Application of rice os3bglu6 gene in plant growth

Abstract

The application provides an application of a rice Os3BGlu6 gene in plant growth, and belongs to the field of plant genetic engineering. The application comprises: overexpression of the Os3BGlu6 gene is used for promoting plant growth. The application comprises: overexpression of the Os3BGlu6 gene is used for promoting plant growth, including increasing root hair length, density and biomass, by increasing the mRNA expression level of the Os3BGlu6 gene, the nitrogen utilization level of the rice plant under low nitrogen can be improved, and the effective tiller number of the mature rice can be improved. Based on this, the gene has wide application prospect and value in regulating the water absorption, nutrient absorption and tillering capacity of rice, and can be used for crop genetic precision improvement breeding.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to the field of plant genetic engineering, and in particular to an application of a rice Os3BGlu6 gene in plant growth. BACKGROUND

[0002] Rice (Oryza sativa L.) is an important food crop in the world, and more than half of the world's population relies on it as their main food. In recent years, scientific research has shown that differences in plant shape, fertility, stress resistance, and yield are closely related to the physiological state and growth vigor of the root system. Root hairs are a special structure formed by the protrusion of epidermal cells in the elongation zone of the root system, which accounts for 80% of the surface area of the root system, and play an important role in water and nutrient absorption, soil anchoring, and microbial interaction.

[0003] In today's context of implementing the concept of green development and developing a resource-saving and environment-friendly agricultural production system, using root hair genetic regulation key genes to carry out molecular improvement of rice root hairs will greatly improve the utilization rate of water and fertilizer in rice varieties themselves, reduce the waste of human and material resources, and reduce the pollution caused by the loss of large amounts of chemical fertilizers and pesticides to the environment. However, the regulatory mechanism of rice root hair development is still unclear. Therefore, exploring rice root hair development regulation genes with independent intellectual property rights and applying them to molecular genetic improvement of rice root systems is of great significance for improving the international competitiveness of China's crop breeding and developing sustainable and efficient green agriculture.

[0004] DISCLOSURE

[0005] To solve the problems of the prior art, the present disclosure provides an application of a rice Os3BGlu6 gene in plant growth. The technical solution is as follows:

[0006] The present disclosure provides an application of a rice Os3BGlu6 gene in plant growth, which includes: overexpression of the Os3BGlu6 gene to promote plant growth.

[0007] Specifically, the application further includes: overexpression of the Os3BGlu6 gene to increase root hair length, density, and biomass.

[0008] Specifically, the application further includes: overexpression of the Os3BGlu6 gene to improve the plant's ability to absorb nitrogen under low nitrogen conditions.

[0009] Specifically, the application further includes: overexpression of the Os3BGlu6 gene to improve the plant's tillering ability at the mature stage.

[0010] Further, the application further includes:

[0011] extracting total RNA from a rice material;

[0012] reverse transcribing the total RNA to obtain cDNA;

[0013] amplifying the cDNA as a template using a forward primer and a reverse primer to obtain an amplification product, i.e., a coding region of the Os3BGlu6 gene, a sequence of the amplification product is shown as SEQ ID NO: 1 in the sequence listing, a sequence of the forward primer is shown as SEQ ID NO: 2 in the sequence listing, and a sequence of the reverse primer is shown as SEQ ID NO: 3 in the sequence listing.

[0014] Specifically, the rice material is Zhonghua 11.

[0015] Specifically, 25 μL of the amplification system comprises: 0.5 μL of cDNA, 12.5 μL of 2xKOD-FX Buffer, 5 μL of 2 mM dNTP, 0.5 μL of KOD enzyme, 0.2 μL of the forward primer with a concentration of 10 μm, 0.2 μL of the reverse primer with a concentration of 10 μm, and 6.1 μL of water.

[0016] Specifically, the amplification program comprises: 98℃ pre-denaturation for 2 min; and then 32 amplification cycles, each cycle comprising: 98℃ denaturation for 15 sec, 60℃ annealing for 15 sec, and 60℃ extension for 90 sec; and 68℃ final extension for 5 min.

[0017] Specifically, the application further comprises: connecting the amplified product after enzyme digestion with the pU1301 vector after enzyme digestion to obtain a ligation product; transferring the ligation product into an E. coli competent cell through an electroporation method to obtain a monoclonal cell after culture; and introducing the monoclonal cell into a receptor material through an Agrobacterium-mediated method to obtain a transgenic plant.

[0018] The technical scheme provided by the embodiments of the present disclosure has the beneficial effects that the present disclosure provides an application of a rice Os3BGlu6 gene in plant growth, which comprises: overexpression of the Os3BGlu6 gene to promote plant growth, including increasing the length, density and biomass of root hairs, improving the nitrogen utilization level of rice plants under low nitrogen by increasing the mRNA expression level of the Os3BGlu6 gene, and increasing the effective tiller number of mature rice. Based on this, the gene has broad application prospects and value in regulating the water absorption, nutrient absorption and tillering ability of rice, and can be used for genetic precision improvement breeding of crops. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings needed to be used in the embodiments will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present disclosure, and other drawings can be obtained by those skilled in the art without creative effort based on these drawings.

[0020] Figure 1 is a Pu1301 vector map provided by the embodiments of the present disclosure;

[0021] Figure 2 is a structure diagram of Pu1301-Os3BGlu6 provided by the embodiments of the present disclosure;

[0022] Figure 3 is a statistical diagram of mRNA expression level of Os3BGlu6 gene provided by the embodiments of the present disclosure, wherein the expression level of wild type plant WT is set as 1, and the asterisk indicates significant difference;

[0023] Figure 4 is a root hair phenotype diagram of wild type plant WT provided by the embodiments of the present disclosure;

[0024] Figure 5 is a partial enlarged view of Figure 4 ;

[0025] Figure 6 is a root hair phenotype diagram of OE1 provided by the embodiments of the present disclosure;

[0026] Figure 7 is a partial enlarged view of Figure 6 ;

[0027] Figure 8 is a root hair phenotype diagram of OE2 provided by the embodiments of the present disclosure;

[0028] Figure 9 is a partial enlarged view of Figure 8 ;

[0029] Figure 10 is a root hair phenotype diagram of OE3 provided by the embodiments of the present disclosure;

[0030] Figure 11 is a partial enlarged view of Figure 10 ;

[0031] Figure 12 is a statistical diagram of plant root hair length provided by the embodiments of the present disclosure;

[0032] Figure 13 is a statistical diagram of plant root hair density provided by the embodiments of the present disclosure;

[0033] Figure 14is a plant root hair biomass statistical chart provided by the embodiments of the present disclosure;

[0034] Figure 15 is a comparison chart of growth conditions of wild type WT and OE1, OE2 and OE3 plants under normal vegetative growth conditions provided by the embodiments of the present disclosure;

[0035] Figure 16 is a comparison chart of growth conditions of wild type WT and OE1, OE2 and OE3 plants under low-nitrogen vegetative growth conditions provided by the embodiments of the present disclosure;

[0036] Figure 17 is a comparison chart of mature plant phenotypes of wild type WT and OE1, OE2 and OE3 plants overexpressing Os3BGlu6 genes provided by the embodiments of the present disclosure;

[0037] Figure 18 is a comparison chart of mature wild type WT and OE1, OE2 and OE3 plants provided by the embodiments of the present disclosure. DETAILED DESCRIPTION

[0038] In order to make the purpose, technical solutions and advantages of the present disclosure clearer, the embodiments of the present disclosure will be described in further detail below with reference to the drawings.

[0039] EMBODIMENTS

[0040] The present disclosure provides an application of a rice Os3BGlu6 gene in improving root hairs, which comprises: using overexpression of the Os3BGlu6 gene to promote root hair growth.

[0041] Specifically, the application further comprises: using overexpression of the Os3BGlu6 gene to increase root hair length, density and biomass.

[0042] Specifically, the application further comprises: using overexpression of the Os3BGlu6 gene to improve the absorption capacity of nitrate nitrogen.

[0043] Specifically, the application further comprises: using overexpression of the Os3BGlu6 gene to improve the tillering capacity of mature rice.

[0044] Further, the application further comprises:

[0045] extracting total RNA from the rice material;

[0046] reverse transcribing the total RNA to obtain cDNA;

[0047] The cDNA was used as a template, and a forward primer and a reverse primer were used for amplification, so as to obtain an amplification product, i.e., a coding region of the Os3BGlu6 gene. The sequence of the amplification product is shown in SEQ ID NO: 1 in the sequence listing, the sequence of the forward primer is shown in SEQ ID NO: 2 in the sequence listing, and the sequence of the reverse primer is shown in SEQ ID NO: 3 in the sequence listing. The sequence of the forward primer is: TTAGGTACCATGGGGAGGATAAAGAGTAGTA. The sequence of the reverse primer is: TTAGGATCCTCAGGTCTTCAGGAGGGCCTT.

[0048] Specifically, the rice material is Zhonghua 11.

[0049] In this embodiment, the roots of Zhonghua 11 (provided by the Crop Science Institute of Chinese Academy of Agricultural Sciences) grown for 5 days were taken as the sample to be tested, and the total RNA was extracted by using a Trizol extraction kit of Invitrogen Company (see the instruction of the kit for specific operation steps).

[0050] The total RNA was subjected to reverse transcription to obtain cDNA.

[0051] Specifically, ① a mixed solution 1 was prepared, and the mixed solution 1 included: 4 μg of total RNA, 2 U of DNase I, 1 μL of 10×DNase I buffer, and DEPC-treated water to 10 μL. The DEPC-treated water was 0.01% DEPC, and the mixed solution 1 was mixed uniformly and then was placed at 37°C for 20 minutes to remove DNA; ② the mixed solution 1 was placed in a 65°C water bath for 10 minutes to remove the activity of DNAse I, and then was placed on ice for 5 minutes; ③ 1 μL of oligo(dT) with a concentration of 500 μg / mL was added to the mixed solution 1 cooled on ice; ④ the mixed solution 1 cooled on ice was immediately placed in a 65°C water bath for 10 minutes to completely denature the RNA, and then was placed on ice for 5 minutes; ⑤ a mixed solution 2 was prepared, and the mixed solution 2 included: 10 μL of the mixed solution 1, 4 μL of 5×First-Strand Buffer, 2 μL of 0.1M DTT (mercaptoethanol), 1.5 μL of 10 mM dNTP mixture, 0.5 μL of DEPC-treated water, and 2 μL of reverse transcriptase. The mixed solution 2 was mixed uniformly and then was placed in a 42°C water bath for 1.5 hours; ⑥ after the reaction, the mixed solution 2 was placed in a 90°C dry bath for 10 minutes to obtain a final product; and ⑦ the final product was stored at -20°C. All the reagents used in the reverse transcription process were purchased from the Invitrogen Company.

[0052] The amplification product is obtained by using forward primer and reverse primer for PCR (Polymerase Chain Reaction) amplification with cDNA as template. Each 25 μL amplification system comprises: cDNA 0.5 μL, 2×KOD-FX Buffer 12.5 μL, 2 mM dNTP 5 μL, KOD enzyme 0.5 μL, forward primer with a concentration of 10 μm 0.2 μL, reverse primer with a concentration of 10 μm 0.2 μL, and water to 25 μL. In this embodiment, 2×KOD-FX Buffer and KOD enzyme are purchased from Tokyo Biochemicals (Shanghai) Co., Ltd. Specifically, the amplification program comprises: 98 ℃ pre-denaturation for 2 min; then 32 amplification cycles, each cycle comprising: 98 ℃ denaturation for 15 sec, 60 ℃ annealing for 15 sec, 60 ℃ extension for 90 sec; 68 ℃ final extension for 5 min, and finally stored at 4 ℃.

[0053] After the amplification product is purified, the enzyme cutting reaction is carried out. Specifically, 20 μL enzyme cutting reaction system comprises: 100 ng / μL amplification product 10 μL, Kpn1 endonuclease 1 μL, BamHI endonuclease 0.5 μL, 10×BamHI Buffer (Thermo Scientific) 2 μL, and water to 20 μL, 37 ℃ enzyme cutting reaction for 6 hours.

[0054] The pU1301 vector is cut, wherein the pU1301 vector map is as shown in Figure 1 Specifically, 20 μL pU1301 vector enzyme cutting reaction system comprises: pU1301 (200 ng / μL) 10 ul, Kpn1 endonuclease 2 μL, BamHI endonuclease 1 μL, 10×BamHI Buffer (Thermo Scientific) 2 μL, and water to 20 μL, 37 ℃ enzyme cutting reaction for 6 hours, to construct Pu1301-Os3BGlu6.

[0055] The PCR amplification product after enzyme cutting is connected with the Pu1301-Os3BGlu6 after enzyme cutting to construct DX-Os3BGlu6 (connection product). Specifically, 10 μL connection reaction system comprises: PCR amplification product after enzyme cutting (20-70 ng / μL) 7 μL, pU1301 vector plasmid after enzyme cutting (80 ng / μL) 1 μL, 10×NEB T4 DNA ligase Buffer 1 μL, NEB T4 DNA ligase 1 μL, 16 ℃ connection for 5 h, to obtain the connection product.

[0056] The amplified product after enzyme digestion is connected with the pU1301 vector after enzyme digestion to obtain a connection product; the connection product is transformed into an E. coli competent cell by an electrotransformation method, and a single colony is obtained after culture; the single colony is introduced into a receptor material by an Agrobacterium-mediated method to obtain a transgenic plant.

[0057] Specifically, the electrotransformation instrument used in the electrotransformation is a product of Eppendorf Company, and the voltage used is 1800V, and the operation method can be found in the instrument instruction. Specifically, the connection product is transformed into an E. coli DH10β competent cell (purchased from Promega Biotechnology Co., Ltd., USA), and is cultured on an LA (the LA formula is described in J. Sambrook, EF Fritsch, T Maniatis, Huang Peitang, Wang Jiaxi, et al. Molecular Cloning Laboratory Guide (3rd Edition), Science Press, 2002) resistant medium containing 250 ppm kanamycin (purchased from Roche Biotechnology Co., Ltd.). Then, the colony is cultured, specifically including: on a clean bench, a single colony grown on the LA resistant medium is inoculated into a sterilized 10 mL centrifuge tube, 3 mL of LB resistant medium containing 250 ppm kanamycin is added in advance, and then the centrifuge tube is cultured on a 37°C shaker for 16-18 hours. After the culture is completed, the plasmid is extracted according to the method reported in J. Sambrook and D. W. Russell, Huang Peitang, et al. Molecular Cloning Laboratory Guide, Science Press, 2002, and is subjected to restriction enzyme digestion and electrophoresis detection, and a clone with correct size is selected for sequencing verification. The correct clone is electrotransformed into Agrobacterium, and the above-mentioned connection product is introduced into a rice japonica receptor variety Zhonghua 11 (ZH11) by an Agrobacterium-mediated transgenic method (Wu et al., 2003. Development of enhancer trap lines for functional analysis of the rice genome. Plant J. 35:418-427) to obtain a transgenic plant Pu1301-Os3BGlu6, see Figure 2 .

[0058] Identification of Pu1301-Os3BGlu6 transgenic positive plants. According to the coding region sequence of Os3BGlu6 gene (SEQ ID NO: 1), primers were designed for PCR amplification. After amplification of the Os3BGlu6 gene with the primer, transgenic positive plants were identified by electrophoresis. The amplification system was 20 μL, specifically including: DNA template 0.5 μL, 10x PCR Mixture (purchased from Zhuangmeng Biological Co., Ltd.) 10 μL, forward primer 0.4 μL, reverse primer 0.4 μL, and water to 20 μL. Specifically, the amplification program included: 95°C pre-denaturation for 5 min; then 32 amplification cycles, each cycle including: 95°C denaturation for 30 sec, 55°C annealing for 30 sec, and 72°C annealing for 60 sec.

[0059] The sequence of the forward primer is: TTAGGTACCATGGGGAGGATAAAGAGTAGTA (as shown in SEQ ID NO: 2 in the sequence listing);

[0060] The sequence of the reverse primer is: TTAGGATCCTCAGGTCTTCAGGAGGGCCTT (as shown in SEQ ID NO: 3 in the sequence listing).

[0061] Analysis of the mRNA expression level of Os3BGlu6 gene. The transgenic positive plants were subjected to quantitative PCR detection, and the PCR amplification system was 10 μL, specifically including: cDNA template 2 μL, 2x SYBR Buffer (purchased from Baobiobiological Co., Ltd.) 5 μL, first forward primer, first reverse primer, second forward primer, and second reverse primer each 0.2 μL, and water to 10 μL. Specifically, the amplification program included: 95°C pre-denaturation for 10 min; then 45 amplification cycles, each cycle including: 95°C denaturation for 15 sec, 60°C annealing for 60 sec.

[0062] The sequence of the first forward primer qOs3BGlu6-F is: GATGAGGAGCCTGATGAACTATG (as shown in SEQ ID NO: 4 in the sequence listing);

[0063] The sequence of the first reverse primer qOs3BGlu6-R is: GATGGAAATGAACGGGTTGTTG (as shown in SEQ ID NO: 5 in the sequence listing);

[0064] The sequence of the second forward primer qUbiquitin1-F is: AACCAGCTGAGGCCCAAGA (as shown in SEQ ID NO: 6 in the sequence listing);

[0065] Second reverse primer qUbiquitin1-R: ACGATTGATTTAACCAGTCCATGA (as shown in SEQ ID NO: 7 in the sequence listing);

[0066] The first forward primer, the first reverse primer, the second forward primer and the second reverse primer were all synthesized by ShangHai Genechem Co., Ltd.

[0067] Using Ubiquitin1 as the internal reference gene, the mRNA expression level of Os3BGlu6 gene was detected by qRT-PCR, and the analysis was performed by T method, and the analysis results are shown in ΔΔ Figures 3 to 6 As shown in Figure 3 , the mRNA expression level of Os3BGlu6 gene in the root system of Pu1301-Os3BGlu6 transgenic plant OE1, OE2 and OE3 was increased by 71.5 times, 704.3 times and 1337.6 times, respectively, compared with the control group. The overexpression type OE1, OE2 and OE3 and wild type WT were respectively planted in a 1 / 2MS culture plate (13cm x 13cm) in a 28°C incubator (16h / 8h) vertical culture for 4 days. The root hair phenotype of OE1, OE2 and OE3 and the control group (wild type WT) was observed, and the results are shown in Figures 4 to 11 . By comparison, it can be known that the root hair length and density of OE1, OE2 and OE3 plants are better than those of the control group. At the same time, the results of root hair length, density and root hair biomass analysis are shown in Figures 12 to 14 . As shown in Figures 12 to 14 , compared with the wild type WT, the root hair length, root hair density and root hair biomass of the transgenic plants OE1, OE2 and OE3 were significantly increased. The results show that increasing the mRNA expression level of Os3BGlu6 gene can significantly promote the growth of rice root hair.

[0068] The 7-day germinated OE1, OE2 and OE3 and wild type WT plants were respectively cultured in low-nitrogen (0.2mM KNO3) nutrient solution and normal nutrient solution for 15 days. As shown in Figure 15 and Figure 16 , it was observed that the above-ground growth of OE1, OE2 and OE3 was significantly greater than that of wild type WT under low-nitrogen nutrient solution, which indicated that the absorption function of nitrate nitrogen of rice was enhanced after increasing the mRNA expression level of Os3BGlu6 gene, so that the low-nitrogen tolerance of rice was improved.

[0069] The mature plant phenotype was observed, as shown in Figure 17 . The phenotype was counted, as shown in Figure 18 . As shown in Figure 18 ​It can be seen that the tiller number of OE1, OE2 and OE3 plants is significantly more than that of the wild type, which indicates that after the mRNA expression level of Os3BGlu6 gene is increased, the water and nutrient utilization ability of rice is improved, so that the tiller number is increased.

[0070] The above only describes optional embodiments of the present disclosure and is not intended to limit the present disclosure. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. Use of overexpression of Os3BGlu6 gene in increasing the length and density of root hairs of rice, wherein the coding region sequence of the Os3BGlu6 gene is shown as SEQ ID NO: 1 in the sequence listing.

2. Use of overexpression of Os3BGlu6 gene in increasing the tillering of rice, wherein the coding region sequence of the Os3BGlu6 gene is shown as SEQ ID NO: 1 in the sequence listing.

3. Use according to any one of claims 1 to 2, characterized in that, The use further comprises: extracting total RNA from rice material; reverse transcribing the total RNA to obtain cDNA; amplifying the cDNA as a template using a forward primer and a reverse primer to obtain an amplification product, i.e., the coding region of the Os3BGlu6 gene, wherein the sequence of the amplification product is shown as SEQ ID NO: 1 in the sequence listing, the sequence of the forward primer is shown as SEQ ID NO: 2 in the sequence listing, and the sequence of the reverse primer is shown as SEQ ID NO: 3 in the sequence listing.

4. Use according to claim 3, characterized in that, The rice material is Zhonghua 11.

5. Use according to claim 3, characterized in that, Each 25 μL amplification system comprises: cDNA 0.5 μL, 2×KOD-FX Buffer 12.5 μL, 2 mM dNTP 5 μL, KOD enzyme 0.5 μL, forward primer with a concentration of 10 μm 0.2 μL, reverse primer with a concentration of 10 μm 0.2 μL, and water 6.1 μL.

6. Use according to claim 3, characterized in that, The amplification procedure comprises: pre-denaturation at 98℃ for 2 min; and then 32 amplification cycles, each cycle comprising: denaturation at 98℃ for 15 sec, annealing at 60℃ for 15 sec, and extension at 60℃ for 90 sec; and final extension at 68℃ for 5 min.

7. Use according to claim 3, characterized in that, The use further comprises: connecting the amplified product after enzyme digestion with the pU1301 vector after enzyme digestion to obtain a ligation product; transferring the ligation product into E. coli competent cells by electroporation to obtain monoclonal cells after culture; and introducing the monoclonal cells into a receptor material by Agrobacterium-mediated method to obtain a transgenic plant.

Images