Needle mushroom iron ion permease gene FvFTR1 and application thereof

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a flammulina velutipes iron ion permease gene FvFTR1 and application thereof, the nucleotide sequence of the flammulina velutipes iron ion permease gene FvFTR1 is shown as SEQ ID NO.1, and the amino acid sequence of the protein is shown as SEQ ID NO.2. The invention further discloses a preparation method of the flammulina velutipes iron ion permease gene FvFTR1. According to the invention, an iron ion permease gene FvFTR1 is cloned from flammulina velutipes for the first time, and the FvFTR1 gene is transferred into tobacco by means of molecular biology and biotechnology to obtain a subcellular localization result of the FvFTR1 gene; meanwhile, the FvFTR1 gene is transferred into pichia pastoris to obtain an FvFTR1 gene overexpression strain, and comparative analysis proves that the tolerance of the overexpression strain to high iron ion stress is obviously improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and specifically relates to a Flammulina velutipes iron ion permease gene FvFTR1 and an application thereof. Background Art

[0002] Flammulina velutipes is an important edible mushroom with rich nutritional and medicinal value. However, there are some problems in the production process of Flammulina velutipes, such as long growth cycle and unstable yield. Therefore, accelerating the selection and breeding of excellent strains with high quality, high yield, disease resistance, insect resistance, and storage resistance is the only way to improve product quality.

[0003] Iron ion permease belongs to the dependent ferredoxin family. Its obvious feature is that it contains two conserved domains, namely REXXE. FTR1 is the only known permease with high affinity for iron ions. It is a structural unit with a trivalent iron binding site Glu-Xaa-Xaa-Glu. The first reported one was the iron ion permease FTR1 in yeast. Studies have found that there is a multi-copper oxidase protein Fet3 on the yeast plasma membrane, and the FTR1 protein needs the participation of the multi-copper oxidase Fet3 to perform the absorption and transport of iron. In the process of iron transport and absorption, the multi-copper oxidase Fet3 protein forms a transport complex with the FTR1 protein. The Fet3 protein is responsible for catalyzing Fe 2+ Oxidized to Fe 3+ , Fe 3+ It is then transported into the cell by the FTR1 protein and absorbed and utilized. FTR1 plays an important role in the survival of Candida albicans in a low-iron environment and is also involved in regulating the utilization of C and N sources. In addition, FTR1 negatively regulates the growth of Candida albicans hyphae, and the absence of FTR1 makes it impossible for Candida albicans to effectively infect the host. In Rhizopus oryzae: FTR1 is induced to express in iron-deficient medium, and RNAi silencing of the FTR1 gene leads to a decrease in the virulence of the strain to mice; in Fusarium graminearum, FgFtr1 expression increases in iron-deficient medium, but it does not participate in regulating pathogenicity. The FTR1 homologous gene fer2 was identified in Ustilago maydis. Fre2 is located in the cytoplasmic membrane and can complement the function of the ftr1 deletion mutant of Saccharomyces cerevisiae. During the pathogenic process, fre2 is expressed during the hyphal differentiation period of the strain in the host. The loss of fer2 leads to a significant decrease in the pathogenicity of the strain, indicating that the high-affinity iron ion absorption system is involved in regulating the pathogenicity of plant pathogenic fungi.

[0004] However, there is currently a lack of research on FTR1 and its functions in large edible and medicinal fungi. Therefore, we used Flammulina velutipes as research material to identify the FTR1 gene and explore its biological functions. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a Flammulina velutipes iron ion permease gene FvFTR1 and application thereof.

[0006] The present invention is implemented by providing a Flammulina velutipes iron ion permease gene FvFTR1, the nucleotide sequence of the Flammulina velutipes iron ion permease gene FvFTR1 is shown in SEQ ID NO.1.

[0007] Provided is a protein encoded by a Flammulina velutipes iron ion permease gene FvFTR1, the amino acid sequence of the protein being shown as SEQ ID NO.2.

[0008] Provided are primers for amplifying the above-mentioned Flammulina velutipes iron ion permease gene FvFTR1, which are pCAMBIA1300-FvFTR1-F and pCAMBIA1300-FvFTR1-R, and the nucleotide sequences are as follows:

[0009] pCAMBIA1300-FvFTR1-F:

[0010] 5'-GAGCTCGGTACCCGGGGATCCATGGCAAAAAACTTGTTCTC-3'

[0011] pCAMBIA1300-FvFTR1-R:

[0012] 5'-GCCCTTGCTCACCATGTCGACCTTCGGGAGTTCATGAAGGCT-3'

[0013] The first 15 bases at the 5' end of the primer are vector homologous sequences, and the following 6 bases are restriction site sequences. These 21 bases do not belong to the FvFTR1 gene sequence, but are necessary for constructing a recombinant plant overexpression vector.

[0014] Provided are primers for amplifying the above-mentioned Flammulina velutipes iron ion permease gene FvFTR1, which are pPIC9-FvFTR1-F and pPIC9-FvFTR1-R, and the nucleotide sequences are as follows:

[0015] pPIC9-FvFTR1-F:

[0016] 5'-AGAATTCATGGCAAAAAACTTGTTCTCTG-3'

[0017] pPIC9-FvFTR1-R:

[0018] 5'-TTGCGGCCGCTTAGTGGTGGTGGTGGTGGTGCTTCGGGAGTTCATGAAG GCT-3'

[0019] Among them, the first 7 bases at the 5' end of the pPIC9-FvFTR1-F primer are the restriction site sequence, the first 10 bases at the 5' end of the pPIC9-FvFTR1-R primer are the restriction site sequence, the next 3 bases are the stop codon sequence, and the next 18 bases are the 6×his tag, which are necessary for the construction of the yeast expression vector.

[0020] Provided is a plant overexpression vector containing the Flammulina velutipes iron ion permease gene FvFTR1, which is pCAMBIA1300-35S-GFP-FvFTR1.

[0021] Provided is an application of a plant overexpression vector containing the Flammulina velutipes iron ion permease gene FvFTR1, which is an application of pCAMBIA1300-35S-GFP-FvFTR1 in subcellular localization in tobacco.

[0022] Provided is a yeast overexpression vector containing the Flammulina velutipes iron ion permease gene FvFTR1, which is pPIC9-FvFTR1.

[0023] Provided is an application of the yeast overexpression vector of the Flammulina velutipes iron ion permease gene FvFTR1, which is an application of pPIC9-FvFTR1 in improving yeast iron ion tolerance.

[0024] Compared with the prior art, the advantages of the present invention are:

[0025] The present invention clones an iron ion permease gene FvFTR1 from Flammulina velutipes for the first time. The FvFTR1 gene is transferred into tobacco by molecular biology and biotechnology to obtain the subcellular localization results of the FvFTR1 gene; at the same time, it is transferred into Pichia pastoris to obtain a yeast strain overexpressing the FvFTR1 gene. Comparative analysis proves that the tolerance of the overexpressed yeast to high iron ion stress is significantly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the amplification result of the cDNA sequence of the full length of 1152bp of FvFTR1 gene;

[0027] Figure 2 The results of subcellular localization detection of FvFTR1 gene in tobacco leaves;

[0028] Figure 3 (a) GS115 and pPIC9:FvFTR1 under normal conditions, 5 mM FeCl 3 and 15 mM FeCl 3 Yeast growth under Figure 3 (b) GS115 and pPIC9:FvFTR1 under normal conditions and 5 mM FeSO 4 and 15 mM FeSO 4 Yeast growth under

[0029] Figure 4 For pPIC9:FvFTR1, under normal conditions, 5 mM FeCl 3 and FeSO 4 , 15 mM FeCl 3 and FeSO 4 The expression level of FvFTR1 gene after treatment. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to explain the present invention and are not used to limit the present invention.

[0031] Example 1: Cloning of Flammulina velutipes FvFTR1 gene

[0032] The mycelium of Shennong White Flammulina velutipes No. 1 was used as the test material; the total RNA of mycelium was extracted using the EASYspin Plus Plant RNA Rapid Extraction Kit, and the first chain of cDNA was synthesized by reverse transcription;

[0033] Gene cloning: Using the first strand of reverse transcribed cDNA as a template, PCR amplification was performed using primers pCAMBIA1300-FvFTR1-F / pCAMBIA1300-FvFTR1-R and pPIC9-FvFTR1-F / pPIC9-FvFTR1-R. The PCR product was recovered to obtain a 1152 bp target fragment. For related results, refer to the attached Figure 1 .

[0034] Example 2: Construction of plant expression vector

[0035] The purified gel recovery product FvFTR1 full length was connected to the pCAMBIA1300-35S-GFP linear large fragment using the In-Fusion HD Cloning kit. The reaction system was: 5μL 2×Cloning Mix, 3μL linear large fragment, 2μL target gene fragment, and reacted at 50℃ for 30min. The ligation product was transformed into E. coli competent TOP10, and the plant expression vector pCAMBIA1300-35S-GFP-FvFTR1 with the target gene was obtained by shaking the bacteria and extracting the plasmid after colony PCR and sequencing. Then, Agrobacterium GV3101 competent cells were transformed, and colony PCR was performed to identify the Agrobacterium containing the recombinant plasmid for the transformation of tobacco leaves.

[0036] Example 3: Construction of yeast expression vector

[0037] The purified gel-recovered product FvFTR1 was ligated to the pLB-T vector. The T vector and the vector pPIC9 were digested with EcoRⅠ and NotⅠ, respectively. The reaction system was: 6μL pPIC9 plasmid / T vector plasmid, 2μL 10×H Buffer, 2μL BSA, 1μL EcoRⅠ, 1μL NotⅠ, 8μL ddH 2 O, 37℃ for 3h, and the linear large fragment and the target small fragment were recovered respectively. The target small fragment of FvFTR1 was connected to the linear large fragment of pPIC9 using T4 ligase. The reaction system was: 1μL 10×T4 ligase buffer, 1μT4 ligase, 5μL target small fragment, 3μL linear large fragment, and connected at 16℃ overnight. The ligation product was transformed into E. coli competent TOP10, and the recombinant plasmid pPIC9-FvFTR1 with the target gene was obtained by shaking the bacteria and extracting the plasmid after colony PCR and sequencing identification.

[0038] Example 4: Subcellular localization detection of tobacco leaves transformed with recombinant plasmids

[0039] Agrobacterium GV3101 positive clones containing pCAMBIA1300-35S-GFP and pCAMBIA1300-35S-GFP-FvFTR1 recombinant plasmids were first inoculated into 10 mL of 50 μg mL -1 Rif (rifampicin) and 50 μg mL -1 Kan (kanamycin) in YEP liquid medium, shake culture at 28 °C for 16 h, and then inoculate in 50 mL of 50 μg mL -1 Rif (rifampicin) and 50 μg mL -1Kan (kanamycin) in YEP liquid medium, shake culture at 28 ° C for 3 h until OD600 is 0.8-1, centrifuge at 4000 rpm for 10 min to collect the bacteria, and use 0.5 mol·L -1 MES+1mol·L -1 MgCl 2 +100mmol·L -1 The bacteria were suspended in an aqueous solution of AS (acetosyringone) until the OD600 was 0.6-0.8, and allowed to stand at 28°C for 3 hours in the dark; the bacterial suspension was injected into the tobacco leaf surface using a needleless syringe; the bacteria were cultured in the dark for 24 hours, and then cultured in the light for 72 hours.

[0040] Subcellular localization detection: Using tobacco leaves injected with pCAMBIA1300-35S-GFP Agrobacterium as control, laser confocal microscopy was used to detect the expression of pCAMBIA1300-35S-GFP-FvFTR1 fusion protein in tobacco protoplasts. The fluorescence signal of pCAMBIA1300-35S-GFP was detected in multiple subcellular compartments such as plasma membrane, nucleus and cytoplasm, while the fluorescence signal of pCAMBIA1300-35S-GFP-FvFTR1 was mainly detected in the plasma membrane, with a small amount detected in the cytoplasm, indicating that FTR1 in Flammulina velutipes is mainly localized on the plasma membrane, which is consistent with its iron ion permeability function. For related results, please refer to the attached Figure 2 .

[0041] Example 5: Transformation of recombinant plasmid into Pichia pastoris for functional verification

[0042] Pichia pastoris GS115 was inoculated into liquid YPD medium at 30°C and 180rpm for 24h. 1mL of bacterial solution was centrifuged at 3000rpm for 5min, and the Super yeast competent state preparation and transformation kit was used to add 1mL of LY1 solution to resuspend the bacteria. After centrifugation, 100μLY2 solution was added to prepare yeast competent state. The pPIC9-FvFTR1 recombinant plasmid was digested with BglⅡ, and the linear large fragment was recovered and mixed with 350μLY3 solution and added to 50μL competent state. Heat shock was performed at 30°C for 1h, and mixed every 10min. After centrifugation, ddH 2 O resuspended bacteria, and finally inverted culture on MD plate. After screening culture and colony PCR detection, the recombinant yeast transformant pPIC9:FvFTR1 was obtained.

[0043] Spot assay: GS115 and pPIC9:FvFTR1 were inoculated into liquid YPD at the same time and cultured for 16 h. The OD600 was adjusted to an error of < 0.1. The adjusted bacterial solution was diluted 10 0 , 10 -1 , 10 -2 , 10-3 The results showed that under iron stress, the yeast volume would decrease with the increase of iron ion concentration. Under low concentration iron ion stress, there was no significant difference in the growth of GS115 and pPIC9:FvFTR1. However, when the iron ion concentration reached 15mM, that is, high concentration iron ion stress, GS115 would grow at a rate of 10 -2 After GS115, pPIC9:FvFTR1 could no longer grow, while pPIC9:FvFTR1 could still grow normally, indicating that pPIC9:FvFTR1 was more tolerant to iron stress than GS115 and that FvFTR1 could promote the growth of Pichia pastoris under high concentration of iron ion stress. Figure 3 .

[0044] qRT-PCR detection: Further detection of the expression of the FvFTR1 gene. The total RNA of pPIC9:FvFTR1 was extracted from the cells that were cultured under normal conditions and after treatment with different concentrations of iron ions for 24 hours, and reverse transcribed to synthesize cDNA. The expression of the FvFTR1 gene in the recombinant yeast transformant pPIC9:FvFTR1 was detected by qRT-PCR. The results showed that the expression of FvFTR1 gradually decreased with the increase of iron concentration, and its expression was inhibited when the iron concentration was high. For related results, please refer to the attached Figure 4 .

Claims

1. Flammulina velutipes iron ion permease gene FvFTR1, characterized in that The nucleotide sequence of the Flammulina velutipes iron ion permease gene FvFTR1 is shown in SEQ ID NO.

1.

2. The protein encoded by the Flammulina velutipes iron ion permease gene FvFTR1 is characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. The primers used to amplify the Flammulina velutipes iron ion permease gene FvFTR1 according to claim 1 are characterized in that: For pCAMBIA1300-FvFTR1-F and pCAMBIA1300-FvFTR1-R, the nucleotide sequences are as follows: pCAMBIA1300-FvFTR1-F: 5'-GAGCTCGGTACCCGGGGATCCATGGCAAAAAACTTGTTCTC-3' pCAMBIA1300-FvFTR1-R: 5'-GCCCTTGCTCACCATGTCGACCTTCGGGAGTTCATGAAGGCT-3' The first 15 bases at the 5' end of the primer are vector homologous sequences, and the following 6 bases are restriction site sequences. These 21 bases do not belong to the FvFTR1 gene sequence, but are necessary for constructing a recombinant plant overexpression vector.

4. The primers used to amplify the Flammulina velutipes iron ion permease gene FvFTR1 according to claim 1, characterized in that: For pPIC9-FvFTR1-F and pPIC9-FvFTR1-R, the nucleotide sequences are as follows: pPIC9-FvFTR1-F: 5'-AGAATTCATGGCAAAAAACTTGTTCTCTG-3' pPIC9-FvFTR1-R: 5'-TTGCGGCCGCTTAGTGGTGGTGGTGGTGGTGCTTCGGGAGTTCATGAAG GCT-3' Among them, the first 7 bases at the 5' end of the pPIC9-FvFTR1-F primer are the restriction site sequence, the first 10 bases at the 5' end of the pPIC9-FvFTR1-R primer are the restriction site sequence, the next 3 bases are the stop codon sequence, and the next 18 bases are the 6×his tag, which are necessary for the construction of the yeast expression vector.

5. A plant overexpression vector containing the Flammulina velutipes iron ion permease gene FvFTR1 according to claim 1, characterized in that: It is pCAMBIA1300-35S-GFP-FvFTR1.

6. Use of the plant overexpression vector of Flammulina velutipes iron ion permease gene FvFTR1 according to claim 5, characterized in that: Application of pCAMBIA1300-35S-GFP-FvFTR1 in subcellular localization in tobacco.

7. A yeast overexpression vector containing the Flammulina velutipes iron ion permease gene FvFTR1 according to claim 1, characterized in that: It is pPIC9-FvFTR1.

8. Use of the yeast overexpression vector of Flammulina velutipes iron ion permease gene FvFTR1 according to claim 7, characterized in that: The application of pPIC9-FvFTR1 in improving the iron ion tolerance of yeast.

Images