is a unicellular cyanobacteria belonging to the Cyanophyta, Cyanophyceae, Chroococcales, Synechococcaceae, and Synechococcus. Synechococcus is widely distributed in freshwater and marine ecosystems and is one of the most important representative strains of cyanobacteria.

[0003] Malate dehydrogenase (MDH) is a key regulatory enzyme in the biological metabolic cycle. It is commonly found in various organisms and plays an important role in the biological energy production process and various metabolic pathways. MDH belongs to the 2-ketoglutarate NAD(P)+ coenzyme-dependent dehydrogenase superfamily. It is commonly found in various organisms such as animals, plants, and bacteria. It mainly participates in the last step of the TCA cycle and catalyzes the reversible conversion between malate and oxaloacetate. Currently, MDH has been found to have two polymerization forms: homodimers and homotetramers. In the existing MDH crystal structure studies, both homodimers and homotetramers have been reported, but homodimers are the majority, including NAD + -MDH and NADP + -MDH. Mitochondrial MDH, cytosolic MDH, glyoxylate cycle MDH, etc. are all homodimers, and some Gram-positive bacteria such as Bacillus subtilis and archaeal MDH are homotetramers. At present, many MDH crystal structures from different sources have been resolved, but there has been no report on the crystal structure of cyanobacterial MDH.

[0004] At present, the whole genome sequence of several Synechococcus has been sequenced. The biological research on Synechococcus mainly focuses on the growth conditions of Synechococcus and its relationship with the environment, genetic diversity, and the expression of foreign genes as a transformation vector, but there are few reports on the functional genes related to the basic metabolism of Synechococcus, and there are no reports on the related functions of MDH of Synechococcus itself. Summary of the invention

[0005] In view of this, the purpose of the present invention is to propose a Synechococcus malate dehydrogenase to enrich the biological information library of cyanobacterial MDH and lay a foundation for further studying the coenzyme specificity of MDH and the systematic evolutionary relationship of MDH.

[0006] Based on the above purpose, the present invention provides a Synechococcus malate dehydrogenase, the amino acid sequence of the Synechococcus malate dehydrogenase is shown in SEQ ID NO.1.

[0007] SEQ ID NO.1:

[0008] 1mfksnphhis hpvvsvigag nvgstlaqri veknladvil ldvvasrsqg valdlmqara

[0009] 61lenhdrqiig tddythtkds dvivitagvp rkdgmsrddl lkinakivse vtlraishsp

[0010] 121naviivvtnp ldvmtyltwe isgfatnkvm gmagvldasr fqafiamelg tstadinamv

[0011] 181mgghgdlmvp lprystvsgv pitelmsada iarlvdrtrn ggaeivkllq tgsayfapas

[0012] 241aaylmvesil rnrrriipaa aylqgeygle glfmgvpvql gqegvdmvve lglspeelea

[0013] 301lhtsatsvra niqrlkaihe r

[0014] The present invention also provides a gene encoding the Synechococcus malate dehydrogenase, and the nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0015] SEQ ID NO.2:

[0016] ATGTTTAAGTCTAACCCGCATCATATTTCCCATCCTGTTGTTAGTGTAATTGGTGCAGGCAATGTTGGCA

[0017] GTACCTTGGCAAAAGAATTGTGGAAAAAAATCTTGCGGATGTGATCCTCTTGGATGTAGTTGCAAGT

[0018] AGGTCTCAAGGTGTAGCTTTGGATTTAATGCAGGCAAGAGCTTTAGAAAATCATGATCGCCAAATTATT

[0019] GGGACTGATGACTATACCCATACAAAAGATTCTGATGTAATTGTAATTACCGCAGGAGTGCCAAGGAA

[0020] AGATGGGATGAGTCGGGACGATCTACTAAAAATTAATGCCAAGATCGTTTCTGAGGTTACACTTAGGG

[0021] CAATTTCCCACTCTCCTAATGCCGTAATTATAGTTGTTACTAACCCATTAGATGTGATGACCTATTTGAC

[0022] ATGGGAAATTAGTGGGTTTGCGACTAATAAGGTGATGGGTATGGCAGGGGTACTTGATGCTTCAAGAT

[0023] TTCAAGCATTTATTGCCATGGAACTAGGTACATCAACGGCTGATATTAATGCCATGGTTATGGGTGGAC

[0024] ATGGCGATTTAATGGTACCTCTACCTCGGTATTCTACGGTTAGTGGAGTACCAATTACGGAATTGATGTC

[0025] TGCGGATGCGATCGCCCGTCTAGTTGATAGAACTCGCAATGGGGGTGCGGAAATTGTCAAGCTATTAC

[0026] AAACAGGAAGTGCTTATTTTGCCCCAGCATCAGCTGCTTACCTAATGGTTGAGTCAATTTTACGTAATC

[0027] GTCGCCGCATTATTCCCGCCGCAGCCTACTTACAGGGAGAGTATGGCTTGGAAGGACTATTTATGGGG

[0028] GTACCAGTTCAGTTAGGACAAGAGGGTGTTGATATGGTCGTAGAGCTGGGCTTATCCCCAGAAGAATT

[0029] AGAGGCTCTACACACCTCAGCTACATCAGTGCGGGCGAATATTCAAAGACTAAAAGCTATTCATGAAAGATAA.

[0030] The invention also provides a recombinant expression vector containing the gene.

[0031] Optionally, the pH of the reaction catalyzed by the Synechococcus malate dehydrogenase is 7.8-8.7 and the temperature is 35-50°C.

[0032] Preferably, the pH of the reaction catalyzed by freshwater Synechococcus malate dehydrogenase is 7.8-8.5 and the temperature is 35-40°C.

[0033] Preferably, the pH of the reaction catalyzed by the marine Synechococcus malate dehydrogenase is 8.0-8.7 and the temperature is 45-50°C.

[0034] The in vitro catalytic reaction of Synechococcus MDH is mainly in the reverse direction, reducing oxaloacetate to malate.

[0035] Beneficial effects of the present invention: The Synechococcus MDH of the present invention has dual coenzyme dependence on NADH and NADPH. The present invention enriches the biological information library of cyanobacterial MDH and lays a foundation for further research on the coenzyme specificity of MDH and the systematic evolutionary relationship of MDH. cat and catalytic efficiency k cat / K m From the above, the catalytic activity of Synechococcus MDH with NADH as coenzyme is much higher than that with NADPH as coenzyme. In some Synechococcus, the catalytic activity of the former is even more than 40 times that of the latter, indicating that although Synechococcus MDH has affinity for both coenzymes, it mainly uses NADH as coenzyme when catalyzing the reduction reaction of OAA. There is no significant difference in the affinity of MDH of marine Synechococcus and freshwater Synechococcus for NADH, but the affinity of marine Synechococcus MDH for NADPH coenzyme is generally higher than that of freshwater Synechococcus MDH for NADPH. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings in the following description are only for the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0037] Figure 1 The agarose gel electrophoresis diagram of the recombinant plasmid of the present invention; wherein, A: M: DL-2000Marker; 1-6: pSyMDH recombinant plasmid; 1. pSy6715MDH; 2. pSy6312MDH; 3. pSy7502MDH; 4. pSy7117MDH; 5. pSy7002MDH; 6. pSy7003MDH; B: 1. pSy7502MDH; 2. pSy7117MDH; 3. empty plasmid;

[0038] Figure 2 The SDS-PAGE results of SyMDH of the present invention; wherein, M: protein marker; 1. Sy7502MDH; 2. Sy6312MDH; 3. Sy6715MDH; 4. Sy7002MDH; 5. Sy7003MDH; 6. Sy7117MDH;

[0039] Figure 3 To determine the effect of pH changes on the enzyme activity of SyMDH catalyzing OAA reduction reaction at 25°C;

[0040] Figure 4 The activity of the SyMDH catalytic reaction is measured at different temperatures in the present invention;

[0041] Figure 5 The effect of temperature on the activity of SyMDH in the present invention; left: Sy6715MDH; right: Sy6312MDH;

[0042] Figure 6 This is the heat resistance analysis of SyMDH at 55°C of the present invention;

[0043] Figure 7 Effects of different metal ions on SyMDH activity;

[0044] Figure 8 The effect of small molecule compounds on SyMDH activity. DETAILED DESCRIPTION

[0045] In order to make the purpose, technical solution and advantages of the present invention more clear, the present invention is further described in detail in conjunction with specific embodiments below. It should be noted that, unless otherwise defined, the technical terms or scientific terms used in the present invention should be the common meanings understood by people with ordinary skills in the field to which the present invention belongs.

[0046] The experimental materials used in the present invention are as follows:

[0047] 1. Strains and plasmids

[0048] Table 1 Strains and plasmids

[0049]

[0050]

[0051] Enzymes and kits

[0052] (1) Enzymes: Nde I and Xho I restriction endonucleases and T4 ligase were purchased from New England BioLabs.

[0053] (2) Kits: High-purity plasmid small-scale rapid extraction kit was purchased from Beijing Protein Biotechnologies; protein purification kit BDTALONTM Metal Affinity Resins was purchased from Clontech; modified Bradford protein concentration determination kit Modified Bradford Protein Assay Kit was purchased from Sangon Biotech.

[0054] (3) Biochemical reagents: IPTG, oxaloacetate, coenzymes NADH and NADPH were purchased from Sigma; DNA molecular weight standard was purchased from TaKaRa; protein molecular weight standard (ProMantTM Prestained protein Ladder) was purchased from Beijing Protein Biotechnologies; other analytical grade reagents were purchased from Shanghai Biotechnologies Co., Ltd.

[0055] Liquid LB medium (100 ml):

[0056]

[0057] LB solid medium (100 ml):

[0058]

[0059]

[0060] Antibiotic solution (30 mg / ml): Antibiotic (Kan, Cam): weigh 300 mg of antibiotic and dissolve in 10 ml of ddHO 2 O, sterilize by filtering with a 0.22μm filter membrane under sterile conditions, and finally dispense into sterile 1.5ml EP tubes. When used, add at a ratio of 1:1000 and 1:2000 respectively, and keep the rest in a -20℃ refrigerator.

[0061] 50× Agarose Gel Electrophoresis Buffer TAE (1L):

[0062]

[0063] Make up to 1L with water, mix well, and dilute to 1× concentration before performing agarose gel electrophoresis.

[0064] LEW Buffer (1L):

[0065]

[0066] Dissolve the above reagent solution in 800 ml of ddH2O, adjust the pH to 8.0 with 10M NaOH, and finally make up to 1L.

[0067] Elution Buffer (150 mM, 1L):

[0068]

[0069] Dissolve the above reagents in 800 ml of ddH 2 O water, adjust the pH to 8.0 with 10M NaOH, and finally make up to 1L.

[0070] 30% Polyacrylamide Solution (500 ml):

[0071]

[0072] Polyacrylamide Gel:

[0073]

[0074] 5× Protein Electrophoresis Buffer (1L):

[0075]

[0076] Protein Loading Buffer (10 ml):

[0077]

[0078] Mix DTT and the loading buffer in a ratio of 1:9 before use to make the final concentration of DTT 100 mM. Coomassie Brilliant Blue Staining Solution (100 ml):

[0079]

[0080]

[0081] Destaining Solution (100 ml):

[0082]

[0083] 2. Experimental methods

[0084] Construction of recombinant pSyMDH plasmid

[0085] According to the gene sequence of Synechococcus MDH in Genbank, the gene fragment required in the experiment was synthesized. The MDH gene (synthesized by Nanjing GenScript Biotech Co., Ltd.) and the vector pET-28b (+) were double-digested with Nde I and Xho I DNA restriction endonucleases at the same time. The digested fragments were separated by T 4 -DNA ligase ligation, the ligation product was transformed into E.coil DH5α host cells, and positive transformation clones were selected after kanamycin resistance screening.

[0086] Extraction and identification of recombinant plasmid

[0087] The positive clones obtained in the above steps were expanded and cultured, and plasmid DNA was extracted using a kit. The method is shown in the instruction manual of the "HiPu Plasmid Mini Kit". The obtained plasmid was preliminarily tested by agarose gel electrophoresis, and DNA sequencing was used to identify whether the pSyMDH plasmid was successfully recombined. The recombinant plasmid was identified by agarose gel electrophoresis, and the results were as follows: Figure 1 .

[0088] Transformation of recombinant pSyMDH plasmid into E. coli Rosetta (DE3) host cells:

[0089] Take a tube of 100 μl frozen E. coli Rosetta (DE3) competent cells and immediately put it on ice to thaw for about 10 minutes.

[0090] Take 2.5 μl of the recombinant plasmid pSyMDH and add it to the competent cells, mix well by pipetting, and place on ice for 30 min.

[0091] Heat shock in 42℃ water bath for 90s, then immediately put in ice bath for 2min.

[0092] Add 500 μl of LB liquid medium without antibiotics and culture at 37°C and 225 rpm with shaking for 1 h.

[0093] Centrifuge at 4000 rpm for 1 min, remove part of the culture medium, leaving about 200 μl, and gently suspend the cells.

[0094] Take 100 μl of the above bacterial solution and spread it evenly on the LB solid plate containing Kan and Cam resistance, place it in a 37°C incubator and culture it upright for about 1 hour. After the bacterial solution is completely absorbed, invert it and culture it overnight.

[0095] Inducible expression of recombinant plasmid pSyMDH:

[0096] Pick a single colony from the plate in the previous step and place it in 5 ml of LB liquid culture medium containing Kan and Cam resistance, and culture it at 37°C and 225 rpm with shaking overnight.

[0097] Take 3 ml of overnight cultured bacterial solution and place it in a conical flask containing 200 ml LB liquid culture medium containing Kan and Cam resistance, and culture it at 37°C and 225 rpm for about 4 hours.

[0098] The absorbance of the bacterial solution at 600 nm was measured with a UV spectrophotometer. When the OD600nm value of the bacterial solution was about 0.4-0.6, IPTG was added to a final concentration of 0.5 mM and the expression was induced at 20°C and 180 rpm for about 20 h.

[0099] The induced bacterial solution was placed on ice for 10 min, centrifuged at 4°C and 5000 rpm for 5 min, and the bacteria were collected.

[0100] Purification of target protein using Co 2+ SyMDH was purified by ion affinity chromatography. The specific method is as follows:

[0101] (1) Ultrasonic disruption of bacteria

[0102] 1) Pour about 20 ml of LEW Buffer (pH 8.0) into the centrifuge tube for collecting bacteria, vortex and oscillate to resuspend the bacteria, centrifuge at 4°C, 5000 rpm for 5 min to collect the bacteria and discard the supernatant. Pour the same amount of LEW Buffer again and oscillate thoroughly to suspend the bacteria.

[0103] 2) Remove the foam generated by the oscillation of the bacterial solution, place the centrifuge tube in an ice-water mixture, and use an ultrasonic cell disruptor to disrupt the cells for about 40 minutes (crushing power 200 W, crushing 1 second, rest 2 seconds).

[0104] 3) After the crushing is completed, the centrifuge tube is placed in a refrigerated centrifuge and centrifuged at 4°C and 10,000 rpm for 20 minutes to remove the precipitate.

[0105] (2) Protein purification

[0106] 1) First, equilibrate the resin with 1 column volume of LEW Buffer, and then transfer the supernatant to the equilibrated chromatography column.

[0107] 2) Place the column on a vertical mixer and allow to tumble and bind for 30 min at 4°C.

[0108] 3) After binding, take out the chromatography column and place it in an ice box to elute the filtrate.

[0109] 4) Elute the resin with 250 ml of LEW Buffer.

[0110] 5) Wash the resin with 20 ml of Elution Buffer containing 10 mM imidazole.

[0111] 6) Elute the resin with 250 ml of LEW Buffer.

[0112] 7) Elute the target protein with 15 ml of 150 mM Elution buffer, collect in a centrifuge tube, and store at 4°C.

[0113] Expression, purification and identification of SyMDH

[0114] The recombinant plasmid pSyMDH was transformed into E. coli Rosetta (DE3) expression host cells and induced with 0.5 mM IPTG. 2+ The target protein was purified by ion affinity chromatography, and the results of SDS-PAGE analysis were as follows: Figure 2 The results showed that the target protein was mainly expressed in soluble form in E. coli, and the molecular weight of the purified protein was around 35.0 kDa, which was basically consistent with the expected protein molecular weight, and its purity could also meet the requirements of subsequent experiments.

[0115] Effect of pH on SyMDH activity

[0116] The reaction buffer (100 mM Tris-HCl) was adjusted to different pH gradients. In a standard reaction system, NADH was used as a coenzyme, and the changes in the enzyme activity of SyMDH between pH 6.5 and 10.0 were measured at 25°C to analyze the optimal pH of the enzyme-catalyzed reaction.

[0117] The effect of pH change on the enzyme activity of SyMDH catalyzing OAA reduction reaction was measured at 25°C. Figure 3 As shown. The results showed that the optimal pH for the reaction of freshwater Synechococcus PCC6715, PCC6312 MDH, and PCC7502 MDH were 8.5, 8.0, and 7.8, respectively. The optimal pH for the MDH of marine Synechococcus PCC7002, PCC7003, and PCC7117 were 8.4, 8.0, and 8.7, respectively. Therefore, it can be seen that the optimal pH range of Synechococcus MDH is relatively wide, about 7.8-8.7.

[0118] Effect of temperature on SyMDH activity

[0119] Adjust the pH of the reaction buffer to 8.0 at the set corresponding gradient temperature, prepare the corresponding standard reaction system, incubate it in a water bath at the corresponding temperature, and detect the reaction rate of the enzymatic reaction at the set temperature. Detect the relative change of enzyme activity in the standard system within the temperature range (20-65°C) and analyze the optimal temperature of the enzyme catalytic reaction.

[0120] The activity of SyMDH catalytic reaction was measured at different temperatures. Figure 4 As shown. The optimum temperatures of freshwater Synechococcus PCC6715 and PCC6312 are 35℃ and 40℃ respectively. The optimum temperatures of marine Synechococcus PCC7002 and PCC7003 are 50℃, and the optimum temperature of PCC7117 is 45℃. From the results, it can be seen that the optimum reaction temperature of marine Synechococcus MDH is higher than that of freshwater Synechococcus MDH.

[0121] Thermal stability of SyMDH

[0122] Sy6715MDH and Sy6312MDH were placed in a water bath at different temperatures (0-80°C) for 20 minutes, taken out and immediately placed on ice for 5 minutes. Under the same conditions, the relative residual enzyme activity of the enzyme in the standard reaction system after SyMDH treatment at different temperatures was measured, and the activity of the enzyme solution without any treatment was set to 100% to analyze the heat resistance of SyMDH.

[0123] Sy6715MDH was placed in a 55°C water bath and heated for different time periods (5-560 min), then taken out and placed in an ice bath for 5 min, and the change in the enzymatic reaction rate was detected at an absorbance of 340 nm. The activity of the enzyme solution without any treatment was set as 100% to analyze the thermal stability of SyMDH.

[0124] The residual activity of Sy6715MDH and Sy6312MDH after treatment at different temperatures (0-80℃) was detected in the standard enzyme reaction system. The results showed that ( Figure 5 ) Synechococcus MDH has good heat resistance. The activity of Sy6715MDH began to decline slightly when heated to 60℃, but it still had about 31% activity at 75℃, and it dropped to 4% of the original activity at 80℃. The heat resistance of Sy6312MDH was better than that of Sy6715MDH. Its activity began to decline when heated to 70℃, and it still had 61% activity at 75℃, and it lost its activity completely when heated to 78℃.

[0125] The enzyme was placed in a 55°C water bath and heated for different time periods (5-560 min), then taken out and placed in an ice bath for 5 min, and the slope change was detected at an absorbance of 340 nm. Figure 6As shown, the Synechococcus PCC6715 MDH reached its half-life when heated to 200 min, still had about 12% activity at 540 min, and only about 8% activity remained after heating for 560 min.

[0126] Effects of metal ions on SyMDH activity

[0127] Under the same conditions, four monovalent metal ions (K + 、Na + , Li + , Rb + ) and 7 divalent metal ions (Mg 2+ , Mn 2+ , Ca 2+ 、Zn 2+ 、Co 2+ , Cu 2+ 、Ni 2+ ) were added to the standard system to a final concentration of 2 mM. The standard system without metal ions was set to 100%, and NADH was used as a coenzyme to measure the changes in the enzyme activities of Sy6715MDH and Sy7117MDH by different ions in the standard reaction solution, and the corresponding enzyme residual activities were calculated to analyze the effects of metal ions on SyMDH activity.

[0128] The effects of different metal ions on SyMDH activity were determined by adding different ions into the reaction system. Figure 7 As shown. For freshwater Sy6715MDH, under experimental conditions, Na + and Co 2+ In addition to promoting the enzyme activity to a certain extent, the activity of Sy6715MDH was increased by about 10% and 5% respectively. Other ions also had different degrees of inhibitory effects on Sy6715MDH, among which K + , Li + , Ca 2+ Slightly inhibit enzyme activity (the loss of target protein activity is within 10%); Mg 2+ and Mn 2+ The activity of Sy6715MDH was reduced by 24% and 60%, respectively; Hg + The inhibitory effect is strong, which can cause Sy6715MDH activity to lose about 92%; Zn 2 + , Cu 2+ , Ni 2+ It has a very strong inhibitory effect, and the enzyme activity is almost completely lost after addition.

[0129] For the marine Sy7117 MDH, K + and Ca 2+ It plays an activating role, while other ions show different inhibitory effects.+ and Ca 2+ Both have a slight activation effect, and the activation effect of the former is slightly stronger than that of the latter. + , Li + and Mg 2+ It has a slight inhibitory effect, and under experimental conditions, the activity of Sy7117 MDH can be reduced by less than 6%. 2+ 、Co 2+ The MDH activity of Sy7117 was reduced by 31% and 23%, respectively; Zn 2+ and Ni 2+ Both can reduce the activity of Sy7117 MDH by about 80%; Hg + and Cu 2+ It has a strong inhibitory effect and completely loses its activity after addition.

[0130] Effects of small molecule compounds on SyMDH activity

[0131] This experiment selected three common purine nucleotides (ATP, ADP and AMP) and three metabolic compounds (α-ketoglutarate, DTT and EDTA) to detect their effects on SyMDH activity. Under the same conditions, the above small molecule compounds were added to the standard system to a final concentration of 2mM. The standard system without any small molecules was set to 100%, and NADH was used as a coenzyme to measure the changes in the enzyme activities of Sy6715MDH and Sy7117MDH by different small molecule compounds in the standard reaction solution, and analyze the effects of small molecule compounds on SyMDH activity.

[0132] The effects of small molecule compounds on SyMDH activity were detected by adding several common compounds (citrate, ATP, ADP, AMP, α-ketoglutarate, EDTA, DTT) into the reaction system. Figure 8 Under the experimental conditions, except for EDTA, which activated Sy6715MDH, the other small molecule compounds showed different degrees of inhibition on the activity of Sy6715MDH. Among them, ATP and DTT had weaker inhibitory effects, reducing the activity of Sy6715MDH by about 5% and 7%, respectively; AMP, citrate, ADP and α-ketoglutarate reduced the activity of Sy6715MDH by about 10%, 14%, 23% and 58%, respectively.

[0133] In the experiment, small molecule compounds showed a certain degree of inhibitory effect on the activity of marine Sy7117MDH enzyme. Among them, AMP had a slight inhibitory effect, only reducing the activity of Sy7117MDH by about 4%; citrate, ATP, ADP, EDTA, and DTT could reduce the activity of Sy7117MDH to 10%-20% of the original; and α-ketoglutarate could reduce the activity of Sy7117MDH by about 54%.

[0134] Those skilled in the art should understand that the discussion of any of the above embodiments is only exemplary and is not intended to imply that the scope of the present invention is limited to these examples; under the concept of the present invention, the technical features in the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other changes in different aspects of the present invention as described above, which are not provided in detail for the sake of simplicity. Any omissions, modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A Synechococcus malate dehydrogenase, characterized in that The amino acid sequence of the Synechococcus malate dehydrogenase is shown in SEQ ID NO.

1.

2. The gene encoding the Synechococcus malate dehydrogenase according to claim 1, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

3. A recombinant expression vector containing the gene according to claim 2.

4. The Synechococcus malate dehydrogenase according to claim 1, characterized in that The pH of the reaction catalyzed by the Synechococcus malate dehydrogenase is 7.8-8.7 and the temperature is 35-50°C.

5. The Synechococcus malate dehydrogenase according to claim 4, characterized in that The pH of the reaction catalyzed by malate dehydrogenase of freshwater Synechococcus is 7.8-8.5 and the temperature is 35-40°C; the pH of the reaction catalyzed by malate dehydrogenase of marine Synechococcus is 8.0-8.7 and the temperature is 45-50°C.

Images