Application of GhLOG8 protein and its encoding gene in regulating resistance to Verticillium wilt in upland cotton

By silencing or knocking out the GhLOG8 gene in cotton and using gene silencing and CRISPR/Cas9 technology to regulate the content and activity of GhLOG8 protein, the problem of regulating cotton wilt resistance was solved, and the disease resistance and breeding efficiency of cotton were improved.

CN120026054BActive Publication Date: 2025-09-12THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510520091.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-24
Publication Date
2025-09-12
Estimated Expiration
2045-04-24

AI Technical Summary

Technical Problem

The existing technology lacks effective means to regulate the Verticillium wilt resistance of upland cotton, especially to increase or decrease the resistance of cotton to Verticillium dahliae by regulating the GhLOG8 protein and its encoding gene.

Method used

The content and activity of GhLOG8 protein were reduced by gene silencing and CRISPR/Cas9 technology. The GhLOG8 gene was silenced or knocked out in cotton using virus-induced gene silencing vectors and CRISPR/Cas9 vectors. The function of GhLOG8 gene was studied in Arabidopsis thaliana by overexpressing the GhLOG8 gene.

Benefits of technology

It significantly improved cotton's resistance to Verticillium wilt, enhanced cotton's stress resistance and yield, simplified the breeding process, and provided an efficient method for breeding disease-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120026054B_ABST
    Figure CN120026054B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of plant genetic engineering technology and discloses the application of GhLOG8 protein and its encoding gene in regulating the resistance of upland cotton to Verticillium wilt. The protein meets the following conditions: B1) the amino acid sequence of the protein is SEQ ID No. 2; B2) a fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of B1). GhLOG8 Disease resistance of transgenic cotton after gene knockout was identified. The results showed that the disease index and relative fungal biomass of the transgenic cotton were significantly reduced, and the resistance to Verticillium wilt was significantly enhanced. Therefore, the GhLOG8 protein and its encoding gene of the present invention can regulate the disease resistance of plants and are of great significance for the cultivation of transgenic cotton resistant to Verticillium wilt.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and relates to the application of GhLOG8 protein and its encoding gene in regulating the resistance of upland cotton to Verticillium wilt. Background Art

[0002] Upland cotton ( Gossypium hirsutum L.) belongs to the Malvaceae family ( Malvaceae ) Cotton ( GossypiumCotton fiber is the primary raw material for the textile industry, and cottonseed also provides a large amount of cottonseed oil and cottonseed protein, playing a vital role in the national economy (Wei F, Zhao L, Xu X, et al. Cultivar-Dependent Variation of the Cotton Rhizosphere and Endosphere Microbiome Under Field Conditions[J]. Front Plant Sci, 2019, 10: 1659). Verticillium wilt, the most important disease of cotton growth, is known as the "cancer of cotton." It not only causes leaf shedding but can also lead to severe yield reductions or even complete crop failure, seriously threatening cotton production safety (Zhu Heqin; Li Zhifang; Feng Zili; Feng Hongjie; Wei Feng; Zhao Lihong; Shi Yongqiang; Liu Shichao; Zhou Jinglong. A Ten-Year Review and Prospect of Cotton Verticillium Wilt Research in my country[J]. Cotton Science, 2017(S1):45-58). Verticillium wilt is a soil-borne vascular disease with a wide host range, infecting more than 600 plant species, primarily affecting dicotyledons (Chen JY, Liu C, Gui YJ, et al. Comparative genomics reveals cotton-specific virulence factors in flexible genomic regions in Verticillium dahliae and evidence of horizontal gene transfer from Fusarium[J]. New Phytol, 2018, 217(2): 756-770). Its pathogen is Verticillium dahliae, which is the most destructive and widely distributed (R. Gams Zare. Gibellulopsis, a suitable genus for Verticillium nigrescens, and Musicillium, a new genus for V. theobromae[J]. Nova Hedwigia, 2007(3-4): 463-489). The pathogen survives in the soil for decades in the form of microsclerotia (Zhang DD, Wang J, Wang D, et al. Population genomics demystifies the defoliation phenotype in the plant pathogen Verticillium dahliae[J]. New Phytol, 2019, 222(2): 1012-1029). Under suitable temperature and soil conditions, it rapidly infects the roots of cotton and spreads along the vascular bundles, resulting in obstruction of nutrient transport in the plant, ultimately causing leaf shedding and severe yield reduction (Kang Liru, Liu Yan, Yang Yongfeng, et al. Research progress on Verticillium dahliae and its pathogenic mechanism [J]. Modern Agriculture, 2022, (03): 49-51).

[0003] Verticillium wilt has a complex infection mechanism. Screening for disease-resistant genes to enhance cotton's resistance to Verticillium dahliae (Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Multiplex genome engineering using CRISPR / Cas systems. Science, 2013, 339(6121): 819-23) can not only reduce the infection and spread of the pathogen but also improve cotton's stress resistance and yield. CRISPR-Cas9 gene editing technology provides a new entry point for this research (Wei G, Lu L, Xinquan T, et al. Genome Editing in Cotton with the CRISPR / Cas9 System[J]. Frontiers in Plant Science, 2017, 8:1364). The CRISPR / Cas9 system can precisely edit disease-resistant genes in cotton, providing powerful technical support for breeding highly resistant cotton varieties (Liu D, Hu R, Palla KJ, Tuskan GA, Yang X. Advances and perspectives on the use of CRISPR / Cas9 systems in plant genomics research. Curr Opin Plant Biol, 2016, 30: 70-77). Furthermore, by generating stable genetic mutations, this system can create transgenic plants without Cas9 or selection markers, significantly simplifying the cotton breeding process and timeline (Zhang Y, Liang Z, Zong Y, Wang Y, Liu J, Chen K, Qiu JL, Gao C. Efficient and transgene-free genome editing in wheat through transient expression of CRISPR / Cas9 DNA or RNA. Nat Commun, 2016, 7: 126-17).

[0004] Virus-induced Gene Silencing (VIGS) is a genetic immune mechanism commonly found in plants and is a type of post-transcriptional gene silencing. When a viral vector carrying endogenous gene fragments infects a host plant, it can activate the plant's own immune system; while recognizing and degrading viral RNA, it also produces microRNA containing the endogenous target gene. These microRNAs bind to the mRNA of the target gene and are then degraded by the Dicer enzyme, thereby reducing the expression level of the target gene or causing loss of function. Among them, gene silencing induced by Tobacco Rattle Virus (TRV) (TRV-VIGS) has become the most widely used gene silencing system due to its high silencing efficiency, long duration, mild viral symptoms in the host plant, no masking of the silenced phenotype, and the ability to produce gene silencing in various tissues. TRV-VIGS has been successfully applied to plants of the Solanum family, such as tomato, tobacco, pepper, Arabidopsis, jatropha, petunia, and others. Plants CLA1 The gene encodes 1-deoxyxylulose 5-phosphate synthase, which is involved in chloroplast development and is highly conserved in evolution. CLA1 gene mutants cla1-1 It has a distinct albinism phenotype, which is an easily identifiable marker trait. Cotton is an important economic crop in the world. In recent years, there have been reports on the construction and application of TRV-VIGS system. CLA1 Gao et al. designed target silencing fragments based on gene sequences. They established a cotton TRV-VIGS system based on Agrobacterium-mediated silencing and successfully applied it to 6 cotton varieties with different genetic backgrounds, laying the foundation for the identification of important gene functions in cotton (Gao X, Britt RC, Shan L, He P. Agrobacterium-Mediated Virus-Induced Gene Silencing Assay In Cotton[J]. J Vis Exp, 2011(54):e2938-e2938). TRV virus was further used to inhibit cotton wilt resistance-related genes. GhNDR1 and GhMKK2Expression of TRV-VIGS makes cotton receptors more susceptible to disease, and the gene function was quickly identified (Gao X, Wheeler T, Li Z, Kenerley CM, He P, Shan L. Silencing GhNDR1and GhMKK2 compromises cotton resistance to Verticillium wilt[J]. Plant Journal, 2011, 66(2):293-305). However, whether TRV-VIGS can be widely applied to various cotton varieties, that is, whether the system is affected by the host genotype, is still unclear, and no relevant research reports have been found. With the rapid progress of cotton genome research, a large amount of cotton expression sequence information has been released in public databases, and the functions of a large number of important cotton genes need to be further identified.

[0005] In recent years, significant progress has been made in the discovery and functional analysis of key genes that negatively regulate cotton Verticillium wilt resistance. During pathogen infection, the key protein kinase BIN2, a brassinosteroid signaling pathway, inhibits the expression of genes related to the jasmonic acid (JA) pathway, thereby reducing cotton resistance to Verticillium dahliae (Song Y, Zhai Y, Li L, et al. BIN2 negatively regulates plant defense against Verticillium dahliae inArabidopsis and cotton[J]. Plant Biotechnology Journal, 2021, 19(10): 2097-2112). GhCPK33 The encoded calcium-dependent protein kinase plays a role in the calcium signaling pathway. After pathogen infection activates this gene, it interferes with the mitogen-activated protein kinase (MAPK) cascade, inhibits the expression of disease-resistant genes, and reduces cotton resistance to Verticillium dahliae (Hu Q, Zhu L, Zhang X, et al. GhCPK33 negatively regulates defense against Verticillium dahliae by phosphorylating GhOPR3[J]. Plant Physiology, 2018, 178(2): 876-889). GhABC Is a gene encoding an ATP-binding cassette (ABC) transporter. GhABCAfter that, the accumulation of related metabolites increased, and cotton showed stronger resistance (Malik WA, Afzal M, Chen X, et al. Systematic analysis and comparison of ABC proteins superfamily conferstructural, functional and evolutionary insights into four cotton species[J]. Industrial Crops and Products, 2022, 177: 114433). GhAPX1 Encodes ascorbate peroxidase, which is activated when pathogens cause a burst of reactive oxygen species. GhAPX1 High expression of HSP70 and APX1 will excessively clear ROS, thereby weakening cotton's resistance to Verticillium wilt (Ma L, Zhang T, Zhu QH, et al. HSP70 and APX1 play important roles in cotton male fertility by mediating ROS homeostasis[J]. International Journalof Biological Macromolecules, 2024, 278: 134856). GhHDA5 It encodes a histone deacetylase that removes histone acetylation modifications in gene promoter regions, changes chromatin structure, hinders the binding of transcription factors, thereby inhibiting the expression of key disease resistance genes and interfering with the JA signaling pathway (Wei C, Wang C, Zhang X, et al. Histone deacetylase GhHDA5 negatively regulates Verticillium wilt resistance in cotton[J]. Plant Physiology, 2024, 196(4): 2918-2935). QHQM1GhiQM1 is a regulator of the calcium signaling pathway, negatively regulating the salicylic acid (SA) pathway, thereby reducing the efficiency of disease resistance signaling pathways (Li MJ, Lei JF, Zulipiye T, et al. Cloning and functional verification of the GhiQM1 gene of cotton in response to Verticillium wilt[J]. 2022). In summary, in-depth research on these negative regulatory genes not only deepens our understanding of the molecular mechanisms of cotton resistance to Verticillium wilt but also provides potential molecular targets for breeding highly resistant cotton varieties. This could fundamentally prevent and control the damage caused by Verticillium wilt, accelerate the selection of Verticillium wilt-resistant cotton varieties, promote the commercialization of cotton breeding, and effectively address the shortage of disease-resistant varieties in production. Improving cotton resistance to Verticillium wilt through genetic means is not only the most cost-effective solution but also crucial for ensuring cotton quality and high and stable yields. It also has broad application value in the field of cotton molecular breeding. Summary of the Invention

[0006] In the early stage of our laboratory, we conducted transcriptome analysis on plants inoculated with Verticillium dahliae and found a large number of differentially expressed genes (DEGs). GhLOG8 , XM_016827497.2). This gene has no known function in plants. Its coding sequence is 918 bp long and encodes 305 amino acids.

[0007] The technical problem to be solved by the present invention is how to utilize the cotton cytokinin nucleotide hydrolase LOG8 and its encoding gene to regulate the disease resistance of upland cotton (such as increasing or decreasing the resistance of upland cotton to Verticillium wilt).

[0008] In order to achieve the above object, the present invention provides the following technical solutions:

[0009] A first aspect of the present invention provides an application for reducing protein content and / or activity, wherein the application is any one of the following:

[0010] A1) Application in improving resistance to Verticillium wilt in upland cotton;

[0011] A2) Use in the preparation of products that improve resistance to Verticillium wilt in upland cotton;

[0012] A3) Application in breeding upland cotton resistant to Verticillium wilt;

[0013] A4) Use in the preparation of products for breeding upland cotton resistant to Verticillium wilt;

[0014] A5) Application in breeding for Verticillium wilt resistance in upland cotton or improving Verticillium wilt resistance germplasm resources in upland cotton;

[0015] The protein is named GhLOG8 and meets the following conditions:

[0016] B1) a protein having an amino acid sequence of SEQ ID No. 2;

[0017] B2) A fusion protein with the same function as B1) is obtained by connecting a tag to the N-terminus and / or C-terminus.

[0018] In the above application, the protein GhLOG8 can be derived from cotton.

[0019] Furthermore, the protein GhLOG8 may be derived from upland cotton.

[0020] Furthermore, the protein GhLOG8 may be a cotton disease resistance-related protein GhLOG8, specifically a cotton Verticillium wilt resistance-related protein GhLOG8.

[0021] In order to facilitate purification or detection of the protein in B1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing.

[0022] The tag protein includes but is not limited to: GST (glutathione sulfhydryl transferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0023] The second aspect of the present invention provides the use of biomaterials related to the protein GhLOG8, wherein the use is any of the following:

[0024] D1) Application in improving resistance to Verticillium wilt in upland cotton;

[0025] D2) Application in the preparation of products that improve resistance to Verticillium wilt in upland cotton;

[0026] D3) Application in breeding upland cotton resistant to Verticillium wilt;

[0027] D4) Use in the preparation of products for breeding upland cotton resistant to Verticillium wilt;

[0028] D5) Application in breeding for Verticillium wilt resistance in upland cotton or improving Verticillium wilt resistance germplasm resources in upland cotton;

[0029] The biological material is any one of the following E1) to E7):

[0030] E1) a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein GhLOG8;

[0031] E2) an expression cassette containing the nucleic acid molecule described in E1);

[0032] E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2);

[0033] E4) A recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing

[0034] E3) a recombinant microorganism containing the recombinant vector;

[0035] E5) a transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2), or a transgenic plant cell line containing the recombinant vector of E3);

[0036] E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2);

[0037] E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2).

[0038] In the above application, the nucleotide sequence of the protein GhLOG8 encoding gene (CDS) is the nucleotide sequence shown in SEQ ID NO.1.

[0039] The third aspect of the present invention provides a method for cultivating plants resistant to Verticillium wilt, the method comprising reducing the content and / or activity of the protein GhLOG8 in a target plant to obtain a disease-resistant plant having higher Verticillium wilt resistance than the target plant, wherein the plant is upland cotton.

[0040] In the above method, reducing the content and / or activity of the protein GhLOG8 in the target plant is achieved by reducing the expression level of the gene encoding the protein GhLOG8 in the target plant.

[0041] In the above method, reducing the expression level of the gene encoding the protein GhLOG8 in the target plant is to use gene knockdown technology or gene knockout technology to reduce the expression level of the gene encoding the protein GhLOG8 in the target plant genome.

[0042] In the above method, the gene silencing technology is used to reduce the expression level of the gene encoding the protein GhLOG8 in the genome of the target plant by using a virus-induced gene silencing vector, and the virus-induced gene silencing vector is a recombinant vector constructed by forward integration of the nucleic acid molecule shown in SEQ ID No. 1 into a plasmid vector based on tobacco rattle virus.

[0043] In the above method, the gene silencing technology is used to reduce the expression level of the gene encoding the protein GhLOG8 in the target plant genome by using a CRISPR / Cas9 vector, and the CRISPR / Cas9 vector is a recombinant vector constructed based on the dual target sites sgRNA1: TCCAAGACAGTATATGATGGAGG and sgRNA2: GCATGAGCGCAAAGCTGCAATGG of the encoding gene.

[0044] Beneficial effects of the present invention:

[0045] The GhLOG8 protein and its encoding gene of the present invention can regulate disease resistance (such as Verticillium wilt resistance) in upland cotton. By reducing the GhLOG8 protein content and / or activity in the target plant (e.g., by inhibiting, silencing, or interfering with GhLOG8 gene expression), the disease resistance of the target plant can be significantly improved. Therefore, the cotton Verticillium wilt resistance-related protein GhLOG8 and its encoding gene have important theoretical and practical significance in regulating disease resistance in upland cotton. This invention is of great significance for the development of Verticillium wilt-resistant transgenic cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 for GhLOG8 Expression pattern identification heatmap.

[0047] Figure 2 Subcellular localization of GhLOG8 in tobacco leaves.

[0048] Figure 3 For target gene amplification and GhLOG8 recombinant plasmid construction: Figure 3 A in the figure is the target VIGS fragment amplification, where M is the Maker III molecular mass marker; lines 1: the VIGS fragment of GhLOG8 amplified in R15; Figure 3 B in the figure is the PCR detection of GhLOG8 recombinant plasmid bacterial solution, where M is Maker III molecular mass marker; lines 1: PCR of recombinant plasmid bacterial solution.

[0049] Figure 4 for GhLOG8 Identification of Verticillium wilt resistance in gene-silenced cotton plants: Figure 4 A in: albino phenotype; Figure 4B in the middle: VIGS silencing efficiency detection; Figure 4 C in: VIGS-silenced cotton GhLOG8 The disease occurrence of cotton after the gene was inoculated with Verticillium dahliae; Figure 4 D in the figure: biomass of Verticillium dahliae in cotton roots; Figure 4 E in: cotton disease index and disease grade.

[0050] Figure 5 Knockout GhLOG8 Enhance cotton seedling resistance to Verticillium wilt: Figure 5 A in: GhLOG8 Schematic diagram of the gene structure and two gene editing sites, sgRNA1 and sgRNA2; Figure 5 B: T2 generation strain GhLOG8 Sequencing results of gene knockout targets. The number of base deletions is indicated by a minus sign (-) followed by a number in parentheses. Figure 5 Figure C: Isolation and detection of Cas9: PCR amplification of the Cas9 fragment in TM-1; M, Maker III molecular mass marker; WT, wild-type TM-1 DNA (negative control); P, plasmid pCAMBIA2301-sgRNA-CRISPR plasmid DNA (positive control); Figure 5 D in: knockout GhLOG8 And the disease situation of cotton after inoculation with Verticillium dahliae; Figure 5 E in: cotton disease index; Figure 5 F in the figure: biomass of Verticillium dahliae in cotton roots.

[0051] Figure 6 Analysis of Verticillium wilt resistance in GhLOG8-overexpressing Arabidopsis thaliana: Figure 6 A in: GhLOG8 PCR detection of overexpression-positive plants; M: DNA marker III; OE1-5: PCR detection of positive seedlings; Positive control: plasmid pCAMBIA2300-GhLOG8; Negative control: WT wild type; Figure 6 B: Overexpression GhLOG8 Disease development in Arabidopsis thaliana after inoculation with Verticillium dahliae; Figure 6 C in transgenic Arabidopsis GhLOG8 Detection of relative gene expression; Figure 6 D in the middle: relative fungal biomass analysis of Arabidopsis; Figure 6 E in: Arabidopsis disease index. DETAILED DESCRIPTION

[0052] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0053] Example 1 GhLOG8 Functional identification of genes

[0054] Upland cotton varieties 'R15', TM1

[0055] The cotton VIGS vectors pTRV1, pTRV2, and pTRV2-CLA1; the highly pathogenic Verticillium dahliae strain V991; and related vectors such as the Escherichia coli DH5α strain and Agrobacterium tumefaciens EHA105, LBA4404, and K599 were provided by the Institute of Biotechnology, Chinese Academy of Agricultural Sciences. Cotton and Nicotiana benthamiana were sown in a 1:1 mixture of nutrient soil and vermiculite and cultured in a constant temperature and humidity chamber at 28°C with 16 h light / 8 h darkness.

[0056] Plant total RNA mini-preparation kit was purchased from Guangzhou Magen Biotechnology Co., Ltd.; plasmid mini-preparation kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; DNA Marker and reverse transcription kit MonScriptTMRTⅢ all-in-one Mix (with dsDNase) were purchased from Monad Biotechnology Co., Ltd.; 2× Taq PCR Mix was purchased from Beijing Adlai Biotechnology Co., Ltd.; restriction endonucleases EcoR Ⅰ, BamH I, Bbs Ⅰ, Kpn Ⅰ, and Sal Ⅰ were purchased from NEB (Beijing) Co., Ltd.; 2× Assembly Mix; and fluorescent quantitative kit 2× ChamQ Universal SYBR qPCR MasterMix were purchased from Nanjing Novozymes Biotechnology Co., Ltd.

[0057] Take 1 mL of V991 bacterial suspension and add it to CM medium (6 g / L yeast extract, 6 g / L acid hydrolyzed casein, and 10 g / L sucrose) containing kanamycin and carbenicillin antibiotics. Incubate at 28°C and 220 rpm for 4-5 days (d). Observe the spores under a microscope and count the spore concentration using a hemocytometer. When the spore concentration reaches 10 7cfu / mL, filter out the mycelium with 4 layers of gauze and collect the spore liquid. When the cotton grows to "two leaves and one heart", soak its roots in V991 spore suspension for 0 h, 0.5 h, 1 h, 2 h, 4 h, and 8 h, respectively, and extract RNA from the root, stem, and leaf tissues and reverse transcribe to synthesize cDNA. Q7 -RT-F / R and GhLOG8 -qRT-F / R (Table 1) qRT-PCR reaction was performed with three technical replicates for each sample. After the reaction, the Ct values ​​of the target gene and the internal reference gene were calculated using 2 -ΔΔCt Methods The relative expression levels of target genes were calculated.

[0058] To achieve the subcellular localization of GhLOG8 protein, this experiment used the online platform Plant-mPLoc (http: / / www.csbio.sjtu.edu.cn / bioinf / plant-multi / ) to predict the subcellular localization of GhLOG8 protein. Eco RI and Bam HI restriction site) primer amplification GhLOG8 The ORF sequence of the gene was obtained by amplification and inserted into Eco RI and Bam The recombinant plasmid was then inserted into the green fluorescent protein (GFP) gene expression vector pYBA1132 after double digestion with HI. The recombinant plasmid was then introduced into Agrobacterium tumefaciens EHA105 via freeze-transformation. Subsequently, 48 hours after the Agrobacterium suspension was injected into tobacco lower epidermal cells, the GFP fluorescence signal in the tobacco cells was observed using an LSM980 confocal laser scanning microscope (Zeiss, Jena, Germany) to determine the subcellular localization of the GhLOG8 protein. Since this experiment focused on observing GFP autofluorescence, the use of an additional chloroplast marker vector was not necessary.

[0059] This experiment was based on gene silencing induced by tobacco rattle virus. First, specific primers GhLOG8-VIGS-F / R (Table 1) were designed and PCR amplified. GhLOG8 Gene VIGS fragment, inserted into the pTRV2 multiple cloning site Eco RI and Bam HI. pTRV2 was transformed by freezing -GhLOG8 The plasmid was transformed into Agrobacterium GV3101. The Agrobacterium-mediated cotton VIGS operation was carried out according to the method of GAO et al. After the injection of VIGS bacterial solution, the injection of pTRV2- CLA1The silencing efficiency can be tested when the second true leaf shows a grid-like whitening of the veins. The first true leaf of the silenced plant and the control plant of the same size is taken, RNA is extracted and reverse transcribed into cDNA, and the silencing efficiency is detected by RT-qPCR using primers GhLOG8-qRT-F / R (Table 1).

[0060] Table 1 Primers used in this study

[0061]

[0062] Use the cotton inoculation method 1.4, soak the cotton root tissue in the spore solution for 5 minutes and then re-transplant it into the nutrient soil. After 14 days, observe the cotton phenotype and calculate the disease index. The disease is divided into 5 levels: Level 0, no disease; Level 1, 10-20% of the leaves wilt and yellow; Level 2, 20%-50% of the leaves wilt and yellow; Level 3, 50%-75% of the leaves wilt and yellow; Level 4, more than 75% of the leaves wilt and yellow or the plant apoptosis. The disease index calculation formula is: Disease index = [∑(number of diseased plants at each level × corresponding disease level) / (10 ×4 )] × 100. Cotton genomic DNA was extracted, and fungal biomass was detected in the ribosomal RNA gene ITS1 and ITS2 regions (Z29511) of Verticillium dahliae genomic DNA using primers Vd-ITS-F / R and an internal reference gene Q7 (Table 1). qRT-PCR reactions were performed on an ABI7500 Fast instrument, and data were analyzed by 2 -ΔΔCt Method analysis.

[0063] The experiment used the upland cotton variety TM-1 as the material. Plants were planted in nutrient soil and cultured in a light incubator with 16 hours of light / 8 hours of darkness, 28°C, and 70% humidity. Once the plants had fully expanded their first true leaf, they were ready for hairy root induction or genetic transformation.

[0064] The core of CRISPR / Cas9 vector construction is based on GhLOG8 Gene design target site. According to the design principle, the second and fourth exons were selected and designed into two sgRNAs, named sgRNA1 and sgRNA2 respectively. Bbs I restriction enzyme site and annealed to the pAtU6-26-SK plasmid using T4 ligase. Bbs I site to form the pSK-AtU6-sgRNA plasmid. Kpn I and SalI restriction endonuclease cut the pSK-AtU6-sgRNA plasmid and recovered the AtU6-sgRNA fragment, which was inserted into the p35S-Cas9-SK vector. The final constructed pAtU6-sgRNA-35S-Cas9-SK fragment was used Kpn I and Eco The fragment was digested with RI and cloned into the plant binary expression vector pCAMBIA2301 to obtain the CRISPR / Cas9 vector pCAMBIA2301-sgRNA-CRISPR.

[0065] Table 2 Target site sequences

[0066]

[0067] Cotton genetic transformation was performed using the Agrobacterium tumefaciens-mediated hypocotyl transformation method. Agrobacterium LBA4404 was used for genetic transformation, and K599 was used for hairy root induction. Agrobacterium was cultured in LB medium containing rifampicin and kanamycin until the OD 600 = 0.4-0.5, cotton hypocotyls were treated and co-cultured in MSB1 medium for 2 days. They were transferred to induction medium containing kanamycin and cephalosporin, and regenerated shoots were finally obtained. Hairy roots were induced using Agrobacterium rhizogenes K599 at different concentrations (OD 600 =0.4, 0.6, 0.8, and 1.0) were injected 1 cm from the stem of cotton seedlings. One month later, hairy roots were collected, DNA was extracted, and PCR was performed using primers to detect positive hairy roots and rule out Agrobacterium contamination.

[0068] 1.9 GhLOG8 Creation of transgenic Arabidopsis

[0069] To further explore the genes GhLOG8 The relationship between the pathogenicity of Verticillium dahliae and pYBA1132- GhLOG8 The construct was transformed into Agrobacterium GV3101, which was then used to transform wild-type Arabidopsis thaliana by floral dip. Seeds were collected to screen for transgenic lines. The resulting T1 seeds were then plated on MS medium containing G418 (100 μg / mL) for resistance screening. Arabidopsis plants that grew normally on the resistance medium were transplanted to soil, and positive plants were identified by PCR. These positive plants were then cultured to T2 seed generation.

[0070] To evaluate GhLOG8To investigate the disease resistance of transgenic Arabidopsis thaliana, three-week-old wild-type Arabidopsis Col-0 and overexpressing genotypes OE1 and OE3 (20 plants per group) were inoculated with Verticillium dahliae. Col-0 plants inoculated with water served as a negative control, while Col-0 plants inoculated with Verticillium dahliae served as a positive control. After 14 days, the Arabidopsis phenotypes were observed and the disease index was calculated. Disease is categorized into five levels, based on the percentage of diseased leaves relative to the total number of leaves: Level 0, no symptoms; Level 1, 1-33% of diseased leaves; Level 2, 34-66%; Level 3, 67-100%; and Level 4, plant death. The disease index is calculated as follows: Disease Index = [∑(number of diseased plants at each level × corresponding disease level) / (10 ×4 )] × 100. Arabidopsis thaliana genomic DNA was extracted, and fungal biomass was detected in the ITS1 and ITS2 regions (Z29511) of the ribosomal RNA gene in the genomic DNA of Verticillium dahliae. The primers used were Vd-ITS-F / R, and the internal reference gene was Q7 (Table 1). qRT-PCR reactions were performed on an ABI7500 Fast instrument, and data were analyzed by 2 -ΔΔCt Method analysis.

[0071] For identification GhLOG8 The expression pattern of the gene during the infection of cotton by pathogens was detected by real-time fluorescence quantitative qRT-PCR at 0, 0.5, 1, 2, 4, 8, 12, and 24 h in roots, stems, and leaves of cotton. GhLOG8 The expression of the gene in roots, stems, and leaves was significantly downregulated from 0 to 12 h, indicating that the gene may play a negative regulatory role in Verticillium dahliae infection in these tissues ( Figure 1 ). According to the results, GhLOG8 Its expression was significantly reduced in the early stage of Verticillium dahliae infection, indicating that it may play a negative regulatory role in the process of resistance to Verticillium dahliae infection.

[0072] GhLOG8 is predicted to be located in chloroplasts. Agrobacterium was used to transform tobacco leaves to make 35:: GhLOG8 - GFP Fusion gene and 35:: GFP Empty vectors were transiently expressed in tobacco leaf cells to determine the localization of GhLOG8. As shown in the figure, the fluorescence of empty GFP was distributed in both the cell membrane and the nucleus. GhLOG8 - GFP Green fluorescence was observed in the chloroplasts of epidermal cells of tobacco leaves with the fusion gene, and the green fluorescence was superimposed on the spontaneous red fluorescence of the chloroplasts to produce yellow light. The results showed that GhLOG8 was localized in the chloroplasts ( Figure 2 ).

[0073] 2.3 Silence GhLOG8 Improve cotton plant resistance to Verticillium wilt

[0074] Amplified from the cDNA of cotton variety R15 GhLOG8 Gene fragments ( Figure 3 A in the figure). The amplified target fragment is sequenced and compared with the target gene CDS library. The comparison results confirm that the gene sequence is consistent with the target sequence and can be used for the construction of VIGS vector. GhLOG8 The fragment was digested with the VIGS vector and then connected to obtain the recombinant vector. The recombinant plasmid was transformed into E. coli and then identified by bacterial liquid PCR ( Figure 3 The size of the fragment (B) was consistent with the expected gene fragment, confirming the successful construction of the VIGS recombinant plasmid. Further transformation into competent Agrobacterium tumefaciens GV3101 was performed for cotton VIGS gene silencing experiments.

[0075] 2.3.2 Silence GhLOG8 Improving cotton plants' resistance to Verticillium wilt

[0076] Two weeks after the injection of the bacterial solution, CLA1 The true leaves of the control plants showed albinism. Five silenced and control plants were selected, and leaf RNA was extracted for real-time quantitative PCR detection. GhLOG8 The results showed that the gene silencing efficiency GhLOG8 Genes are silenced, which can GhLOG8 The seedling function of the gene was studied.

[0077] 14 days after the control group and silenced group plants were inoculated with V991, GhLOG8 The silent group showed yellowing of individual leaves with downward curling of leaf margins, while the control group showed more severe symptoms of Verticillium wilt, including plant wilting, yellowing and falling of leaves. GhLOG8 The cotton plants in the silenced group and the control group were cut open at the cotyledon junction and observed under a stereo microscope. The vascular bundles of the cotton in the control group were observed to be brown, with more obvious brown stripes. GhLOG8 The disease index and relative fungal biomass of the silenced plants were significantly lower than those of the control group ( Figure 4 ). Therefore, it is speculated that GhLOG8 Genes play an important regulatory role in cotton's resistance to Verticillium wilt.

[0078] 2.4 Knockout GhLOG8 Enhance cotton seedling resistance to Verticillium wilt

[0079] Using the pCAMBIA2301-sgRNA-CRISPR vector system to isolate and isolate cotton GhLOG8The gene was knocked out in a targeted manner. T0 generation plants were obtained through Agrobacterium-mediated genetic transformation, and 5 positive transformants were identified by sequencing screening. Two homozygous mutant strains were successfully isolated from the T1 generation population through two consecutive generations of self-pollination screening, and genetically stable T2 generation materials were further cultivated and named KO1 and KO2 for subsequent research. Verticillium dahliae V991 was inoculated into wild-type and transgenic cotton, and the disease incidence of cotton was measured 14 days after inoculation. A more resistant phenotype was observed in the transgenic lines KO1 and KO2, with less wilting and yellowing ( Figure 5 D in the figure). Compared with the wild type, the disease index and fungal biomass of the transgenic plants were significantly reduced ( Figure 5 E in Figure 5 F in). The experimental results showed that knockout GhLOG8 The gene has a positive effect on plant resistance to Verticillium dahliae. GhLOG8 It is a negative regulatory factor for cotton resistance to Verticillium dahliae.

[0080] 2.5 turns GhLOG8 Analysis of the resistance of Arabidopsis thaliana to Verticillium wilt

[0081] The T2 generation overexpression transgenic GhLOG8 The Arabidopsis thaliana gene was PCR amplified ( Figure 6 The T2 transgenic Arabidopsis plants were named OE-1, OE-2, OE-3, OE-4 and OE-5, and RNA was extracted for semi-quantitative analysis. GhLOG8 The expression levels of the genes were screened and two strains, OE1 and OE3, with different expression levels, were selected as the subjects for subsequent experimental analysis. V991 was inoculated into unbolted wild-type Arabidopsis and transgenic Arabidopsis strains OE1 and OE3. Phenotypic observations, disease index, and fungal biomass were measured 14 days later ( Figure 6 B in Figure 6 D in Figure 6 E in Figure 1). 14 days after inoculation, the empty control Arabidopsis thaliana inoculated with water showed normal growth, while the OE1 and OE3 strains inoculated with Verticillium dahliae showed severe leaf wilting, yellowing, lodging, and chlorosis. In contrast, the wild-type Arabidopsis thaliana Col-0 control showed milder leaf yellowing and wilting after inoculation with Verticillium dahliae. This indicates that overexpression GhLOG8 The resistance of transgenic Arabidopsis to Verticillium dahliae was significantly reduced. LOG8 Overexpression of the gene plays a negative regulatory role in Arabidopsis thaliana's resistance to Verticillium dahliae infection.

[0082] The present invention has been described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0083] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0084] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0085] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0086] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, can be equivalent parameters, concentration and conditions, implement the present invention in a wide range. Although the present invention provides special embodiments, it should be understood that the present invention can be further improved. In a word, by the principle of the present invention, the application is intended to include any variation, purposes or improvements to the present invention, including departing from the disclosed range in the application, and the changes performed with conventional techniques known in the art.

Claims

1. Application for reducing protein content and / or activity, characterized in that, The application is any of the following: A1) Application in improving resistance to Verticillium wilt in upland cotton; A2) Use in the preparation of products that improve resistance to Verticillium wilt in upland cotton; A3) Application in breeding upland cotton resistant to Verticillium wilt; A4) Use in the preparation of products for breeding upland cotton resistant to Verticillium wilt; A5) Application in breeding for Verticillium wilt resistance in upland cotton or improving Verticillium wilt resistance germplasm resources in upland cotton; The protein meets the following conditions: B1) a protein having an amino acid sequence of SEQ ID No. 2; B2) A fusion protein with the same function as B1) is obtained by connecting a tag to the N-terminus and / or C-terminus.

2. Use of a biomaterial related to the protein according to claim 1, characterized in that: The application is any of the following: D1) Application in improving resistance to Verticillium wilt in upland cotton; D2) Application in the preparation of products that improve resistance to Verticillium wilt in upland cotton; D3) Application in breeding upland cotton resistant to Verticillium wilt; D4) Use in the preparation of products for breeding upland cotton resistant to Verticillium wilt; D5) Application in breeding for Verticillium wilt resistance in upland cotton or improving Verticillium wilt resistance germplasm resources in upland cotton; The biological material is any one of the following E1) to E7): E1) a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein according to claim 1; E2) an expression cassette containing the nucleic acid molecule described in E1); E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) A recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing E3) a recombinant microorganism containing the recombinant vector; E5) a transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2), or a transgenic plant cell line containing the recombinant vector of E3); E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2); E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2).

3. The use according to claim 2, characterized in that The CDS sequence of the gene encoding the protein is shown in SEQ ID NO.

1.

4. A method for cultivating plants resistant to Verticillium wilt, characterized in that: The method comprises reducing the content and / or activity of the protein of claim 1 in a target plant, thereby obtaining a disease-resistant plant having higher Verticillium wilt resistance than the target plant, wherein the plant is upland cotton.

5. The method according to claim 4, characterized in that The reduction of the content and / or activity of the protein according to claim 1 in the target plant is achieved by reducing the expression level of the gene encoding the protein in the target plant.

6. The method according to claim 5, characterized in that The step of reducing the expression level of the gene encoding the protein in the target plant is to use gene silencing technology to reduce the expression level of the gene encoding the protein in claim 1 in the genome of the target plant.

7. The method according to claim 6, characterized in that The gene silencing technology used to reduce the expression level of the gene encoding the protein described in claim 1 in the genome of the target plant is carried out using a virus-induced gene silencing vector, and the virus-induced gene silencing vector is a recombinant vector constructed by forward integration of the nucleic acid molecule shown in SEQ ID No. 1 into a plasmid vector based on tobacco rattle virus.

8. The method according to claim 5, characterized in that The step of reducing the expression level of the gene encoding the protein in the target plant is to use gene knockout technology to reduce the expression level of the gene encoding the protein in claim 1 in the genome of the target plant.

9. The method according to claim 8, characterized in that The gene knockout technology is used to reduce the expression level of the gene encoding the protein of claim 1 in the genome of the target plant by using a CRISPR / Cas9 vector, and the CRISPR / Cas9 vector is a recombinant vector constructed based on the dual target sites sgRNA1: TCCAAGACAGTATATGATGGAGG and sgRNA2: GCATGAGCGCAAAGCTGCAATGG of the encoding gene.

Citation Information

Patent Citations

  • Cotton verticillium wilt resistance related gene GhCBL3 and encoding protein and application thereof

    CN115820722A

  • GhCRP21 gene of upland cotton as well as encoding protein and application of GhCRP21 gene

    CN117535311A