Therapeutic agents for metabolism-related diseases

Abstract

Provided herein are targets for the treatment of metabolism-related diseases, such as metabolism-related fatty liver disease (MAFLD). Agents for treating the disease and methods of using the agents are also provided.

Description

Technical Field

[0001] Provided herein are targets for treating metabolic-related diseases, such as metabolic-associated fatty liver disease (MAFLD). Also provided are agents for treating the diseases and methods of using the agents. Background Art

[0002] In mammals, 95% of multi-exon genes undergo one or more alternative splicing (AS) events, generating multiple isoforms. 1,2 , leading to transcriptional diversity and complexity 3 AS has been proposed to be important for establishing and maintaining tissue-specific protein interaction networks. 4-6 and organizational identity 6 In contrast, it is unclear whether specific AS programs regulate physiological adaptations, and their role in metabolic diseases is unclear. This is because of poor functional characterization of specific isoforms and technical challenges involved in identifying specific upstream regulatory splicing factors in vivo. Therefore, there is limited information about the splicing networks involved in metabolic reprogramming at the level of splicing factors and the isoforms they regulate. In addition to increasing our understanding of metabolic regulation in health and disease, the characterization of splicing factors and isoforms involved in metabolic regulation may lead to the development of RNA-based therapeutics that enhance or antagonize specific isoforms. RNA-based therapeutics that inactivate specific genes in the liver, such as APOB or PCSK9, are emerging as promising therapeutic strategies for metabolic pathologies. 7，8 However, the development of splice-switching RNA therapeutics has not yet been explored.

[0003] As obesity rates increase worldwide, metabolic-associated fatty liver disease (MAFLD) has become the most prevalent non-communicable liver pathology, affecting up to 25% of the world's population. 9 MAFLD ranges from presymptomatic hepatic steatosis (fatty liver) to nonalcoholic steatohepatitis (NASH), which is characterized by additional inflammation, hepatocellular injury, and fibrosis, and can progress to liver failure, cirrhosis, and hepatocellular carcinoma (HCC). 10 .

[0004] Although the exact mechanisms that promote the progression from steatosis to NASH are not fully understood, there is evidence that chronic overnutrition and a high-calorie Western diet play a role. This is due in part to dysregulation of bioactive and / or toxic lipid species such as phospholipids, saturated fatty acids, sphingomyelin, ceramides, and cholesterol. 11-13 Furthermore, there is evidence that MAFLD contributes to the pathogenesis of type 2 diabetes and cardiovascular disease, with coronary artery disease being the leading cause of death in these patients. 14,15Given the unmet clinical need for MAFLD, there is interest in understanding the molecular mechanisms linking MAFLD to increased cardiovascular risk and progressive liver damage in order to identify new therapeutic targets. Summary of the invention

[0005] In one aspect, an agent capable of inducing skipping of exon 12 of class B type I scavenger receptor (Scarb1) is provided. The agent can bind to pre-mRNA of Scarb1. For example, the agent can bind to a site within pre-mRNA of Scarb1 that affects splicing of exon 12. The agent can be a nucleic acid analog or a nucleic acid. The agent can be an antisense oligomer.

[0006] In one aspect, an antisense oligomer capable of inducing skipping of exon 12 of scavenger receptor class B type I (SCARB1) is provided. The antisense oligomer is capable of inducing skipping of exon 12 of human SCARB1. The antisense oligomer can be 10-45 nucleobases, 12-40 nucleobases, 15-35 nucleobases, 18-30 nucleobases, or 19-25 nucleobases in length.

[0007] The antisense oligomer may comprise a nucleobase sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19, and may comprise 5, 4, 3, 2, 1 or fewer substitutions, deletions or insertions. The antisense oligomer may comprise a nucleobase sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19, and one or more nucleobases substituted with a modified nucleobase capable of base pairing with a nucleobase of the same type. The antisense oligomer may comprise a nucleobase sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19. The antisense oligomer may comprise a nucleobase sequence according to any one of SEQ ID NOs: 5, 8, 10, 11, 18 or 19. The nucleobase sequence of the antisense oligomer may be according to any one of SEQ ID NO: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19.

[0008] The antisense oligomer may include at least one 2'-O-methyl nucleotide and / or at least one 2'-O-methoxyethyl nucleotide. The antisense oligomer may be a 2'-O-methyl nucleic acid oligomer and / or a 2'-O-methoxyethyl nucleic acid oligomer. The antisense oligomer may include at least one phosphorothioate internucleotide linkage. In some embodiments, all internucleotide linkages in the antisense oligomer are phosphorothioate internucleotide linkages.

[0009] In one embodiment, the antisense oligomer is an oligonucleotide and has a nucleobase sequence according to SEQ ID NO: 5, 8, 10, 11, 18 or 19, and wherein -O-CH 3 or -O-CH 2 -CH 2 -O-CH 3 Attached to the 2' position of the sugar moiety of each nucleotide.

[0010] Provided herein are antisense oligonucleotides having a sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19, wherein the internucleotide linkage is a phosphorothioate internucleotide linkage, and wherein -O-CH 3 or -O-CH 2 -CH 2 -O-CH 3 Attached to the 2' position of the sugar moiety of each nucleotide.

[0011] Provided herein are pharmaceutical compositions comprising any antisense oligomer or antisense oligonucleotide as disclosed herein.

[0012] Provided herein are any antisense oligomers, antisense oligonucleotides or pharmaceutical compositions as disclosed herein, which are used as medicines. Provided herein are any antisense oligomers, antisense oligonucleotides or pharmaceutical compositions as disclosed herein, which are used in methods for treating or preventing metabolic-related diseases. Provided herein are any antisense oligomers, antisense oligonucleotides or pharmaceutical compositions as disclosed herein, which are used in methods for treating or preventing the pathological effects of obesity and / or obesity-causing diets. Pathological effects can be liver inflammation, lipotoxicity, hepatocyte injury and / or fibrosis. Provided herein are any antisense oligomers, antisense oligonucleotides or pharmaceutical compositions as disclosed herein, which are used in methods for treating or preventing liver inflammation. Liver inflammation can be obesity-induced. Provided herein are any antisense oligomers, antisense oligonucleotides or pharmaceutical compositions as disclosed herein, which are used in methods for treating or preventing metabolic-related fatty liver disease (MAFLD). Provided herein are any antisense oligomers, antisense oligonucleotides or pharmaceutical compositions as disclosed herein, which are used in methods for treating or preventing presymptomatic liver steatosis. Provided herein are any antisense oligomers, antisense oligonucleotides or pharmaceutical compositions as disclosed herein for use in a method for treating or preventing nonalcoholic steatohepatitis (NASH). Provided herein are any antisense oligomers, antisense oligonucleotides or pharmaceutical compositions as disclosed herein for use in a method for treating or preventing hepatocellular carcinoma (HCC) in a subject. The subject may suffer from liver inflammation, presymptomatic hepatic steatosis or NASH. Provided herein are any antisense oligomers, antisense oligonucleotides or pharmaceutical compositions as disclosed herein for use in treating or preventing any one or a combination thereof of gallstone disease, type 2 diabetes, cardiovascular disease and coronary artery disease.

[0013] Provided herein is any antisense oligomer, antisense oligonucleotide or pharmaceutical composition as disclosed herein for use in a method of treatment, wherein the method comprises lowering cholesterol levels in a subject in need thereof.

[0014] Provided herein is any method of increasing the expression of class B type I scavenger receptor (Scarb1) subtype SR-BII relative to subtype SR-BI in a cell, the method comprising contacting the cell with a composition comprising an antisense oligomer or antisense oligonucleotide as disclosed herein. The method can be in vivo, and the composition can be administered to a subject in need thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1.The expression of the pre-mRNA splicing machinery is regulated by nutrient input in the liver. A. Schematic diagram of the experimental design. Livers from mice fed HFD or CD were harvested in the fed (ad libitum) or fasted (16h) state and processed for high-throughput TMT / MS (isobaric mass tag) proteomics (n=3) or RNAseq analysis (n=4). B. Principal component analysis of TMT / MS (upper panel) and RNAseq (lower panel) analyses. C. Gene ontology analysis of differentially expressed proteins between fasted state versus fed state (upper panel) and between HFD livers versus CD livers (lower panel). D. Analysis of differential AS events between CD fasting versus fed (black), HFD versus CD (blue), and HFr versus CD (red). The percentage of events that changed in each comparison is represented by pie charts (right) (SE: skipped exons, MXE: mutually exclusive exons, RI: retained introns, A5SS: alternative 5' splice sites, A3SS: alternative 3' splice sites). EG. Enrichment of eCLIP crosslinks around conserved AS events that were differentially regulated in each comparison in HepG2 cells from the ENCODE database. H. Venn diagram showing the overlap of splicing factors differentially expressed in HFD relative to CD from RNAseq (yellow) and TMT / MS analysis (blue) and splicing factors detected in primary hepatocytes (green).

[0016] Figure 2 .RBFOX2 is a splicing factor expressed in the liver. A. Single-cell analysis of Rbfox2 expression in the liver. BL WT and L ΔRbfox2 Western blot of liver lysate showing RBFOX2 expression in hepatocytes. C. Western blot of C57BL6 liver lysate showing RBFOX2 expression in mice fed CD, HFD or HFr diet (n=6 for each condition, 3 representative samples are shown). Right: Quantification of long / short RBFOX2 variants. D. Expression of RBFOX2 containing the full-length RRM motif as quantified by TMT / MS (n=3). Bar graphs represent mean ± SEM. Statistical significance was determined by one-way ANOVA (C) or two-sided t-test (D) of biologically independent samples (*p value < 0.05; ***p value < 0.001).

[0017] Figure 3RBFOX2 controls AS in lipid-regulating gene clusters in liver. A. Cartoon depicting the experimental strategy to identify RBFOX2-regulated AS programs and isoforms for RNA therapeutics (the sequence depicted is SEQ ID NO: 55). B. RBFOX2 motif enrichment relative to eiCLIP-RBFOX2 crosslinking sites in mouse hepatocytes (n=3). C. Shows the enrichment of RBFOX2 motifs in mouse hepatocytes from L WT and L ΔRbfox2 RNA profile of normalized density of RBFOX2 eiCLIP crosslinking sites relative to the 5'SS and 3'SS of selected exons identified by RNAseq in mouse liver. D. GO molecular function analysis of RBFOX2 crosslinked genes in mouse liver visualized with REVIGO. Bubble size corresponds to the number of combined GO terms. Color corresponds to the combined score. E. GWAS of human genes crosslinked by RBFOX2 in hepatocytes. F. Schematic diagram of the Scarbl gene showing the location of the RBFOX2 eiCLIP peak around exon 12 (arrow). L WT and L ΔRbfox2 Semi-quantitative PCR plus capillary electrophoresis analysis of Scarbl exon 12 in liver of mice and quantification of AS (lower panel). G. Analysis of RBFOX2 regulation of Pla2g6 exon 10, (H) Numb exon 3 and exon 9, and (I) Osbp19 exon 6. PSI values ​​are expressed as mean ± SEM (n = 6-8). Statistical significance was determined by two-sided t-test of biologically independent samples.

[0018] Figure 4 RBFOX2 controls lipid homeostasis in the liver. WT and L ΔRbfox2 A. Serum lipid analysis of total cholesterol levels and (B.) triglycerides in mice fed a CD diet and a HFr diet as determined by LC-MS. WT and L ΔRbfox2PCA plot of liver lipid profiles of mice. D. LC-MS lipidomic analysis showing the total levels of the indicated species and PUFA / non-PUFA TG ratios normalized to tissue mass (n=8). E. Cartoon depicting the strategy for analysis of iPSC-derived human hepatocytes. F. RT-qPCR analysis showing knockdown of RBFOX2 in human hepatocytes (n=6). G. Analysis of RBFOX2-mediated regulation of NUMB exon 3, (H) NUMB exon 9, (I) SCARB1 exon 12, (J) SEC31A exon 21, and (K) OSBPL9 exon 6. PSI values ​​are expressed as mean ± SEM (n=6). Lipidomic quantification of (L) cholesterol esters and (M) sphingomyelin accumulation after RBFOX2 knockdown in human hepatocytes (n=5). Statistical significance was determined by a two-sided t-test of biologically independent samples (*p value <0.05; **p value <0.01).

[0019] Figure 5. Virus-mediated overexpression of RBFOX2-Δ6 and RBFOX2 WT in the liver. A. Cartoon depicting the AAV backbone used to overexpress RBFOX2-Δ6 (with truncated RNA binding motif RRM) or control GFP in the liver (top) and representative Western blots showing expression levels in the liver. B. RT-qPCR expression analysis of codon-optimized RBFOX2-Δ6 in the liver. C. Quantification of the splicing percentage (PSI) of Numb (exon 3), Osbpl9 (exon 6), Scarb1 (exon 12), and Sec31a (exon 21). D. Cartoon depicting the adenoviral backbone used to overexpress RBFOX2 wild-type or control GFP (top) and representative Western blots showing expression levels in hepatocytes. E. Capillary electrophoresis and quantification of splicing percentage (PSI) of Numb (exon 3), Osbpl9 (exon 6), Scarbl (exon 12), and Sec31a (exon 21) after RBFOX2 overexpression in hepatocytes (n=6). F. LC-MS lipidomics analysis showing total levels of free cholesterol, cholesterol esters, sphingomyelin, and ceramide and PUFA / non-PUFA TG ratios normalized to liver tissue mass in mice fed a HFr diet after transduction with pAd-RBFOX2 or pAd-GFP control (n=8-9). G. Quantified cholesterol levels in bile of mice fed a HFr diet after transduction with pAd-RBFOX2 or pAd-GFP control (n=8-9). H. Serum lipid analysis of total cholesterol, HDL-cholesterol and triglycerides in mice fed a HFr diet after transduction with pAd-RBFOX2 or pAd-GFP control is shown (n=8-9). Results are expressed as mean±SEM. Statistical significance was determined by two-sided t-test or Mann-Whitney test for biologically independent samples (***p<0.001).

[0020] Figure 6.Transcriptional regulation of Rbfox2 in the liver.A. Transcription start site (TSS) signals at the promoter of RBFOX2 transcripts detected by CAGE in hepatocytes, aortic smooth muscle and hippocampus. Two transcript isoforms and their corresponding promoters are shown. The tag clusters are enlarged and ChIP-seq signals of FOXA1, FOXA2, H3K4me3 and H3K27ac are shown. B. RT-qPCR of Foxa1, Foxa2 and Rbfox2 in Hepa1-6 cells expressing scrambled shRNA (shC) or shRNA against Foxa1 / 2 (shF1 / 2) (n=6). C. Microarray analysis of HepG2 cells with adenoviral FOXA1 overexpression (GSE30447)36. Results are expressed as mean ± SEM. Statistical significance was determined by two-sided t-test of biologically independent samples (***p<0.001).

[0021] Figure 7 .Scarb1 mediates lipidomic changes associated with RBFOX2 deficiency in hepatocytes and can be modulated by splice-switching oligomers.A. Mice fed a HFr diet were subcutaneously injected with SSO8.3, scrambled (Scr) or saline over four consecutive weeks (upper panel). No significant effect of the injection on body weight was detected (lower panel). B. Semi-quantitative PCR analysis of Scarb1 exon 12 contained in the liver (upper panel) and quantification of the resulting total AS expressed as PSI (lower panel). C. Immunohistochemistry showing reduced macrophage (anti-MRC1) infiltration in the liver of SSO8.3-treated mice. Cell nuclei were stained with DAPI. D. qPCR analysis in the liver of SSO8.3-treated mice (n=7-9). EF. LC-MS lipidomic analysis showing total levels of free cholesterol and sphingomyelin normalized to tissue weight in mice fed a HFr diet after SSO8.3 injection. G. Quantification of cholesterol and phospholipids in the bile of SSO8.3-treated mice and Scr-treated mice. H. Blood analysis of SSO8.3-treated mice relative to Scr-treated mice showing total cholesterol and triglycerides. I. Analysis of blood VLDL, LDL and HDL lipoprotein composition. Samples from three replicates were pooled. J. Cartoon depicting the analysis of Dil-HDL uptake in AML12 hepatocytes expressing codon-optimized SR-BI or SR-BII after targeted inactivation of endogenous Scarb1 with specific siRNA or scrambled control (left panel). Uptake as quantified as Dil-positive cells after 4 hours of incubation with 0.1 μg / ml Dil-HDL (n=6). K. Analysis of Dil-HDL uptake in L12 hepatocytes fed a HFr diet and treated with SSO8.3 or Scr control. ΔRbfox2 Mouse relative to LWT Quantification of major lipid species in mouse purified HDL lipoproteins. L was treated with SSO8.3 or Scr control as indicated. ΔRbfox2 Mouse relative to L WT Quantification of cholesterol levels in bile of mice. Results are expressed as mean ± SEM (n = 7-10); statistical significance was determined by two-sided t-test of biologically independent samples (*p value < 0.05; **p value < 0.01; ***p value < 0.001).

[0022] Figure 8 .Splicing factors are differentially expressed in the liver under specific metabolic conditions. Volcano plots showing the expression of splicing factors (gold) in mouse livers in the fed or fasted state as determined by A. TMT / MS analysis or B. RNAseq analysis. Splicing factor expression in mice fed HFD versus CD as determined by C. TMT / MS analysis and D. RNAseq analysis. E. Overlap between differentially regulated AS events in mice fed CD or HFD during feeding / fasting cycles. F. Enrichment of splicing factor motifs within and around alternatively spliced ​​cassette exons in mouse livers in the fasted versus fed state and G. under HFD versus CD. Enrichment in non-AS exons is used as background (dotted line).

[0023] Fig. 9 .Single-cell RNAseq analysis of RNA-binding protein gene expression in the liver.Single-cell RNAseq analysis of the liver for the expression of related AS factors.

[0024] Fig.10 .Analysis of RBFOX2-mediated AS regulation in the liver.A. NuPAGE gel visualizing protein-RNA complexes obtained in eiCLIP of hepatocytes. Lane 1: no antibody, 2: no UV, 3: 0.2U / ml RNase, 4: 0.1U / ml RNase and 5: size-matched input. The area where the protein-RNA complex was cut from the membrane is marked with a dashed box. eiCLIP analysis confirmed crosslinking of RBFOX2 to B. Ptbp2 and C. Snrnp70 pre-mRNA transcripts. D. Cartoon depicting the position effect of RBFOX2 regulation on AS. E. Representation of the position effect of RBFOX2 regulation on AS in L ΔRbfox2 With L WTBubble plot of significant AS events between livers. Significant events are represented by pie charts (right) as a percentage of total events. Selected transcripts with eiCLIP RBFOX2 crosslinking peaks are indicated. F. eiCLIP tracks showing RBFOX2 crosslinking (top) and semi-quantitative PCR showing that RBFOX2 promotes Sec31a exon 24 skipping. PSI values ​​are expressed as mean ± SEM (n = 6-8). Statistical significance was determined by two-sided t-test of biologically independent samples. RBFOX2 crosslinks to G.PLA2G6, H.SEC31A, I.NUMB, and J.SCARB1 pre-mRNA transcripts in human hepatocyte samples.

[0025] Fig.11 RBFOX2 is involved in the regulation of cholesterol homeostasis. L. WT Animals and L ΔRbfox2 Weight gain of animals over time. L. fed D.CD, (E.) HFD and (F.) HFr diets WT and L ΔRbfox2 Glucose tolerance test. G. cholesterol level and H. triglyceride level are shown. ΔRbfox2 Mouse relative to L WT Blood analysis of female mice. I. L from mice fed a HFr diet ΔRbfox2 Mouse relative to L WT H&E staining of mouse liver. Scale bar 50 μm. JM. L. fed HFD ΔRbfox2 Mouse relative to L WT LC-MS / MS analysis of specific lipids in the liver of mice fed a HFD ΔRbfox2 Mouse relative to L WT Blood cholesterol and triglyceride levels in mice. Results are expressed as mean ± SEM (n = 8-9). Statistical significance was determined by two-way ANOVA (AF) or two-sided t-test (GN) of biologically independent samples (*p value < 0.05; **p value < 0.01).

[0026] Fig.12 .RBFOX2 regulates lipid metabolism in human hepatocytes. A. RT-qPCR analysis of ASGPR2, SERPINA1, and SERPINA2 in human hepatocytes after targeted knockdown of RBFOX2 (n=6). B. PCA plot of lipidomic analysis of human hepatocytes after targeted knockdown of RBFOX2 as determined by LC-MS (n=5). C. PCA plot of lipidomic analysis of human hepatocytes after targeted knockdown of RBFOX2 (n=5). ΔRbfox2 With L WTRT-qPCR analysis of genes involved in cholesterol and bile acid homeostasis in mouse liver (n=18-20). D. shows L ΔRbfox2 Mouse relative to L WT Representative Western blot of APOB and ABCA1 expression in the liver of mice fed an EK.HFr diet or a (LU)HFD diet as determined by LC-MS / MS. ΔRbfox2 Mouse relative to L WT Bile acid levels in the liver of mice. Samples were normalized by tissue weight and internal standard (n=8). Results are expressed as mean ± SEM; statistical significance was determined by two-sided t-test of biologically independent samples (*p value < 0.05; **p value < 0.01; ***p value < 0.001).

[0027] Fig.13 Quantification of AS of direct RBFOX2 targets in mice fed CD, HFD, or HFr diets. WT Mouse and L ΔRbfox2 A. Quantification of percent splicing (PSI) of Pla2g6 (exon 10), (B.) Scarb1 (exon 12), (C.) Numb (exon 3), (D.) Numb (exon 9), (E.) Sec31a (exon 21), and (F.) Osbpl9 (exon 6) in mice (n=7-10). G. Shows representative Western blots of RBFOX2 expression levels in mouse livers after transduction with pAd-RBFOX2 or pAd-GFP control (left panel), and quantification of percent splicing (PSI) of Scarb1 (exon 12) by PCR / capillary electrophoresis (right panel) (n=7-9). H. ChIPseq signal of FOXA1 in the mouse Rbfox2 promoter in liver. I. Shows L ΔRbfox2 Hepatocytes relative to L WT Volcano plot of LC-MS lipidomics analysis of hepatocytes (n=5-6). J. L as determined by LC-MS lipidomics analysis ΔRbfox2 Hepatocytes relative to L WT PCA plots of hepatocytes and associated SSO treatments. Results are expressed as mean ± SEM. Statistical significance was determined by two-way ANOVA or two-sided t-test for biologically independent samples (**p value < 0.01; ***p < 0.001).

[0028] Fig.14 .The role of RBFOX2 downstream targets in lipid metabolism in hepatocytes. A. After treatment with SSO7.8 or Scr control, L WT and L ΔRbfox2Capillary electrophoresis of Numb (exon 9) in hepatocytes and quantification of splicing percentage (PSI). B. Shows L treated with SSO7.8 or Scr. WT and L ΔRbfox2 Heat map of LC-MS metabolomics analysis of hepatocytes. C. After treatment with SSO6.2 or Scr control, L WT and L ΔRbfox2 Capillary electrophoresis of Sec31a (exon 21) in hepatocytes and quantification of the splicing percentage (PSI). D. Shows L treated with SSO6.2 or Scr. WT and L ΔRbfox2 Heat map of LC-MS metabolomics analysis of hepatocytes. Results are expressed as mean ± SEM. Statistical significance was determined by two-sided t-test of biologically independent samples (n=5-6) (***p<0.001).

[0029] Fig.15 . Role of Osbpl9 and Pla2g6 isoforms in lipid metabolism. A. After treatment with SSO11.1 or Scr control, L WT and L ΔRbfox2 Capillary electrophoresis of Osbpl9 (exon 6) in hepatocytes and quantification of the splicing percentage (PSI). B. Shows L treated with SSO11.1 or Scr. WT and L ΔRbfox2 Heat map of LC-MS metabolomics analysis of hepatocytes. C. Western blot showing PLA2G6 expression in wild-type and RBFOX2-deficient hepatocytes (top). Cryo-EM map of PLA2G6 dimer showing tight interaction of the catalytic domain of each monomer (orange) with the ankyrin repeats (purple) oriented outward from the core. The ankyrin repeats "claw-like" face faces the membrane phospholipids. Inset: Detailed description of a 90-degree rotation of the structure of the region corresponding to exon 10 of Pla2g6L, an intrinsically disordered proline-rich region of 55 amino groups at the interface of the ankyrin repeats and the catalytic domain. D. Diagram showing the design of a splice-switching oligomer targeting alternative splicing of Pla2g6 at exon 10. SSO5.1 was designed to promote exon skipping (top), as verified by semi-quantitative PCR analysis (bottom). E. Quantification of the effect of SSO5.1 on the lipid species as determined by LC-MS. Results are expressed as mean ± SEM (n = 5-6). Statistical significance was determined by two-sided t-test of biologically independent samples (*p value < 0.05; ***p < 0.001).

[0030] Fig.16. Role of Scarb1 splice variants in lipid metabolism. A. Splice switching oligonucleotide (SSO8.3) promotes skipping of Scarb1 exon 12 in primary hepatocytes, as determined by semiquantitative PCR analysis. B. Shows the expression of Scarb1 in L treated with 100 nM SSO8.3 or Scr for 16 h. ΔRbfox2 Volcano plot of LC-MS lipidomic analysis of hepatocytes (n=5-6). Metabolomic analysis of the levels of C. total ceramide, D. PUFA / non-PUFA TG ratio, E. total sphingomyelin, and F. total triglycerides (n=5-6) is shown. GI. L treated with SSO8.3 or Scr WT Hepatocytes and L ΔRbfox2 Heat map of LC-MS metabolomics analysis of hepatocytes. J. Western blot showing SR-BI / II levels in liver after SSO8.3 treatment. RT-qPCR expression analysis of potential off-target genes such as K.Dscc1, (L.) Kcnj16 and (M.) Rab10 in the liver of mice treated with SSO8.3 or Scr. Effect of SSO8.3 injection on N. circulating ALT and O.AST levels. P. Liver / body weight ratio after SSO8.3 injection (n=7-10). Results are expressed as mean ± SEM. Statistical significance was determined by one-way ANOVA or two-sided t-test for biologically independent samples (*p value <0.05; **p value <0.01; ***p value <0.001).

[0031] Fig.17 . In vivo treatment with SSO8.3 promotes lipoprotein remodeling. Quantification of major lipid species in purified A. VLDL, B. LDL, and C. HDL lipoproteins from mice fed a HFr diet and treated with SSO8.3 or Scr control. Samples from three replicates were pooled. D. L treated with SSO8.3 or Scr WT Mouse and L ΔRbfox2 Representative Western blot analysis of lipogenic proteins in the liver of mice (n=9-10). E. Quantification of liver triglyceride content normalized to liver weight in mice injected with SSO8.3 or Scr control (n=8-9). F. RT-qPCR expression analysis of endogenous Scarb1 gene knockdown in AML12 hepatocytes treated with siRNA against Rbfox2 or Scr control (n=5). G. Absolute RT-qPCR expression analysis of codon-optimized Scarb1 isoforms in AML12 cells (n=5). H. L WT Liver and L ΔRbfox2Quantification of capillary electrophoresis and splicing percentage (PSI) of Scarb1 (exon 12) in the liver (upper panel) and western blot analysis of protein levels (lower panel) in the liver (n = 8 - 9). I. After treatment with SSO8.3 or Scr control, L WT mice and L ΔRbfox2 Quantification of liver triglyceride content normalized to liver weight in mice (n = 9 - 10). J. L ΔRbfox2 mice fed an HFr diet as shown and treated with SSO8.3 or Scr control relative to L WT Total blood cholesterol levels in mice. K. Quantification of major lipid classes in purified LDL and (L)VLDL lipoproteins. Results are expressed as mean ± SEM; statistical significance was determined by two-tailed t-test of biologically independent samples (*p value < 0.05; **p value < 0.01; ***p value < 0.001).

[0032] Fig.18 . Activity of SSO8.4, SSO8.5, SSO8.6, and SSO8.7 in human hepatocytes. A. Cartoon showing the hybridization sites of the tested SSOs within the exon 12 locus. B. Human hepatocytes were transfected with 100 nM SSO using Lipofectamine 2000 for 6 hours. At 24 hours post-transfection, RNA was extracted and activity was quantified as the PSI of SCARB1 exon 12. A scrambled oligomer was used as a control. Results are expressed as mean ± SEM (n = 3).

[0033] Fig.19 . Activity of SSO8.5, SSO8.8, SSO8.9, SSO8.10, SSO8.11, and SSO8.12 in human hepatocytes. A. Cartoon showing the hybridization sites of the tested SSOs within the exon 12 locus. B. Human hepatocytes were transfected with 100 nM SSO using Lipofectamine 2000 for 6 hours. At 24 hours post-transfection, RNA was extracted and activity was quantified as the PSI of SCARB1 exon 12. A scrambled oligomer was used as a control. Results are expressed as mean ± SEM (n = 3).

[0034] Fig. 20. Activity of SSO8.5, SSO8.10, SSO8.11, SSO8.12, SSO8.13, SSO8.14, SSO8.15, SSO8.16, SSO8.17, SSO8.18, SSO8.19, SSO8.20, SSO8.21 in Huh7 or HepG2 human hepatocytes. A. Cartoon showing the hybridization sites of the tested SSOs within the exon 12 locus. B. Cartoon depicting the chemical modifications introduced in the tested SSOs. C. Huh7 human hepatocytes were transfected with 100 nM SSO using Lipofectamine 2000 for 24 hours. 24 hours after transfection, RNA was extracted and activity was quantified as PSI of SCARB1 exon 12. D. HepG2 human hepatocytes were transfected with 100 nM SSO using Lipofectamine 2000 for 24 hours. 24 hours after transfection, RNA was extracted and activity was quantified as PSI of SCARB1 exon 12. Scrambled oligo was used as control. Results are expressed as mean ± SEM (n=3).

[0035] Fig.21 .Analysis of efficacy and toxicity of SSO8.19 in human liver microtissues. A. PCR and capillary electrophoresis analysis of SCARB1 exon 12 inclusion / skipping. B. Quantification of exon 12 inclusion / skipping expressed as percentage of splicing (PSI = inclusion of exon 12 / (inclusion of exon 12 + skipping of exon 12)). CD. Hepatotoxicity assessed as LDH release caused by increasing doses of SCR (C), SSO8.18 (D) and chlorpromazine (E). Results are expressed as mean ± SEM.

[0036] Fig. 22 .Anti-inflammatory effect of SSO8.18.A. Cartoon depicting the experimental setup with repeated treatments (20 μM). B. Effect of SSO8.18 on CXCL10 (IP10) levels. C. Cartoon depicting the experimental setup with a single treatment (7.5 μM) for 48 hours (top). PCR and capillary electrophoresis analysis of SCARB1 exon 12 inclusion / skipping under these conditions (bottom). D. Hepatotoxicity assessed as LDH release for a single treatment (7.5 μM). E. Effect of SSO8.18 on CXCL10 (IP10) levels. Results are expressed as mean ± SEM. Pairwise statistical comparisons between SCR and SSO8.18 were assessed using Student's t-test (***P < 0.001). DETAILED DESCRIPTION

[0037] The present inventors have discovered that components of the pre-mRNA alternative splicing machinery are selectively regulated by metabolic inputs in the liver. They identified RNA-binding Fox protein 2 (RBFOX2) as a key splicing factor in the liver that regulates AS in a gene cluster involved in lipid homeostasis. This includes the class B type I scavenger receptor (Scarb1), group VI phospholipase A2 (Pla2g6), the clathrin vesicle adaptor Numb, components of the COPII vesicle transport system Sec31a, and oxysterol-binding protein-like 9 (Osbpl9). The present inventors revealed that, in addition to promoting or antagonizing the expression of specific AS variants in the liver, RBFOX2 regulates AS in response to an obesogenic diet. They also showed that this RBFOX2-regulated AS network can be targeted therapeutically. Specifically, splice-switching oligonucleotides (SSOs) that modulate Scarb1 splicing restored the accumulation of lipotoxic species in hepatocytes of RBFOX2-deficient mice, reduced liver inflammation associated with diet-induced obesity in vivo, and promoted anti-atherogenic lipoprotein profiles in the blood. These findings highlight the potential of subtype-specific RNA therapeutics for metabolic pathologies.

[0038] In one aspect, an agent capable of inducing skipping of exon 12 of class B type I scavenger receptor (Scarb1) is provided. The agent can bind to pre-mRNA of Scarb1. For example, the agent can bind to a site within pre-mRNA of Scarb1 that affects splicing of exon 12. The agent can be a nucleic acid analog or a nucleic acid. The agent can be an antisense oligomer.

[0039] A "nucleic acid analog" is a compound having a nucleobase arrangement that mimics the nucleobase arrangement in a nucleic acid containing a 2' deoxyribose 5' monophosphate or ribose 5' monophosphate backbone, wherein the nucleic acid analog is capable of base pairing with a complementary nucleic acid. Examples of backbone moieties include amino acids as in peptide nucleic acids, diol molecules as in diol nucleic acids, threofuranosyl sugar molecules as in threose nucleic acids, morpholine rings and phosphorodiamidate groups as in morpholino, and cyclohexenyl molecules as in cyclohexenyl nucleic acids.

[0040] In one aspect, antisense oligomers capable of inducing skipping of exon 12 of scavenger receptor class B type 1 (SCARB1) are provided.

[0041] In the context of the present disclosure, an "antisense oligomer" is a molecule comprising a subunit comprising a portion capable of binding a nucleobase. Thus, an antisense oligomer can be designed so as to be able to hybridize with a specific nucleic acid sequence. The subunits can be monomers, each of which comprises a portion capable of binding a nucleobase. The portion capable of binding a nucleobase can bind by base-specific hydrogen bonding (such as Watson-Crick base pairing).

[0042] Antisense oligomers may be referred to as antisense compounds, particularly when the compounds are not necessarily synthesized from monomers.

[0043] The term "antisense" refers to a molecule that is at least partially complementary to a region of the sense strand of a nucleic acid. The antisense oligomers of the present disclosure are at least partially complementary to a region of Scarb1 pre-mRNA and are capable of binding to the region by hybridization. The degree of complementarity may not be exact, as long as the antisense oligomer and the pre-mRNA can hybridize under physiological conditions. In some examples, the antisense oligomer and the pre-mRNA may be complementary except for 5, 4, 3, 2 or 1 mismatches. In some examples, the antisense oligomer is completely complementary to a region of the pre-mRNA. In other examples, the antisense oligomer comprises a region that is completely complementary to a region of the pre-mRNA, wherein the complementary region has a sufficient length to enable binding by hybridization.

[0044] Physiological conditions are conditions (such as temperature, pH, concentrations of various ions, etc.) that exist in natural, in vivo situations or conditions corresponding to such situations. For example, antisense oligomers can be combined by hybridization under intracellular conditions (such as intracellular conditions of human cells). Physiological conditions can be those conditions during pre-mRNA splicing in cells present in the liver, such as intracellular conditions of human hepatocytes. Confirming hybridization under physiological conditions can be performed in vitro, for example, at a temperature, pH, and salt concentration that approximates intracellular conditions. In a specific example, antisense oligomers can be hybridized at 37°C, pH 7.4, and phosphate buffered saline (e.g., containing 137mM NaCl, 2.7mM KCl, 10mM Na 2 HPO 4 and 1.8 mM KH 2 PO 4 ) hybridizes to Scarb1 pre-mRNA at a level of 1:1. In all embodiments, the degree of hybridization is capable of inducing exon skipping during splicing of the target gene in the subject.

[0045] The binding of the antisense oligomers disclosed herein to Scarb1 pre-mRNA is capable of inducing the skipping of exon 12 during splicing. Due to this activity, the antisense oligomers disclosed herein can therefore be referred to as splice switching oligonucleotides (SSOs). The SSOs disclosed herein increase the likelihood of exon 12 skipping during splicing after binding to Scarb1 pre-mRNA. When exon 12 is skipped, it is not included in the resulting mRNA, and the polypeptide region encoded by exon 12 will not be present in the translated protein. This effect is important because inclusion of exon 12 of Scarb1 produces a typical SR-BI isoform, while skipping this exon produces an alternative receptor variant with a different adapter carboxyl terminal domain, which is called SR-BII.

[0046] Splicing switching activity can be detected by determining whether a candidate antisense oligomer is able to increase the ratio of mRNA that does not contain Scarb1 exon 12 to mRNA that contains Scarb1 exon 12 in a cell. The antisense oligomers disclosed herein can increase the ratio of SR-BII to SR-BI expressed by a cell. These effects can be quantified as a splicing percentage (PSI), which can be expressed as the percentage of Scarb1 mRNA that is not exon 12 skipped relative to the total Scarb1 mRNA. The relevant calculation is therefore: PSI = inclusion of exon 12 / (inclusion of exon 12 + skipping of exon 12). A PSI of 100% represents a situation in which all Scarb1 mRNAs contain exon 12 (i.e., no skipping is induced). Methods for measuring PSI are disclosed in the Examples herein. For example, PSI can be measured by transfecting candidate splice switching oligos into Huh7 human hepatocytes, extracting RNA 24 hours later, and quantifying Scarb1 mRNA containing exon 12 and total Scarb1 mRNA (see Examples for further information).

[0047] In some examples, the antisense oligomers of the present disclosure induce skipping of Scarb1 exon 12, such that the PSI is less than or equal to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or 5.7%. In a specific embodiment, the PSI is less than 40% (i.e., the antisense oligomer induces a 60% decrease in the PSI of Scarb1 exon 12).

[0048] Antisense oligomers can be targeted to cis-regulatory regions within Scarb1 pre-mRNA (see Fig.18 A). In some examples, the antisense oligomer targets the 3' splice site of Scarb1 exon 12. For example, the antisense oligomer can be complementary to a region comprising the 3' end of exon 12 in Scarb1 pre-mRNA. SSO8.5 and SSO8.21 provide examples of such antisense oligomers (see Fig. 20 ). In other examples, the antisense oligomer may target a region within exon 12 and thus be capable of hybridizing to a region of exon 12 that does not include the 5' or 3' ends. SSO8.18 provides an example of such an antisense oligomer (see Fig. 20 ). The antisense oligomer may be able to hybridize to a region overlapping with the region to which SSO8.18 is complementary. For example, the antisense oligomer may be complementary to 5, 10, 15, 16, 17, 18, 19 or all 20 bases to which SSO8.18 is complementary.

[0049] The sequence of the SCARB1 gene can be found on the NIH identification page as Gene ID: 949, as updated on August 12, 2022. The gene can be found as Ensemble gene: SCARB1 ENSG00000073060.17.

[0050] The sequence of the SCARB1 pre-mRNA may be the sequence of human SCARB1 pre-mRNA. The sequence of the SCARB1 pre-mRNA may be according to SEQ ID NO:1.

[0051] The sequence of Scarb1 exon 12 can be:

[0052] Antisense oligomers may comprise a nucleobase that can base pair with a nucleobase of a target nucleic acid. Antisense oligomers may comprise nucleotides. Antisense oligomers may be or may comprise nucleic acids and / or nucleic acid analogs. Antisense oligomers may be or may comprise oligonucleotides or polynucleotides. Antisense oligomers may be or may comprise phosphorodiamidate morpholino oligomers (PMOs). Antisense oligomers may be or may comprise peptide nucleic acids (PNAs).

[0053] In some instances, the antisense oligomer comprises at least 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleobases. In some instances, the antisense oligomer comprises no more than 45, 40, 35, 30, 29, 28, 27, 26, 25, 24, or 21 nucleobases. The antisense oligomer may comprise 10-45, 12-40 nucleobases, 15-35 nucleobases, 18-30 nucleobases, or 19-25 nucleobases. The length of the antisense oligomer may be 14-30, 15-29, 16-28, 17-27, 18-26, or 19-25 nucleobases. The antisense oligomer may be 14-24, 15-24, 16-24, 17-24, 18-24, or 19-24 nucleobases in length. In a specific embodiment, the antisense oligomer is 21 nucleobases in length.

[0054] The antisense oligomer may comprise one or more nucleosides that have been modified, for example, the modification may be to a sugar moiety. In some examples, the 2'-position of the sugar moiety may be modified. The modification may be to any moiety that is not "-H" for DNA or "-OH" for RNA. Examples of such 2' modifications are -O-CH 3 or -O-CH 2 -CH 2 -O-CH 3, and further examples are provided herein. In some examples, the 4' position of the sugar moiety is modified, such as to create a bridge between the 2' and 4' positions. The antisense oligomer may comprise one, two, three, four or more types of nucleosides. The antisense oligomer may comprise a combination of modified and unmodified nucleosides. The antisense oligomer may comprise only modified nucleosides. The nucleotides of the antisense oligomer may all be modified in the same way, or may be modified in two or more different ways.

[0055] The antisense oligomer may comprise modifications to one or more internucleoside linkages. For example, the antisense oligomer may comprise one or more phosphorothioate linkages. In some embodiments, all internucleotide linkages within the antisense oligomer are phosphorothioate linkages. The antisense oligomer may be or may comprise an oligonucleotide phosphorothioate. The antisense oligomer may comprise one or more phosphorodiamidate linkages. In some embodiments, all monomer linkages within the antisense oligomer are phosphorodiamidate linkages.

[0056] The antisense oligomer may comprise one or more of deoxyribonucleotides, ribonucleotides, arabinonucleotides, 2'-fluoroarabinonucleotides (FANA), 2'-O-methyl (2'OMe) nucleotides, phosphorothioate 2'-O-methyl (PS-2'OMe) nucleotides, 2'-O-methoxyethyl (MOE) nucleotides, phosphorothioate 2'-O-methoxyethyl (PS-MOE) nucleotides, phosphorodiamidate morpholino monomers, locked nucleic acids, P-alkylphosphonate nucleotides, threonucleotides, hexitol nucleotides, 2'-hydroxy-hexitol nucleotides, cyclohexene nucleotides, 3'-deoxy-DNA(2'-5') nucleotides, peptide nucleic acid (PNA) residues, 2'-O,4'-C-ethylene-bridged nucleotides, or any combination thereof.

[0057] The antisense oligomer may be or may comprise a DNA oligomer, an RNA oligomer, an arabinonucleic acid (ANA) oligomer, a 2'-fluoroarabinonucleic acid (FANA) oligomer, a 2'-O-methyl ribonucleic acid (2'OMe) oligomer, a phosphorothioate 2'-O-methyl ribonucleic acid (PS-2'OMe) oligomer, a 2'-O-methoxyethyl (MOE) nucleic acid oligomer, a phosphorothioate 2'-O-methoxyethyl (PS-MOE) nucleic acid oligomer, a phosphorodiamidate morpholino oligomer (PMO), a locked nucleic acid (LNA) oligomer, a P-alkylphosphonate nucleic acid (pbNA) oligomer, a threonucleic acid (TNA) oligomer, a hexitol nucleic acid (HNA) oligomer, a 2'-hydroxy-hexitol (AtNA) oligomer, a cyclohexene nucleic acid (CeNA) oligomer, a 3'-deoxy-DNA(2'-5') oligomer, a peptide nucleic acid (PNA) oligomer, a 2'-O,4'-C-ethylene-bridged nucleic acid (ENA) oligomer or any combination thereof.

[0058] The antisense oligomers disclosed herein may include one or more naturally occurring nucleobases and / or one or more modified nucleobases. A modified nucleobase is a nucleobase that is capable of base pairing with a nucleobase of a nucleic acid, but is structurally different from a naturally occurring nucleobase. An example of a modified nucleobase is 5-methylcytosine.

[0059] Any antisense oligomer of the present disclosure may exist as a pharmaceutically acceptable salt, ester, salt of the ester, or hydrate of the antisense oligomer, and reference to an antisense oligomer encompasses such compounds.Antisense oligomers of the present disclosure may exist as prodrugs.

[0060] The sequence of the scrambled oligonucleotide used in Example 8 is: AAAUAAUUGAAUUUUAAAUA (SEQ ID NO: 3).

[0061] Examples of sequences complementary to Scarb1 pre-mRNA include: In the sequence listing, all "U"s have been replaced with "T"s in accordance with the requirements of WIPO ST.26. The antisense oligomers disclosed herein may contain uracil or thymine at the positions. In some embodiments, the nucleobases are as described above, including the corresponding uracils.

[0062] The antisense oligomer of the present disclosure may comprise a sequence according to any one of SEQ ID NOs: 4-20, or may be a sequence according to any one of SEQ ID NOs: 4-20, wherein the sequence comprises a modification, including an extension, a deletion, an insertion, a substitution, and wherein the antisense oligomer is capable of inducing skipping of exon 12 of Scarb1. The antisense oligomer may be complementary to 5, 10, 15, 16, 17, 18, 19, 20 or all bases to which the antisense oligomer comprising any one of SEQ ID NOs: 4-20 is complementary.

[0063] In one embodiment, the antisense oligomer of the present disclosure may comprise a sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18, or 19, or may be a sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18, or 19, wherein the sequence comprises 5, 4, 3, 2, 1 substitutions, deletions, or insertions, or does not comprise substitutions, deletions, or insertions. In particular, the sequence may comprise 3, 2, 1 substitutions, or does not comprise substitutions. In one embodiment, the antisense oligomer of the present disclosure may comprise a sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18, or 19, or may be a sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18, or 19. Antisense oligomers may include nucleotides containing 2'-O-methyl sugar moieties and / or 2'-O-methoxyethyl sugar moieties. Antisense oligomers may only include 2'-O-methyl nucleotides and / or 2'-O-methoxyethyl nucleotides. Antisense oligomers may include one or more phosphorothioate connections. In some instances, all connections within the antisense oligomer are phosphorothioate connections.

[0064] In some embodiments, the antisense oligomer does not comprise any additional nucleic acid sequence or similar nucleobases other than those set forth in any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18, or 19. In other embodiments, the antisense oligomer may comprise 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45 or more nucleobases in addition to those set forth in: i) any one of SEQ ID NOs: 4-20, ii) any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18, or 19, or iii) any one of SEQ ID NOs: 5, 8, 10, 11, 18, or 19.

[0065] In certain embodiments, the antisense oligomers of the present disclosure may comprise a sequence according to any one of SEQ ID NOs: 5, 8, 10, 11, 18 or 19, or may be a sequence according to any one of SEQ ID NOs: 5, 8, 10, 11, 18 or 19, wherein the sequence comprises 5, 4, 3, 2, 1 substitutions, deletions or insertions or no substitutions, deletions or insertions. In particular, the sequence may comprise 3, 2, 1 substitutions or no substitutions. In certain embodiments, the antisense oligomers of the present disclosure may comprise a sequence according to any one of SEQ ID NOs: 5, 8, 10, 11, 18 or 19, or may be a sequence according to any one of SEQ ID NOs: 5, 8, 10, 11, 18 or 19. The antisense oligomers may comprise 2'-O-methyl nucleotides and / or 2'-O-methoxyethyl nucleotides. The antisense oligomers may comprise only 2'-O-methyl nucleotides and / or 2'-O-methoxyethyl nucleotides. The antisense oligomer may comprise one or more phosphorothioate linkages. In some examples, all linkages within the antisense oligomer are phosphorothioate linkages. In some embodiments, the antisense oligomer does not comprise any additional nucleic acid sequence or similar nucleobases other than those set forth in any one of SEQ ID NOs: 5, 8, 10, 11, 18, or 19.

[0066] The antisense oligomers disclosed herein may comprise a sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18, or 19, or may be a sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18, or 19, wherein one or more nucleobases have been substituted with modified nucleobases. For example, one or more of the nucleobases of any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18, or 19 may be substituted with a modified nucleobase that retains the base pairing ability of the substituted nucleobase. As an example, the cytosine of any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18, or 19 may be substituted with 5-methylcytosine. In addition, any uracil in the sequences disclosed herein may be exchanged for thymidine.

[0067] The antisense oligomer may be complementary to 5, 10, 15, 16, 17, 18, 19, 20 or all bases to which the antisense oligomer comprising any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19 is complementary. The antisense oligomer may be complementary to 5, 10, 15, 16, 17, 18, 19, 20 or all bases to which the antisense oligomer comprising any one of SEQ ID NOs: 5, 8, 10, 11, 18 or 19 is complementary.

[0068] In one embodiment, the antisense oligomer is not according to or does not comprise the sequence AGCCCUUGGGAGCUGAUGUCAUCAG (SEQ ID NO: 21) (US 2005 / 0244851A1).

[0069] Examples of antisense oligonucleotides are provided below. Code: [2'oMe] <2'MOE> *Phosphorothioate

[0070] In an embodiment, the antisense oligomer of the present disclosure may comprise or may be an antisense oligonucleotide shown above as SSO8.4, SSO8.5, SSO8.7, SSO8.8, SSO8.9, SSO8.10, SSO8.11, SSO8.12, SSO8.18, SSO8.19 or SSO8.21. The antisense oligomer may be or may comprise any one of SEQ ID NOs: 35-54. Optionally, any of these antisense oligonucleotides may comprise 5, 4, 3, 2, 1 substitutions, deletions or insertions to the sequence or no substitutions, deletions or insertions to the sequence. In particular, the sequence may comprise 3, 2, 1 substitutions or no substitutions. Optionally, the antisense oligonucleotide may comprise 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 modification or no modification, for example, the linkage between one or more nucleotides may be different from a phosphorothioate linkage, or one or more nucleotides may have a sugar moiety different from the corresponding 2'-O-methyl nucleotide or 2'-O-methoxyethyl nucleotide. In a particular embodiment, the antisense oligomer of the present disclosure may comprise or may be an antisense oligonucleotide shown above as SSO8.5, SSO8.8, SSO8.10, SSO8.11, SSO8.18, SSO8.19 or SSO8.21. Within the antisense oligonucleotide, any uracil may be replaced with thymidine.

[0071] In some instances, the antisense oligomers of the present disclosure exist in an isolated form. The isolated antisense oligomers do not contain other nucleobases complementary to the target precursor mRNA. However, the isolated antisense oligomers can associate with other components, such as peptides, lipids, sugar moieties, or modifications to the 5' or 3' ends of the antisense oligomers. The association between the antisense oligomer and any of the components can be covalent or non-covalent. The antisense oligomers can be purified.

[0072] Antisense oligomers can be conjugated to one or more sugar moieties, such as monosaccharides, disaccharides or oligosaccharides. Antisense oligomers can be glycosylated or glycosylated. In one example, antisense oligomers are conjugated to at least one N-acetylgalactosamine (GalNac). GalNac can be associated with targeting antisense oligomers to the liver of a subject.

[0073] Antisense oligomers of the present disclosure may be associated with one or more other agents, such as agents that promote the delivery of antisense oligomers to relevant sites. Antisense oligomers may be associated with agents for delivering antisense oligomers to target organs (such as liver or gallbladder). Antisense oligomers may be associated with agents for delivering antisense oligomers to cells (e.g., for promoting transmembrane transfer of antisense oligomers). Antisense oligomers may be non-covalently or covalently bound to the one or more agents.

[0074] The antisense oligomers disclosed herein may be present as part of an extracellular vesicle composition. For example, the antisense oligomers may be loaded into the lumen of an exosome or associated with a component of an exosome. The antisense oligomers may be associated with a monolayer, a micelle, a bilayer, a lipid vesicle, or a liposome.

[0075] Antisense oligomers can be included in nanoparticles, such as lipid nanoparticle compositions. Antisense oligomers can be covalently or non-covalently bound to peptides that promote cell entry, such as cell penetrating peptides. The peptide for cell entry can be a polycationic peptide, can be an amphipathic peptide, can be a hydrophobic peptide, can be a stapled peptide, or can be a stitched peptide.

[0076] The antisense oligomer can be part of a vector or encoded by a vector. Therefore, the antisense oligomer can be delivered as part of a vector or by transcription from the vector. The vector can be in an extracellular vesicle (such as an exosome) or a nanoparticle. Therefore, in one embodiment, an extracellular vesicle or nanoparticle comprising a vector encoding an antisense oligomer of the present invention is provided.

[0077] In one aspect, a pharmaceutical composition comprising the antisense oligomer disclosed herein is provided. The pharmaceutical composition may comprise a pharmaceutically acceptable vehicle, a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, a pharmaceutically acceptable stabilizer, or a pharmaceutically acceptable preservative, or any combination thereof. In order to be pharmaceutically acceptable, the substance or combination of substances must be suitable for preparing a pharmaceutical composition or a medicament.

[0078] The pharmaceutical composition may comprise a therapeutically effective amount of the antisense oligomers disclosed herein. As used herein, the phrases "therapeutically effective amount" and "effective amount" etc. refer to the amount required for administration to a subject or a subject's cells, tissues or organs to achieve a therapeutic effect (such as an ameliorative effect or an alternative curative effect). The effective amount is sufficient to cause the biological or medical response of the cell, tissue, system, animal or human being that the researcher, veterinarian, doctor or clinician is seeking.

[0079] In one aspect, an antisense oligomer or pharmaceutical composition of the present disclosure is provided for use as a medicament.

[0080] In one aspect, there is a method of treatment comprising administering to a subject in need thereof a therapeutically effective amount of an antisense oligomer or pharmaceutical composition of the present disclosure.

[0081] In one aspect, there is provided a use of the antisense oligomer or pharmaceutical composition of the present disclosure for the manufacture of a medicament.

[0082] The antisense oligomers or pharmaceutical compositions disclosed herein can be used to treat or prevent metabolic-related diseases. For example, antisense oligomers can be used to treat or prevent the pathological effects of obesity and / or an obesogenic diet. The pathological effect can be liver inflammation. The pathological effect can be lipotoxicity. In some instances, the antisense oligomers disclosed herein are used to reduce hepatocyte damage and / or fibrosis in a subject in need thereof.

[0083] The antisense oligomers or pharmaceutical compositions disclosed herein can be used to reduce the level of lipotoxic species in hepatocytes. For example, the lipotoxic species can be ceramide, cholesterol and / or sphingomyelin. In some instances, the antisense oligomers disclosed herein can be used to promote the anti-atherosclerotic lipoprotein profile in the blood. The anti-atherosclerotic lipoprotein profile can be associated with a reduction in plasma VLDL and triglycerides.

[0084] In some examples, the antisense oligomers or pharmaceutical compositions of the present invention are used to treat or prevent liver inflammation. For example, obesity-induced liver inflammation. The antisense oligomers of the present invention can be used to treat or prevent metabolic-related fatty liver disease (MAFLD). The antisense oligomers of the present invention can be used to treat or prevent presymptomatic liver steatosis (fatty liver), non-alcoholic steatohepatitis (NASH), liver failure, or hepatocellular carcinoma (HCC). In a specific embodiment, the antisense oligomers of the present invention are used to treat or prevent NASH, and a therapeutically effective amount of antisense oligomers is administered to a subject in need. In another embodiment, antisense oligomers can prevent, delay or reduce the severity of HCC, wherein HCC is associated with liver inflammation (eg, NASH). In one example, a subject may suffer from NASH and be at risk of HCC, and antisense oligomers can reduce the risk of developing HCC. Alternatively, a subject may suffer from NASH and HCC, and antisense oligomers can reduce the severity of at least one symptom.

[0085] The antisense oligomers or pharmaceutical compositions disclosed herein can be used to treat or prevent gallstone disease. Antisense oligomers can be used to reduce the level of cholesterol in bile. The cholesterol level in bile can be reduced to a degree that reduces the risk of gallstone disease or the severity of gallstone disease.

[0086] Antisense oligomers or pharmaceutical compositions can be used to treat or prevent any one or a combination of type 2 diabetes, cardiovascular disease and coronary artery disease. The treatment of the pathological condition can be due to the reduction or prevention of metabolic changes in the liver. For example, the treatment of MAFLD can reduce the risk of type 2 diabetes, cardiovascular disease or coronary artery disease or reduce its severity.

[0087] Antisense oligomers or pharmaceutical compositions can be used to reduce cholesterol levels in subjects in need thereof. For example, the subject may suffer from hypercholesterolemia or MAFLD. Cholesterol levels can be total cholesterol levels, circulating cholesterol levels, free cholesterol levels, liver cholesterol levels, intrahepatic cholesterol levels and / or bile cholesterol levels.

[0088] In one aspect, a method for increasing the expression of SR-BII relative to SR-BI in a cell is provided. The method may include contacting the cell with a composition comprising an antisense oligomer of the present disclosure, or may include administering an antisense oligomer to a subject in need thereof. The level of SR-BII on hepatocytes may be increased. The method may be in vitro or in vivo.

[0089] In a specific embodiment, an antisense oligonucleotide having a nucleobase sequence according to SEQ ID NO: 5 is provided for use in a method of treatment. The oligonucleotide may comprise a modified nucleobase (e.g., 5-methylcytosine instead of cytosine, etc.). The oligonucleotide may comprise at least one modified internucleotide linkage, such as a phosphorothioate internucleotide linkage. The oligonucleotide may comprise one or more nucleotides having a modified sugar moiety, such as an -O-CH attached to the 2' position of the sugar moiety. 3 or -O-CH 2 -CH 2 -O-CH 3 Therapeutic approaches may be used to treat liver inflammation. Therapeutic approaches may be used for NASH.

[0090] In a specific embodiment, an antisense oligonucleotide having a nucleobase sequence according to SEQ ID NO: 11 is provided for use in a method of treatment. The oligonucleotide may comprise a modified nucleobase (e.g., 5-methylcytosine instead of cytosine, etc.). The oligonucleotide may comprise at least one modified internucleotide linkage, such as a phosphorothioate internucleotide linkage. The oligonucleotide may comprise one or more nucleotides having a modified sugar moiety, such as an -O-CH attached to the 2' position of the sugar moiety. 3 or -O-CH 2 -CH 2 -O-CH 3 Therapeutic approaches may be used to treat liver inflammation. Therapeutic approaches may be used for NASH.

[0091] In a specific embodiment, an antisense oligonucleotide having a nucleobase sequence according to SEQ ID NO: 18 is provided for use in a method of treatment. The oligonucleotide may comprise a modified nucleobase (e.g., 5-methylcytosine instead of cytosine, etc.). The oligonucleotide may comprise at least one modified internucleotide linkage, such as a phosphorothioate internucleotide linkage. The oligonucleotide may comprise one or more nucleotides having a modified sugar moiety, such as an -O-CH attached to the 2' position of the sugar moiety. 3 or -O-CH 2 -CH 2 -O-CH 3 Therapeutic approaches may be used to treat liver inflammation. Therapeutic approaches may be used for NASH.

[0092] The antisense oligomers or pharmaceutical compositions disclosed herein can be administered to a subject by any suitable means. Suitable means for administering antisense oligomers (such as oligonucleotides, nucleic acids, and nucleic acid analogs) are known in the art. For example, antisense oligomers or pharmaceutical compositions can be administered intravenously or subcutaneously.

[0093] The pharmaceutical compositions of the present disclosure can be formulated for administration to any subject in need thereof. As used herein, a "subject" can be a vertebrate, a mammal, or a livestock. Most preferably, the subject is a human.

[0094] Suitable dosing regimens can be used according to the organism to be treated. In non-limiting examples, the dosage can be 1 mg / kg to 100 mg / kg, 20 mg / kg to 60 mg / kg, or 40 mg / kg. It should be understood that the antisense oligomers or pharmaceutical compositions according to the present disclosure can be used in monotherapy. Alternatively, the antisense oligomers or pharmaceutical compositions according to the present disclosure can be used as adjuvants for known therapies or in combination with known therapies. The antisense oligomers or pharmaceutical compositions can be administered before, during, or after the onset of a pathological condition.

[0095] Unless otherwise indicated, the terms "treat", "treating", "treatment" and the like as used herein refer to reversing, alleviating, inhibiting the course of the disease, disorder or condition to which such terms apply, or preventing the disease, disorder or condition, or one or more symptoms of such disease, disorder or condition, and include the administration of any antisense oligomer, pharmaceutical composition or dosage form described herein to prevent the onset of symptoms or complications, or to alleviate symptoms or complications, or to eliminate the disease, condition or condition. For example, treatment is curative or ameliorative. "Prevention" as used herein means complete or partial prevention, or improvement or control, or reduction or cessation of the generation or occurrence of the thing or event (e.g., disease, disorder or condition) to be prevented.

[0096] As used herein, the terms "administering," "administer," "administration," and the like refer to any manner of transferring, delivering, introducing, or transporting a therapeutic agent to a subject in need of treatment with such an agent.

[0097] It should be understood that wherever an embodiment is described herein with the language "comprising," other similar embodiments described with "consisting of" and / or "consisting essentially of" are also provided.

[0098] All features described herein (including any accompanying claims, abstract, and drawings) and / or all steps of any method or process so disclosed may be combined with any of the above-described aspects in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive.

[0099] In order to better understand the present invention and to show how to carry out embodiments of the present invention, reference will now be made to examples which are not intended to limit the present invention in any way.

[0100] Example Overview

[0101] RNA alternative splicing (AS) expands the regulatory potential of eukaryotic genomes. The liver is a transcriptionally highly complex organ. However, the mechanisms regulating liver-specific AS profiles and their contribution to liver function are unclear. Here, we explored the links between diet, AS, and metabolic flexibility in the liver. We identified a critical role for the splicing factor RNA-binding Fox protein-2 (RBFOX2) in maintaining cholesterol homeostasis in an obesogenic setting. Using enhanced individual-nucleotide resolution UV-crosslinking and immunoprecipitation (eiCLIP), we identified physiologically relevant targets of RBFOX2 in mouse liver, including the class B type I scavenger receptor (Scarb1). Our findings suggest that a specific AS program actively maintains liver physiology and, when dysregulated, contributes to the lipotoxic effects of an obesogenic diet. Use of splice-switching oligonucleotides targeting this network attenuated obesity-induced inflammation in the liver and promoted an anti-atherogenic lipoprotein profile in the blood, highlighting the potential of subtype-specific RNA therapeutics for the treatment of metabolic-related diseases. Example 1 - Nutrition-Promoted Changes in Hepatic Splicing Mechanisms

[0102] To investigate the molecular mechanisms involved in liver metabolic plasticity during health and disease, we performed unbiased analyses of the liver transcriptome (RNAseq) and proteome (tandem mass tags; TMT / MS) of mice fed a control (CD) or high-fat (HFD) diet under fed and starved conditions ( Figure 1 A). Proteomic analysis identified 5999 proteins in all experimental conditions (Supplementary Table 1 - see Paterson et al., Nature Metabolism). Principal component analysis confirmed the effects of dietary intervention on the liver proteome ( Figure 1 B, upper panel) and transcriptome ( Figure 1 B, lower panel). Gene ontology analysis showed that the feeding / fasting cycle specifically altered the expression of “spliceosomal” proteins involved in pre-mRNA splicing (FDR = 2.43*10 -9 ) and core metabolic categories such as "insulin signaling" and "TCA cycle" ( Figure 1 C in the figure above, Figure 8 AB). Similarly, consumption of HFD altered the expression of spliceosomal proteins in the liver (FDR = 4.72*10 -2 )( Figure 1 C in the figure below, Figure 8CD). Thus, components of the pre-mRNA splicing machinery are selectively regulated by metabolic inputs in the liver, suggesting potential effects on pre-mRNA splicing and / or alternative splicing (AS).

[0103] Direct analysis of AS profiles by RNAseq identified significant changes associated with feeding / fasting cycles in mice fed a control diet and a HFD ( Figure 1 D). AS changes promoted by HFD included exon skipping (SE) as the most abundant category (55%), followed by intron retention (RI; 13%), alternative 3' splice site (A3SS; 14%), alternative 5' splice site (A5SS; 11%), and mutually exclusive exons (MXE; 7%). Increased sugar consumption is an important cause of diet-induced liver disease and related cardiometabolic diseases. We investigated AS as an alternative model of diet-induced obesity. 16 AS events promoted by a high-fructose (HFr) diet. AS changes associated with a HFr diet included exon skipping (SE), which was the most abundant AS event identified under these conditions (56%), followed by intron retention (RI; 17%), alternative 3' splice site (A3SS; 16%), alternative 5' splice site (A5SS; 9%), and mutually exclusive exons (MXE; 2%) ( Figure 1 D) AS changes promoted by feeding / fasting cycles in CD mice are strongly attenuated in diet-induced obesity ( Figure 8 E), suggesting that perturbations in the liver AS network contribute to the reduced metabolic plasticity observed in obesity. Together, these results reveal specific changes in the pre-mRNA AS program in both physiological (feeding / fasting cycles) and pathophysiological (HFD-induced obesity and HFr-induced obesity) adaptations. Example 2 - Dietary regulation of the splicing factor RBFOX2 in the liver

[0104] We investigated which splicing factors (SFs) promote the changes detected in the liver AS profile under different nutritional states. We reasoned that SFs controlling the splicing network in the liver should (a) show detectable expression in the liver and / or hepatocytes, and (b) have enriched binding at regions within or surrounding alternatively spliced ​​exons in the liver. We therefore performed an unsupervised motif enrichment analysis of sequences within and surrounding alternatively spliced ​​exons in the liver under physiological (feeding / fasting cycles) and pathological (diet-induced obesity) states. This revealed a significant enrichment of SF binding motifs including RBFOX2, CUGBP2, SRSF1, PTBP1, and MBN1 ( Figure 8 FG). Analysis of SFs with conserved cross-linking peaks in and around AS exons in human hepatocytes. 17Eight SFs (U2AF2, RBFOX2, QKI, hnRNPC, PCBP2, TIA1, hnRNPM, and TAF15) were identified as top 20% ranking factors in all three comparisons analyzed: feeding / fasting cycle ( Figure 1 E) HFD-induced obesity ( Figure 1 F) and HFr-induced obesity ( Figure 1 G). Additional analyses confirmed that RBFOX2 is expressed in the liver ( Figure 1 H) In addition, the mouse single-cell RNAseq dataset 18 Analysis of hepatocytes showed that hepatocytes accounted for the majority of Rbfox2 expression in the liver, although Rbfox2 was also detected in endothelial cells ( Figure 2 A). Other splicing factors that may be involved in AS regulation show broader expression in other liver-resident cell populations ( Fig. 9 ). We generated Alb_cre - Rbfox2 LoxP / LoxP (L WT ) and Albécre + Rbfox2 LoxP / LoxP (L ΔRbfox2 ) mice to selectively inactivate the Rbfox2 gene in hepatocytes. Western blot analysis showed that ΔRbfox2 RBFOX2 was undetectable in the liver of mice, confirming that hepatocytes account for the majority of its expression in the liver ( Figure 2 B). These results suggest a relevant role for RBFOX2 in regulating AS in hepatocytes.

[0105] Our proteomic and transcriptomic analyses revealed that Rbfox2 is regulated at the transcriptional level by the feeding / fasting cycle in the liver ( Figure 8 AB). Using alternative promoters and AS can generate multiple RBFOX2 isoforms with different splicing activities. 19 Western blot analysis showed that both HFD- and HFr-induced obesity were associated with decreased expression of the major RBFOX2 isoform in the liver ( Figure 2 C). Furthermore, TMT / MS proteomic analysis showed that these changes were associated with decreased levels of full-length active RBFOX2 ( Figure 2 D), suggesting a potential loss of RBFOX2 function in the liver in diet-induced obesity. Taken together, these data suggest that RBFOX2 may play a specific role in coordinating dynamic AS changes in response to physiological and pathological metabolic signals. Example 3—RBFOX2 controls cholesterol regulatory genes via AS

[0106] Splicing factors often regulate AS through interrelated cis- and trans-mediated effects 20,21 . However, the identification of direct targets of endogenous splicing factors in the liver is hampered by rapid pre-mRNA degradation during cross-linking and immunoprecipitation (iCLIP) analysis in liver samples. Therefore, very limited information is available about the AS programs in the adult liver that contribute to maintaining or perturbing homeostasis. To overcome this problem, we employed an 'enhanced single nucleotide resolution iCLIP' (eiCLIP) protocol with an accelerated and improved library preparation workflow (see Methods) to significantly enhance the recovery of RBFOX2 cross-linked pre-mRNA products ( Figure 3 A; 10A). The specificity of the signal was confirmed by peak analysis, showing enrichment at the previously described RBFOX2 consensus sequence (U)GCAUG binding motif. 22 ( Figure 3 B) Furthermore, our analysis revealed that in hepatocytes, direct RBFOX2 targets include previously described bona fide targets such as Ptbp2 and Snrnp70 20 ( Fig.10 BC).

[0107] RBFOX2 protein promotes or inhibits AS in a position-dependent manner 20,22-27 ( Fig.10 D) Analysis of RBFOX2 cross-linking sites upstream or downstream of the AS exon (in L WT With L ΔRbfox2 Identified by RNAseq in mice; Fig.10 E) shows that in liver, this position effect is more robust in enhanced exons (50.0%) than in repressed exons (27.9%) compared with control exons (25.1%) ( Figure 3 C).

[0108] Gene ontology analysis showed that the RBFOX2 cross-linked cluster encoded genes involved in phosphatidylcholine-sterol-O-acyltransferase activity (adjusted p value = 3.66*10 -2 ), lipoprotein particle receptor binding (adjusted p value = 1.13*10 -2 ), apolipoprotein receptor binding (adjusted p value = 2.61*10 -3 ) and LDL particle receptor-binding protein transcripts, suggesting a role for RBFOX2 in controlling lipid metabolism ( Figure 3 D). In addition, other targets involved included cadherin binding (adjusted p value = 7.42*10 -16 ), disordered domain-specific binding (adjusted p value = 2.72*10 -4) and RNA binding proteins (RBP) (adjusted p value = 3.72*10 -14 ), which emphasizes the role of RBFOX2 in mediating an additional layer of transcriptional regulation 20 A list of RBFOX2-targets contributing to each Gene Ontology category is included in Supplementary Table 2 (see Paterson et al., Nature Metabolism).

[0109] Human orthologs of mouse RBFOX2 targets detected by eiCLIP are highly enriched in genes implicated in GWAS in human lipid metabolism phenotypes, LDL cholesterol levels, or triglycerides ( Figure 3 E) These include the Scarbl gene encoding the class B scavenger receptor SR-BI, the HDL receptor that mediates cholesterol uptake and alters plasma HDL and bile cholesterol 28,29 , Pla2g6 (which is group VI phospholipase A2) 30 , Sec31a (which is involved in SREBP1 activation 31 and processing of lipoproteins containing ApoB 32 The oxidized sterol-binding protein Osbpl9 and Numb, an adaptor protein involved in clathrin-dependent reverse cholesterol transport from bile, are also involved. 33 .

[0110] Further analysis of the eiCLIP profile at the Scarb1 pre-mRNA transcript revealed that RBFOX2 binds upstream of exon 12. ΔRbfox2 PCR analysis of mouse liver confirmed that RBFOX2 promotes Scarb1 exon 12 skipping ( Figure 3 F). In addition, RBFOX2 promotes Pla2g6 ( Figure 3 G), Numb( Figure 3 H), Osbp19( Figure 3 I) and Sec31a( Fig.10 Analysis of RBFOX2 binding in human hepatoma cells confirmed the conservation of RBFOX2 cross-linking within alternatively spliced ​​exons in orthologous human transcripts ( Fig.10 GJ). Taken together, these results reveal that RBFOX2 directly regulates AS of a gene network involved in lipid homeostasis in the liver. Example 4—RBFOX2 regulates cholesterol metabolism in an obesogenic diet

[0111] L ΔRbfox2 The mice were viable and born in the expected Mendelian ratio. When fed a control chow, HFD, or HFr diet, L ΔRbfox2The mice did not show body weight ( Fig.11 AC) or glucose tolerance ( Fig.11 DF), indicating that RBFOX2 ablation does not interfere with normal liver development. In contrast to the normal glucose homeostasis observed, lipid profile analysis revealed that when consuming the HFr diet, L ΔRbfox2 Male mice showed a significant decrease in total cholesterol ( Figure 4 A), but no significant decrease in triglycerides ( Figure 4 B) In the study of L WT and L ΔRRbfox2 Similar results were obtained in female mice ( Fig.11 GH).

[0112] The liver plays a central role in lipid homeostasis. To investigate the metabolic changes associated with this altered lipid profile, lipid profiles from L. WT With L ΔRbfox2 Principal component analysis showed that the HFr diet was associated with significant changes in the overall metabolomic profile compared with CD samples ( Figure 4 C). In mice fed a HFr diet, ablation of RBFOX2 was associated with increased hepatic lipid content, particularly cholesteryl esters (CE), total cholesterol, and sphingomyelin ( Figure 4 D). Although we did not observe differences in the pattern of steatosis ( Fig.11 I), but we note that L ΔRbfox2 Changes in triglyceride (TG) composition favoring longer polyunsaturated fatty acyl chains (as indicated by the PUFA / non-PUFA TG ratio) in mice when fed a HFD. ΔRbfox2 The mice also showed an increase in total cholesterol esters in the liver. However, in contrast to mice fed the HFr diet, they did not show overall changes in cholesterol or sphingomyelin ( Fig.11 JM) and showed no changes in blood cholesterol ( Fig.11 N), which means that in giving L ΔRbfox2 Some of these phenotypes were exacerbated when mice were fed the pro-lipogenic HFr diet.

[0113] CLIP-seq analysis revealed conservation of RBFOX2 targets in humans ( Fig.10 GJ). To investigate whether RBFOX2 is involved in lipid metabolism in human hepatocytes, we derived iPSC-derived hepatocytes and used siRNA to silence RBFOX2 ( Figure 4 E). Effective RBFOX2 silencing was confirmed by qPCR analysis ( Figure 4F). RBFOX2 silencing did not affect the expression of mature hepatocyte / differentiation markers such as ASGPR2, SERPINA1 and SERPINA2 ( Fig.12 A). Consistent with human RBFOX2 binding to pre-mRNA, the effects of RBFOX2 deficiency on alternative splicing of SCARB1, SEC31A, OSBPL9, and PLA2G6, as well as NUMB, were maintained in human hepatocytes ( Figure 4 GJ), which confirms the conservation of this regulatory network. In addition, lipidomic analysis of human hepatocytes showed that RBFOX2 silencing promoted changes in lipid composition ( Fig.12 B), including the accumulation of CE and SM ( Figure 4 LM). These results further support a role for RBFOX2 in controlling a conserved AS network involved in lipid metabolism.

[0114] Cholesterol in L ΔRbfox2 The simultaneous accumulation of RBFOX2 in the liver and reduction of cholesterol in plasma of mice suggests that RBFOX2 plays a specific role in the regulation of hepatic cholesterol uptake, transport, and / or efflux. To gain insight into these mechanisms, we used RNAseq to compare the expression of RBFOX2 in L. WT Mouse and L ΔRbfox2 Transcriptome of mice. Ablation of RBFOX2 in the liver leads to a decrease in cholesterol biosynthesis (ratio = 0.138; p value = 1.7*10 -5 ), mevalonate pathway (ratio = 0.214; p value = 5.25*10 -5 ), LXR pathway (ratio = 0.02; p value = 2.75*10 -2 ) and FXR pathway (ratio = 0.02; p value = 3.09*10 -2 ) changes, which is consistent with the role of RBFOX2 in lipid and cholesterol metabolism. -17 ) and mitochondrial dysfunction (ratio = 0.0877; p value = 2.51*10 -14 ) were found to have additional changes.

[0115] Cholesterol metabolism is controlled by a feedback mechanism involving sterol regulatory element binding proteins (SREBPs), a family of ER-resident transcription factors. 34 Specific qPCR analysis of genes involved in cholesterol homeostasis showed that elevated hepatic cholesterol was not associated with increased expression of key biosynthetic genes, including Srebf2, Hmgcs, and Hmgcr ( Fig.12C), indicating that this feedback regulation remains intact. Increased expression of Abca1, Abcg8, and Nr1h2 (LXRβ) and Nr1h3 (LXRα) genes further suggests a compensatory increase in cholesterol efflux pathways caused by cholesterol accumulation in RBFOX2 deficiency ( Fig.12 C) Consistent changes were also observed at the protein level for ApoB, although ABCA1 WT and L ΔRbfox2 The difference between the Fig.12 D).

[0116] Reverse HDL cholesterol uptake and conversion to bile acids in the liver is the major pathway for cholesterol excretion via bile. ΔRbfox2 The reduction of blood cholesterol and the simultaneous increase of cholesterol in the liver of mice can lead to an increase in bile acid levels. Consistent with this hypothesis, LC-MS / MS analysis showed an increase in bile acids such as taurocholic acid, taurodeoxycholic acid, tauroursodeoxycholic acid, and cholic acid ( Fig.12 EK). When fed HFD, WT Compared with control mice, L ΔRbfox2 The mice also showed an increase in intrahepatic bile acids ( Fig.12 LU). Taken together, these results show that liver-specific ablation of Rbfox2 leads to cholesterol accumulation in the liver, increased conversion to bile acids, and subsequent activation of the LXR and FXR pathways.

[0117] Next, we hypothesized that changes in RBFOX2 activity could coordinate this downstream AS network in response to changes in diet. To test this idea, we analyzed L. WT Mouse and L ΔRbfox2 AS changes of Scarb1, Pla2g6, and Numb in mice. Consistent with our hypothesis, HFr in L WT mice promoted significant AS changes, while L ΔRbfox2 Mouse Pla2g6 ( Fig.13 A) Scarb1 Fig.13 B) and Numb( Fig.13 C) failed to induce obesity-specific AS events. Analysis of other targets such as Sec31a and Osbpl9 confirmed the strong regulation of RBFOX2 ( Fig.13 EF), however, no effect of diet was detected, suggesting that other factors may play a role in the regulation of these genes under obesogenic conditions.

[0118] To gain further mechanistic insights into the regulation of this AS network by RBFOX2, we investigated whether changes in alternative splicing were associated with reduced levels of active RBFOX2 or increased levels of inactive (lacking the RRM motif) protein ( Figure 2 CD). To investigate this, we generated an AAV vector expressing RBFOX2 lacking the RRM motif (RBFOX2-Δ6) ( Figure 5 A). Expression was confirmed by Western blot and qPCR ( Figure 5 AB). However, overexpression of RBFOX2-Δ6 did not mimic the AS changes associated with RBFOX2 inactivation in mouse and human hepatocytes ( Figure 5 C). We next generated a vector overexpressing full-length RBFOX2 (containing the RRM motif) ( Figure 5 D; 13G). Notably, overexpression of active RBFOX2 promoted AS changes in the opposite direction to RBFOX2 deficiency ( Figure 5 E; 13G), indicating that the level of active RBFOX2 is more relevant for AS regulation in the liver than the expression of the dominant negative form.

[0119] LC-MS / MS lipidomics analysis showed that RBFOX2 overexpression was associated with decreased cholesterol in the liver ( Figure 5 F) and reduction of cholesterol in bile ( Figure 5 Transient overexpression of RBFOX2 was associated with a mild increase in blood HDL cholesterol that did not reach statistical significance ( Figure 5 H). Taken together, these results demonstrate that RBFOX2 regulates a network of genes involved in lipid metabolism and that changes in full-length RBFOX2 expression alter cholesterol profiles under a lipogenic diet. Example 5 - Hepatic expression of RBFOX2 is controlled by FOXA1 / 2

[0120] To characterize the upstream regulators of RBFOX2 in human liver, we used the FANTOM5 CAGE dataset of transcription start sites, because the RBFOX2 gene has a complex architecture containing multiple promoters. 19 ( Figure 6 A). This analysis concluded that RBFOX2 expression in human hippocampus or aortic smooth muscle is driven by two promoters - a proximal promoter and a distal promoter - with similar activity levels. On the other hand, in hepatocytes, the distal promoter mainly controls RBFOX2 expression (3-fold change compared to the proximal promoter). CAGE data detected a third promoter in human hepatocytes that does not overlap with the previously annotated RBFOX2 promoter ( Figure 6A). This promoter and a common distal promoter account for the majority of RBFOX2 transcription in human hepatocytes. Both show enrichment of H3K4me3 and H3K27ac in adult liver by ChIP-seq, consistent with their role as active hepatic promoters.

[0121] Further analysis of the liver ChIP-seq dataset revealed that the RBFOX2 promoter was expressed in humans ( Figure 6 A, bottom inset) and mice ( Fig.13 H) is bound by FOXA1 / 2. FOXA1 / 2 are winged helix transcription factors involved in bile acid metabolism and preventing hepatic cholestasis 35 To verify the role of FOXA1 / 2 in Rbfox2 regulation, we knocked down Foxa1 and Foxa2 in mouse hepatocellular carcinoma Hepa1-6 cells, which resulted in a significant decrease in Rbfox2 expression ( Figure 6 B) In contrast, overexpression of FOXA1 in HepG2 cells 36 was associated with a significant increase in RBFOX2 expression, but not RBFOX1 / 3 ( Figure 6 C). Together, these results identify an active promoter of RBFOX2 in the liver and demonstrate that the transcription factors FOXA1 / 2 are upstream regulators of RBFOX2 in human and mouse liver. Example 6 - Scarb1 is a RBFOX2 target with therapeutic potential

[0122] To elucidate the molecular mechanisms underlying the role of RBFOX2 in lipid homeostasis, we performed a systematic design of splice-switching oligonucleotides that regulate alternative splicing of RBFOX2 downstream targets. The potency of the SSOs was tested by PCR and subsequent capillary electrophoresis. Next, the SSOs that showed potent activity for each splicing event were further used for lipidomic analysis in primary hepatocytes (Table 1).

[0123] LC / MS metabolomics analysis revealed that RBFOX2-deficient hepatocytes displayed increased lipid accumulation ( Fig.13 I), confirming the role of RBFOX2 in lipid metabolism in hepatocytes. Although SSO7.9, which promotes changes in Numb exon 3, was not associated with significant lipid remodeling ( Fig.13 J), but SSOs targeting Numb exon 9, Sec31 exon 21, Pla2g6 exon 10, Osbpl9 exon 6, and Scarb1 exon 12 were associated with specific changes in lipid composition ( Fig.13 J), suggesting that these isoforms mediate the effects of RBFOX2.

[0124] SSO-induced skipping of exon 9 in the Numb transcript ( Fig.14 A) restored the accumulation of many lipid species, including phospholipids PC(36:3), PC(40:7), PE(38:5), PC(38:4), PC(36:2), PC(40:5), triglycerides such as TG(58:8), TG(62:13), TG(58:8), TG(56:7), TG(56:2) or TG(54:2), etc. ( Fig.14 B). Expression of the short Sec31a isoform (skipping exon 21) is associated with increased levels of specific lipid species such as PC(36:2), TG(51:1), PC(32:0), PC(34:0), DG(38:4) or lysoPC(22:6) ( Fig.14 CD). Expression of the short Osbp19 isoform (exon 6 skipping) in wild-type cells promoted an increase in specific species such as Cer(40:2), TG(50:1), TG(51:1), PC(32:0), PC(34:0), DG(38:4), PE(40:7), similar to RBFOX2-deficient hepatocytes and suggested a previously uncharacterized role in lipid metabolism ( Fig.15 AB). Expression of the long Pla2g6 isoform including exon 10 ( Fig.15 CD) is associated with small changes in lipid composition ( Fig.15 E).

[0125] Inclusion of Scarb1 exon 12 produces the typical SR-BI isoform, whereas skipping of this exon generates an alternative receptor variant with a different adaptor carboxyl-terminal domain, which is termed SR-BII 37 SR-BI / II is a scavenger receptor for a variety of ligands, including very low-density lipoprotein (VLDL) and high-density lipoprotein (HDL), which are involved in the transport of cholesterol, cholesterol esters, phospholipid-PC, sphingomyelin, lysoPC, and other lipid species. 38 However, the overall impact and pathophysiological significance of these splice variants on liver lipidomics have not been determined. SSO8.3 showed significant activity in inhibiting exon 12 inclusion in primary hepatocytes ( Fig.16 A) LC / MS analysis showed that this treatment was consistent with L ΔRbfox2 The results were associated with significant changes in lipid composition in hepatocytes, which partially restored some of the changes associated with RBFOX2 deficiency, such as increased total ceramide ( Fig.16 C), PUFA / non-PUFATG ratio ( Fig.16 D) and the number of SM and TG ( Fig.16 GI).

[0126] Elevated intrahepatic levels of cholesterol, ceramide, sphingomyelin, and other lipotoxic species are implicated in the pathogenesis of obesity-induced steatohepatitis 13,38 .

[0127] Although SCARB1 is a complex therapeutic target, the effect of SSO8.3 in reducing the levels of some of these lipid species in hepatocytes suggests that strategies aimed at promoting the SR-BII isoform may help to reduce obesity-induced inflammation in vivo. To test this, we injected SSO8.3, a scrambled control SSO (Scr), or saline into mice fed an obesogenic HFr diet ( Figure 7 A, upper panel). SSO8.3 showed potent activity in antagonizing Scarb1 exon 12 inclusion in the liver in vivo ( Figure 7 B, 16J). SSO8.3 was designed to avoid potential off-target effects. This specificity was confirmed by evaluating potential expression changes in the top three potential off-target genes via qPCR ( Fig.16 KM). No weight loss was detected ( Figure 7 A, lower panel) or an increase in transaminases ( Fig.16 NO), indicating that RNA injection was not associated with toxic side effects. IHC analysis of liver sections showed reduced macrophage infiltration in the livers from SSO8.3-injected mice ( Figure 7 C). qPCR analysis showed that the expression of inflammatory markers (Arg1, F4 / 80, and Tnfa) and fibrotic markers (Tgfb1 and Colla1) were significantly downregulated in mice treated with SSO8.3 ( Figure 7 D). and reduced lipid load in hepatocytes ( Figure 7 EF), SSO8.3-treated mice showed a reduced liver / total body weight ratio ( Fig.16 P) and decreased secretion of cholesterol and phospholipids into bile ( Figure 7 G), indicating reduced reverse cholesterol transport into the liver.

[0128] Genetically modified mouse models have shown complete inactivation of Scarb1 39 Liver-specific inactivation 40 Correlated with increased VLDL, LDL, and HDL levels and increased atherosclerosis, whereas overexpression of SR-BI had the opposite effect 28 SSO8.3 treatment resulted in a slight but significant increase in total cholesterol levels and a decrease in blood triglycerides ( Figure 7H). These results suggest that SSO8.3 treatment results in specific effects on VLDL and HDL lipoproteins by increasing SR-BII isoform expression. Consistent with this hypothesis, lipoprotein analysis showed a strong decrease in VLDL lipoproteins and increased HDL and LDL levels ( Figure 7 I). To further confirm these findings, lipid species content was directly quantified in the isolated lipoproteins. This analysis revealed major changes in lipoprotein composition, including a decrease in the cholesterol content of VLDL, while the cholesterol content of HDL and LDL increased after SSO8.3 treatment ( Fig.17 AC). SSO8.3 treatment and adipogenic genes ( Fig.17 D) or total triglyceride content in the liver ( Fig.17 E) changes. For these reasons, although we cannot rule out the contribution of reduced VLDL secretion, the reduced total triglyceride blood levels, VLDL triglyceride blood levels and LDL triglyceride blood levels indicate that SSO8.3 accelerates VLDL lipolysis and residue formation. However, the confirmation of this mechanism will require further study.

[0129] Together, these results suggest that RBFOX2 coordinates an alternative splicing network in the liver that promotes specific changes in lipid metabolism and co-regulates the homeostasis of lipid species, including cholesterol, sphingomyelin, and phospholipids. In particular, the SR-BI / II splicing switch may be therapeutically targeted to reduce liver inflammation and alter lipid profiles. Example 7 - Scarb1 AS mediates the effects of RBFOX2 in cholesterol metabolism

[0130] RBFOX2 deficiency is not associated with changes in cholesterol biosynthesis and lipogenesis ( Fig.12 C; 17D). In addition, our data support that SR-BI / II-mediated increased lipid uptake contributes to the increased accumulation of cholesterol and other lipids in RBFOX2 deficiency. We hypothesized that this mechanism could also contribute to the changes in blood cholesterol associated with RBFOX2 deficiency through increased reverse cholesterol uptake and excretion into bile. To explore this possibility, we first engineered AML12 hepatocytes that simultaneously expressed codon-optimized SR-BI or SR-BII ( Figure 7 J, 17F). Absolute qPCR quantification confirmed comparable expression levels of SR-BI and SR-BII ( Fig.17 G). FACS analysis showed that expression of SR-BI isoforms (including exon 12) was associated with increased lipid uptake from Dil-HDL lipoprotein ( Figure 7 J).

[0131] Next, we investigated the contribution of SR-BI / II subtypes to the role of RBFOX2 in vivo. We treated L WT mice and L ΔRbfox2 mice with Scr control or SSO8.3 to antagonize the SR-BII subtype in L ΔRbfox2 mice. Notably, SSO8.3 effectively restored the SR-BI / SR-BII ratio in the livers of L ΔRbfox2 mice ( Fig.17 H). Blood lipoproteins were isolated and lipid composition was quantified. In L ΔRbfox2 mice, the cholesterol and phospholipid contents in HDL were decreased, and these differences were eliminated by restoring the SR-BI / SR-BII ratio, which confirmed the contribution of this subtype conversion and cholesterol transport to the role of RBFOX2 in the liver ( Figure 7 K). Further analysis confirmed that cholesterol in bile increased after inactivation of RBFOX2 in the liver ( Figure 7 E), while acute adenovirus-mediated overexpression of RBFOX2 led to the opposite effect ( Figure 5 G). In addition, conversion of Scarb1 subtype expression by SSO8.3 treatment restored cholesterol excretion in bile ( Figure 7 E) and total blood cholesterol levels ( Fig.17 J), which further confirmed that SR-BI / II-mediated reverse cholesterol transport contributed to the role of RBFOX2 in cholesterol metabolism. Purification and analysis of blood LDL and VLDL showed that RBFOX2 deficiency was associated with changes in cholesterol and phospholipids that did not reach statistical significance, indicating a major role of RBFOX2 in cholesterol HDL uptake ( Fig.17 K-L). Collectively, these results revealed a new role of RBFOX2 in controlling lipid metabolism and showed that SR-BI / SR-BII subtype conversion played a key role in this mechanism by regulating HDL lipoprotein homeostasis. Discussion of Examples 1 to 7

[0132] In the liver, precursor mRNA alternative splicing (AS) is largely considered a housekeeping mechanism involved in adjusting the transcriptome to maintain cell identity. Although several splicing factors have been shown to play a role in this regulation 41-45 , the contribution of specific AS networks (splicing factors and downstream subtypes) to fluctuating metabolic demands remains to be characterized.

[0133] Here, we describe a role for RBFOX2 in regulating genes involved in lipid metabolism in the liver. This AS network is modulated by an obesogenic diet, and RBFOX2 is essential for this regulation. In mammals, the Rbfox family includes three paralogs: Rbfox1, Rbfox2, and Rbfox3. RbFox1 is expressed in neurons, heart, and muscle; Rbfox3 expression is restricted to neurons; whereas Rbfox2 has a broader expression profile 46 We have found that Rbfox2 is mainly expressed in hepatocytes in the liver, and that ablation of the Rbfox2 gene in hepatocytes leads to decreased blood cholesterol and increased intrahepatic levels of cholesterol, bile acids, and other lipids, revealing a role for RBFOX2 in controlling lipid profiles.

[0134] Elevated circulating and intrahepatic cholesterol levels contribute to metabolic-associated fatty liver disease (MAFLD) and promote coronary artery disease 14,15 Hepatic cholesterol overload is also thought to be a key cause of the progression of liver damage and inflammation. 13,38,47 Cholesterol levels are tightly regulated to ensure a constant supply to tissues while preventing the deleterious effects of excessive accumulation. Characterization of this AS network in the liver suggests that cholesterol homeostasis in health and disease involves an additional layer of complexity.

[0135] We demonstrate that RBFOX2-mediated regulation of splice variants in Scarb1, Pla2g6, Numb, Sec31a, or Osbpl9 transcripts is conserved in humans and has specific roles in controlling lipid composition. While the coordinated activity of this splicing network accounts for the effects of RBFOX2 in lipid metabolism, individual components can be targeted with splice-switching oligonucleotides to trigger specific changes in hepatocyte lipid content. Two distinct canonical receptors, SR-BI and SR-BII, are generated by inclusion / skipping of exon 12 of the Scarb1 gene. SR-BI has increased activity in HDL binding and promotes selective import of cholesterol esters 37,48 However, the regulation and biological significance of this splicing event have not been described. In humans and in some mouse models, plasma HDL cholesterol levels are inversely correlated with the risk of atherosclerosis. 49 For this reason, there is considerable interest in SR-BI as a therapeutic target for altering lipid metabolism by increasing HDL-C levels. However, human genetic studies 50 Gain-of-function 28 and loss-of-function 39Mouse models have shown that SR-BI activity is anti-atherogenic, emphasizing that HDL cholesterol flux is more important than steady-state levels. We found that by promoting SR-BII expression, RBFOX2 blocks reverse cholesterol flux from HDL lipoproteins, a mechanism that ensures proper distribution and prevents excessive cholesterol loss. Consistently, under a lipogenic diet, RBFOX2 inactivation was associated with reduced total and HDL cholesterol in the blood and elevated cholesterol in the liver and subsequent excretion in bile.

[0136] Furthermore, by promoting SR-BII expression, the splice-switching oligonucleotide SSO8.3 significantly reduced the accumulation of lipotoxic species such as ceramide, cholesterol, and sphingomyelin, and this effect was associated with reduced expression of inflammatory markers in the liver.

[0137] Treatment with SSO8.3 to promote expression of the SR-BII isoform in vivo was associated with substantial reductions in plasma VLDL and triglycerides. These results suggest that expression of the SR-BII isoform may promote an antiatherogenic lipoprotein profile by accelerating VLDL catabolism rather than loss- or gain-of-function. Although our results clearly establish that the RBFOX2-SR-BI / II axis plays a key role in controlling cholesterol homeostasis, the contribution of SR-BI / II splicing switching to triglyceride homeostasis appears to be more complex, as RBFOX2 inactivation was not associated with changes in total circulating triglycerides. Clarification of this point requires further studies.

[0138] RNA-based drugs, such as Inksilicon 8 Mipomersen 7 Cholesterolemia was significantly reduced by targeting PCSK9 and ApoB mRNA, respectively. Recent improvements in the design and pharmacokinetics of RNA-based oligonucleotides should enable the development of subtype-specific therapeutics for common metabolic pathologies. However, this avenue is underexplored due to limited characterization of key subtypes that either maintain health or promote disease. Our work provides proof of principle for the potential of RNA therapeutics targeting individual subtypes in the liver. Example 8 - Development of a humanized version of an SSO targeting the SCARB1 gene

[0139] Examples 1 to 7 identify the class B type I scavenger receptor (Scarb1) as a potential new target for regulating lipid metabolism and liver inflammation in non-alcoholic steatohepatitis (NASH). Scarb1 has two AS variants: SR-BI including exon 12 / SR-BII skipping exon 12. A high fructose diet in mice increases the expression of SR-BI, which is involved in the transport of cholesterol and other lipid species. By increasing SR-BI expression, the body promotes the liver's uptake of cholesterol and other lipids, leading to inflammation and liver toxicity. In contrast, splice switching oligonucleotides (SSOs) specifically targeted to promote the expression of an isoform (SR-BII) that skips exon 12 lead to a reduction in lipid load in the liver of mice.

[0140] Results in mice showed that treatment with the 21nt oligonucleotide SSO8.3 was associated with significant changes in liver and circulating lipids, with clear therapeutic effects: 1) reduced liver inflammation, which may be beneficial for NASH, 2) reduced blood triglycerides, 3) reduced intrahepatic cholesterol, and 4) reduced cholesterol levels in bile (which is associated with gallstone disease). No toxic side effects were detected.

[0141] Furthermore, we have developed a humanized version of an SSO targeting the SCARB1 gene, which can be used as an effective therapeutic agent targeting the underlying pathological processes associated with the above pathologies, such as NASH in humans.

[0142] An initial set of splice switching oligonucleotides (SSOs) was designed. The rationale for the first round of design was to target the cis-regulatory region in exon 12 of the human SCARB1 gene. These SSOs were tested in human hepatocytes (derived from induced pluripotent stem cells - iPSCs) by transfection of 100 nM oligos with lipofectamine 2000. RNA was extracted 24 hours after transfection and activity was assessed by calculating the percentage of splicing (PSI = inclusion of exon 12 / (inclusion of exon 12 + skipping of exon 12)).

[0143] like Fig.18 As shown, SSO8.5 targeting the 3' region of exon 12 showed stronger activity in antagonizing exon 12.

[0144] To improve the chances of finding the best molecule, we explored additional genomic regions and designed a second round of SSOs. The rationale for the second round of design was to target an alternative region in exon 12 of the human SCARB1 gene. These SSOs were tested in iPSC-derived hepatocytes by transfection of 100 nM oligomers with lipofectamine 2000. RNA was extracted 24 h after transfection and activity was assessed by calculating PSI. Fig.19 As shown, SSO8.5 is still the oligomer with higher activity.

[0145] Thereafter, the most promising candidates from rounds 1 and 2 were further modified by genomic micro-walk. The rationale for the third round design was to 1) test the impact of subtle sequence modifications in oligos that previously showed some activity, and 2) identify target intronic regulatory elements. In addition, 3) introduce a chemical modification (2'MOE) in one of the candidates (SSO8.5), generating a new oligomer SSO8.21, to improve activity and / or pharmacokinetics. It is noteworthy that human hepatocytes or HepG2 hepatocytes have low transfection potential, while Huh7 hepatocytes have high transfection efficiency. To maximize activity, 13 hSSOs (2'OME modification: SSO8.5, SSO8.10, SSO8.11, SSO8.12, SSO8.13, SSO8.14, SSO8.15, SSO8.16, SSO8.17, SSO8.18, SSO8.19, SSO8.20 or 2'MOE modification: SSO8.21) were tested in Huh7 human hepatocytes by transfection of 100 nM with lipofectamine 2000. RNA was extracted 24 hours after transfection and activity was assessed by calculating PSI.

[0146] Cells were transfected with 100 nM SSO using lipofectamine 2000 for 6 h. 24 h after transfection, RNA was extracted and activity was quantified as PSI of SCARB1 exon 12. Scrambled oligos were used as controls. Results are expressed as mean ± SEM (n = 3). Statistical comparisons were performed using Student's T test (***p < 0.001).

[0147] like Fig. 20 As shown, SSO8.5, SSO8.10, SSO8.11, SSO8.18 and SSO8.21 promoted a greater than 60% reduction in the PSI of SCARB1 exon 12 (a threshold initially established in the DGF application). In particular, both SSO8.18 and SSO8.21 showed very high activity antagonizing SCARB1 exon 12 (promoting the SR-BII isoform). To further test these candidates, we transfected HepG2 cells (an alternative human liver cell line with much lower transfection efficiency than Huh7 cells). In this system, SSO8.18 showed higher activity, indicating that this oligomer has consistently higher activity across different cell types and has therefore been selected as the lead hSSO for liver-on-a chip experiments. Fig. 20 D). Example 9 - Liver Chip Experiment

[0148] The Liver Chip is a human microtissue system that contains most of the key cell types involved in the development of NASH, including hepatocytes, astrocytes, Kupffer cells, and liver endothelial cells. Using a culture medium developed by Insphero (Zurich, Switzerland), it promotes the development of NASH and fibrosis, as assessed by gene expression, very similar to the human disease.

[0149] Oligonucleotides designed to promote the expression of SR-II isoform (SSO8.18) and a scrambled control (SCR) were used in the liver chip model system. Efficacy and toxicity were evaluated by treating liver microtissues with different doses (1 to 20 μM) of these SSOs for 3-10 days.

[0150] 5-6 microtissues were pooled into 3 biological replicates. RNA was isolated using the RNAeasy micro kit, and cDNA was obtained by reverse transcription. The expression of SR-BI (including exon 12) and SR-BII (skipping exon 12) was analyzed by PCR and capillary electrophoresis ( Fig.21 A). This analysis confirmed the potent role of SSO8.18 in triggering dose-dependent skipping of exon 12 ( Fig.21 B). Toxicity was assessed by quantifying LDH release, and even higher doses of SCR or SSO8.18 oligomers were not associated with significant toxicity ( Fig.21 CD). A dose-response curve of chlorpromazine was used as a positive control ( Fig.21 E).

[0151] The chemokine CXCL10 (IP-10) has been shown to play a key role in the development of liver inflammation. Increased SR-BII expression is associated with decreased expression of inflammatory markers in vivo. To this end, we tested the effect of SSO8.18 on the expression of IP10 in liver microtissues ( Fig. 22 A). Fig. 22 As shown in B, SSO8.18 was able to promote an effective reduction in IP10 levels, confirming the anti-inflammatory activity.

[0152] RNA oligomer therapeutics offer multiple pharmacokinetic advantages for the treatment of liver pathologies. The 2' modification confers high stability to the oligonucleotide. To this end, we tested the effect of a single lower dose on the activity of SSO8.18 in this system. Microtissues were treated with 7.5 μM SSO8.18 or SCR control over a 48-hour period. Thereafter, SSO was washed off and microtissues were maintained in SSO-free medium for the remainder of the experiment ( Fig. 22 C, top). Under these conditions, SSO8.18 was able to trigger efficient splicing changes that promoted SCARB1 exon 12 skipping, confirming the efficacy of our oligomers ( Fig. 22C, lower figure).

[0153] Furthermore, consistent with our previous experiments, no toxicity was detected as assessed by LDH release ( Fig. 22 D), Treatment with SSO8.18 caused a strong decrease in IP10 levels ( Fig. 22 E). Methods of Examples 1 to 7

[0154] Mouse C57BL6 / J (Stock No. 000664), Rbfox2 loxP / loxP (Stock No. 014090) 51 and Albumin-cre (Stock No. 003574) 52 Obtained from Jackson Laboratory. Eight-week-old mice were randomly assigned to experimental groups and fed CD, a high-fat diet (60% Kcal from fat, Bioserve) or a high-fructose diet containing 30% (w / v) fructose in drinking water for 16 to 22 weeks. Mice were housed in a pathogen-free barrier facility at 22°C with a 12-hour light / dark cycle with free access to food and water. The presence of Cre recombinase and Rbfox2 LoxP site was determined by PCR analysis of genomic DNA with the following primers: CreF1>TTACTGACCGTACACCAAATTTGCCTGC (SEQ ID NO: 22) and CreR1>CCTGGCAGCGATCGCTATTTTCCATGAGTG (SEQ ID NO: 23), Rbfox2F1>AACAAGAAAGGCCTCACTTCAG (SEQ ID NO: 24) and Rbfox2R1>GGTGTTCTCTGACTTATACATGCAC (SEQ ID NO: 25). All in vivo work was approved by the Animal Welfare and Ethical Review Board of Imperial College London and complied with the United Kingdom Animals (Scientific Procedures) Act (1986). Adenovirus and Adeno-associated Virus

[0155] The adenovirus vector (Ad-m-RBM9) driving mouse RBFOX2 expression and pAd-GFP were obtained from Vector Biolabs (Malvern, PA, USA). These viruses were purified by using the AdEasy virus purification kit (Agilent technologies). 8×10 9 GC were intravenously injected into mice fed an HFr diet, and the mice were harvested 7 days after injection. The codon-optimized RBFOX2 lacking RRM was obtained by gene block synthesis (IDT) and cloned into the AAV-CBA-GFP vector. AAV2 / 8 was produced and purified by iodixanol gradient, and 5×10 11 GC were intravenously injected into mice fed an HFr diet. The mice were harvested 12 weeks after injection. Tissue and blood harvest

[0156] The biopses were snap-frozen in liquid nitrogen and kept at -80 °C. The sections for histology were fixed in 10% formalin, then embedded in paraffin, or immersed in OCT and isopentane for cryosections. The paraffin sections were stained with hematoxylin and eosin or used for IHC analysis of macrophage infiltration with anti-MRC1 antibody (ab64693) and DAPI (Sigma, D9542) for nuclear staining. Unless otherwise stated, serum was obtained by centrifugation at 5000 g for 10 minutes at 4 °C and analyzed by the Pathology Department of St. Mary's Hospital. Quantitative proteomics (TMT / MS, tandem mass tags)

[0157] Snap-frozen livers were lysed using a homogenizer with SDS lysis buffer (2.5% SDS, 50mM HEPES pH 8.5, 150mM NaCl, 1× EDTA-free protease inhibitor cocktail (Roche), 1× PhosSTOP phosphatase inhibitor cocktail (Roche)). Lysates were clarified by centrifugation at 13,000rpm for 15 minutes, and protein concentration was measured by Pierce BCA assay (Thermoscientific). 20mg of protein was reduced with 5mM TCEP for 30 minutes, followed by alkylation with 14mM iodoacetamide for 30 minutes, and finally quenched with 10mM DTT for 15 minutes. All reactions were performed at room temperature. The protein was chloroform-methanol precipitated and the pellet was resuspended in 8M urea, 50mM EPPS pH 8.5. To aid resuspension, the protein precipitate was passed through a 22G needle 10 times, and the protein concentration was measured again. Prior to protein digestion, 5 mg of protein was collected and the urea concentration was diluted to 1 M with 50 mM EPPS pH 8.5. Subsequently, LysC was added at 1:100 (LysC:protein) and digested for 12 hours at room temperature. The samples were further digested with trypsin at 1:100 (trypsin:protein) at 37°C for 5 hours. To stop the digestion, 0.4% TFA (pH <2) was added to the samples. The digested samples were clarified by centrifugation at 13,000 rpm for 10 minutes. Peptide concentrations were measured using a quantitative colorimetric peptide assay (Thermo scientific). 25 μg of peptides were desalted using a 10 mg SOLA HRP SPE column (Thermoscientific). In order to enable comparison of the two TMTs, 2 bridge channels were prepared and treated in parallel. To this end, 1.39 μg of each sample was added to each bridge channel. Subsequently, the dried peptides from all 20 samples were resuspended in 200 mM EPPS pH 8.5 and followed by 53 The protocol described in was used for labeling with TMT-10plex. After labeling, the two bridge channels were combined and separated again to ensure homogeneity. Finally, the samples were mixed in equal amounts. After combining, both TMTs were desalted using tC18 SepPak solid phase extraction cartridges (Waters) and dried in a SpeedVac. Next, the desalted peptides were resuspended in 5% ACN, 10 mM NH 4 HCO 3The two TMTs were fractionated in basic pH reverse phase chromatography using an HPLC (Agilent) equipped with a 3.5 μm Zorbax 300 Extended-C18 column. 96 fractions were collected and combined into 24. Twelve of these fractions were extracted with a C18 Stop and Go Extraction Tip (STAGE-Tip). 54 Finally, the samples were resuspended in 3% ACN, 1% FA and lysed as previously described. 53 In the Orbitrap Fusion 55 The raw data is converted to mzXML format using a modified version of RawFileReader and searched using the search engine Comet 56 Searches were performed against a mouse target bait protein database (Uniprot, 11 June 2019) including the most common contaminants. Precursor ion tolerance was set at 20 ppm, while product ion tolerance was set at 1 Da. Cysteine ​​carboxamidomethylation (+57.0215 Da) and TMT tag (+229.1629 Da) on lysine residues and peptide N-termini were set as static modifications. Up to 2 variable methionine oxidations (+15.9949 Da) and 2 missing cleavages were allowed in the search. Linear discriminant analysis was used. 57 Peptide-spectrum matching (PSM) is adjusted to 1% FDR and the protein is further folded to 1% of the final protein level FDR. We obtain TMT quantitative values ​​from MS3 scans. Only those with signal-to-noise ratio>100 and separation specificity>0.7 are used for quantification. Each TMT is normalized relative to the total signal in each column. In order to enable comparison of two TMTs, those proteins are quantified in both TMTs, and the data are normalized using the bridge channel present in each TMT. The quantitative representation included in Schedule 1 (see Paterson et al., Nature Metabolism) is relative abundance. As described below, the newly generated proteomics data set is publicly available. iPSC-derived human hepatocytes

[0158] Human induced pluripotent stem cells (iPSCs) CGT-RCiB-10 (Cell & Gene Therapy Catapult, London, UK) were maintained on vitronectin XF (STEMCELL Technologies)-coated Corning Costar TC-treated 6-well plates (Sigma-Aldrich) in Essential 8 medium (Thermo Fisher Scientific) and passaged every 4 days using Gentle Cell Dissociation Reagent (STEMCELL Technologies).

[0159] As previously mentioned 58,59 , at 182cm treated with TC 2 Hepatocyte differentiation was performed in flasks (VWR) in Essential 6 medium (ThermoFisher Scientific; days 1-2), RPMI-1640 medium (Sigma-Aldrich; days 3-8), and HepatoZYME-SFM (Thermo Fisher Scientific; from day 9 onwards). The following growth factors and small molecules were supplemented into the culture medium for hepatocyte differentiation: 3 μM CHIR9901 [day 1] (Sigma-Aldrich), 10 ng / ml BMP4 [days 1-2] (R&D Systems), 10 μM LY29004 [days 1-2] (Promega, Madison, WI), 80 ng / ml FGF2 [days 1-3] (R&D Systems), 100 ng / ml [days 1-3] and 50 ng / ml [days 4-8] Activin A (Qkine), 10 ng / ml OSM [from day 9 onwards] (R&D Systems), and 50 ng / ml HGF [from day 9 onwards] (PeproTech). After 21 days, iPSC-derived hepatocytes were dissociated into single cell suspensions using TrypLE Express (10×), phenol red-free (Thermo Fisher Scientific) and seeded into multiwell plates coated with type 1 collagen from rat tail (Sigma-Aldrich). Silencing of human RBFOX2 was performed by transfecting 100 nM smart pools to RBFOX2 or mock control (Horizon) with RNAimax reagent (Invitrogen) in Optimem (Invitrogen). AML12 hepatocytes and Dil-HDL uptake

[0160] As previously mentioned 60 AML12 was cultured. Scarb1 was silenced by transfecting 100nM smart pool to Scarb1 or blank control (Horizon) with RNAimax reagent (Invitrogen) in Optimem (Invitrogen). Expression of SR-BI and SR-BII was obtained by cloning codon-optimized SR-BI and SR-BII (generated by gblock synthesis by IDT) into the pLV(PGK)-GFPNeo vector. Third-generation lentivirus was produced in HEK-293T cells and purified by high-speed centrifugation. The virus was resuspended in medium supplemented with polybrene and added to the cells. When indicated, the cells were incubated with 100ng / ml Dil-HDL for 4 hours, and lipid uptake was quantified by FACS using the FACSAria III cell sorting system (BD biosciences). RNA Isolation

[0161] Cells or tissues were homogenized in TRIzol (Thermo Fisher Scientific) and RNA was extracted according to the manufacturer's instructions. For RNA sequencing, RNA was extracted using RNeasy kit columns (Qiagen) following homogenization with TRIzol according to the manufacturer's instructions (including DNase I treatment). RNAseq sequencing and analysis

[0162] RNA quality control was performed using a 2100 bioanalyzer (Agilent CA, US). Poly(A) enrichment was performed for samples with RIN>8, and libraries were prepared using the NEBNext Ultra II RNA library preparation kit for Illumina and multiplexed using NEBNext Multiplex Oligos for Illumina (NEB, E7760S and E7335S). Sequencing was performed using a HiSeq 2500 (Illumina) with 100 bp double-end reads. As described below, the newly generated RNAseq dataset is publicly available. The previously published dataset for mice fed a high fructose diet was obtained from GSE123896 16 Using Tophat2 (2.0.11) 61Reads were aligned to the Ensemb1 mouse genome (GRCm38) with the argument "--library-type-strand-specific". Reference sequence assembly and transcript annotation were obtained from Illumina iGenomes (https: / / support.illumina.com / sequencing / sequencing_software / igenome.html). 62 The featureCounts function of DEseq2 was used to obtain gene-based read counts. 63 or edgeR-voom-limma 64,65- 67 The bioconductor package was used for normalization and differential expression analysis. 68 Analysis of alternative splicing. Differentially spliced ​​sites were kept for data visualization if the following thresholds were exceeded: p < 0.05; FDR < 0.1 and absolute value (IncLevelDifference) > 0.1 or < -0.1. 69 Gene ontology analysis was performed. A list of differentially expressed genes with an adjusted p-value less than or equal to 0.05 was selected as input to Ingenuity Pathway Analysis (IPA; http: / / www.ingenuity.com / index.html). No cutoff was applied for the fold change of differential expression. The data were analyzed using the edgeR bioconductor package. 70 The binomTest function tests the enrichment of binding motifs of different SFs. Lipidomic analysis

[0163] Tissue was pulverized using a cyroPREP dry pulverizer (Covaris). Adapted from Folch and colleagues. 71 . Approximately 30 mg of frozen liver powder was weighed into a weighed Eppendorf. The tissue was homogenized in a TissueLyzer (20 Hz, 3-5 min x 2) using a stainless steel ball and 1 ml of chloroform:methanol (2:1). The stainless steel ball was removed and 400 ul of HPLC grade water was added, the sample was vortexed for 20 seconds and centrifuged at 13,200 x g for 15 minutes at room temperature. The organic and aqueous layers were removed. The protein pellet was re-extracted in 500 ul of 2:1 chloroform:methanol and 200 ul of HPLC grade water, the sample was vortexed and centrifuged, and the corresponding fractions were combined.

[0164] Lipid analysis was performed by liquid chromatography high-resolution mass spectrometry (LC-HRMS) using a Vanquish Flex Binary UHPLC system (Thermo Scientific) connected to a benchtop combined quadrupole-Orbitrap Q-Exactive mass spectrometer (Thermo Scientific). Chromatographic separation was achieved using an Acquity UPLCBEH C18 column (Waters, 50×2.1 mm, 1.7 μm) maintained at a temperature of 55°C and a flow rate of 0.5 mL / min. For the positive ion mode, the mobile phase consisted of 60:40 (v / v) acetonitrile / water plus 10 mM ammonium formate (solvent A) and 90:10 (v / v) isopropanol / acetonitrile plus 10 mM ammonium formate (solvent B). For the negative ion mode, the mobile phase consisted of 60:40 (v / v) acetonitrile / water plus 10 mM ammonium acetate (solvent A) and 90:10 (v / v) isopropanol / acetonitrile plus 10 mM ammonium acetate (solvent B). According to Schedule 4 (see Paterson et al., Nature Metabolism), two ion modes were subjected to gradient elution procedures to obtain a total run time of 10 minutes for each sample. The injection volumes for positive and negative ion modes were 5 μL and 10 μL, respectively. A heated electrospray ionization source (HESI) was used for ionization, and the parameters for the positive / negative mode were as follows: capillary voltage 3.5 / -2.5 KV, heater temperature 438°C, capillary temperature 320°C, S-lens RF level 50, shielding gas, auxiliary gas and purge gas flow rates were 53, 14 and 1 units, respectively. For both ion modes, mass accuracy was calibrated before sample analysis. High-resolution mass spectrometry (70,000 at m / z200) data were collected in profile mode using a full scan setting (m / z 200-2000). Automatic gain control (AGC) was set to 1e6, and the maximum MS1 injection time was 200ms. Lipidomics data acquisition was performed using Xcalibur software (version 4.1). Using XCMS 72Peak picking was performed, and features were normalized to isotope-labeled internal standards and dry tissue weight. Lipid identification was performed using an internal database by accurate mass. Bile acid analysis was performed using a liquid chromatography tandem mass spectrometry (LC-MS / MS) in an Acquity I-Class binary UPLC system (Waters) connected to a triple quadrupole Xevo TQ-XS mass spectrometer as previously described (https: / / www.waters.com / webassets / cms / library / docs / 720006261en.pdf) (Waters). Chromatographic separation was performed on a CORTECS T3 column (Waters, 30×2.1mm, 2.7μm) maintained at a temperature of 60°C and a flow rate of 1.3mL / min. The mobile phase consisted of 0.2 mM ammonium formate plus 0.01% (v / v) formic acid (solvent A) and 50:50 (v / v) isopropanol / acetonitrile plus 0.01% (v / v) formic acid and 0.2 mM ammonium formate. The elution gradient program started with 20% B, held for 0.1 min, and increased to 55% B over 0.7 min, followed by a 0.9 min column wash at 98% B. The column was re-equilibrated to initial conditions, resulting in a total run time of 1.71 min per sample. The injection volume was 10 μL. Data were collected using multiple reaction monitoring (MRM) in negative ion mode according to Appendix 5 (see Paterson et al., Nature Metabolism). The source parameters were as follows: -2.0 kV capillary voltage, 60 V cone voltage, desolvation gas temperature 600°C, cone and desolvation gas flow rates of 150 and 1000 L / hr, respectively. Data were acquired by MassLynx software (version 4.2) and processed with TargetLynx XS (Waters). Quantification of liver triglycerides

[0165] The liver (50-200 mg) was incubated overnight at 50°C and added to 350 μl of ethanolic KOH (2 ethanol (100%): 1 KOH (30%)). After incubation, the sample was vortexed and 650 μl of ethanol (50%) was added, followed by centrifugation at full speed for 5 minutes. 900 μl of the supernatant was mixed with 300 μl of ethanol (50%), and 200 μl of the sample was mixed with 215 μl of 1 M MgCl 2 Mix and incubate on ice for 10 minutes. Subsequently, the samples were centrifuged at full speed for 5 minutes and the glycerol content of 10 μl of the supernatant was determined using free glycerol reagent (Sigma). Protein analysis

[0166] Tissues were homogenized in Triton lysis buffer (12.5 mM HEPES pH 7.4, 50 mM NaCl, 500 μM EDTA, 5% glycerol, 0.5% Triton X-100, 50 mM sodium vanadate, 50 mM PMSF, 5 mM aprotinin, 5 mM leupeptin) using a TissueLyser II homogenizer (Qiagen) followed by centrifugation at 10,000 rpm for 10 min at 4°C. The supernatant was transferred to a new tube, and protein was quantified using the Pierce BCA protein assay kit (Thermo Fisher Scientific) and analyzed by Western blotting by incubation with primary antibodies against RBFOX2 (Bethyl Laboratories), anti-PLA2G6 (Santa Cruz), anti-SREBP1 (Pharmigen), anti-vinculin, anti-APOB, anti-ABCA1, anti-ACC, anti-pS79ACC, anti-FASN (Cellsignaling), and anti-tubulin (Santa Cruz), and imaged using an Odyssey infrared scanner (LICOR). Glucose tolerance test

[0167] For the glucose tolerance test, animals were fasted for 16 hours and injected intraperitoneally with 1 g glucose / kg. Blood glucose was measured using a Contour XT blood glucose meter (Roche). Lipoprotein fractionation and characterization

[0168] The major lipoprotein fractions, i.e., very low density lipoprotein (VLDL, d < 1.019 g / ml), low density lipoprotein (LDL, d: 1.019-1.063 g / ml) and high density lipoprotein (HDL, d: 1.063-1.21 g / mh), were separated from plasma successively after centrifugation times of 1 hour 30 minutes, 3 hours 30 minutes and 5 hours 30 minutes, respectively, by continuous ultracentrifugation at 100,000 rpm at 15°C using a Beckman OptimaMax-TL centrifuge. After separation, the lipid and protein content of the lipoprotein fractions were analyzed with a calibrated automatic analyzer (Konelab 20) using commercial kits. Total cholesterol, free cholesterol and phospholipids were measured using reagents from Diasys. The cholesterol ester (CE) mass was calculated as (TC-FC) × 1.67 and thus represents the sum of esterified cholesterol and fatty acid moieties. Triglycerides were quantified using a commercial kit (Thermo Electron). Bicinchoninic acid assay reagent (Pierce, Thermo Fisher Scientific) was used for protein quantification. Lipoprotein mass was calculated as the sum of the masses of the individual lipid and protein components of each lipoprotein fraction. Primary hepatocytes

[0169] Liver perfusion buffer (HBSS, KCl 0.4 g / L, glucose 1 g / L, NaHCO 3 2.1g / L, EDTA0.2g / L) perfused liver, and then digested with liver digestion buffer (DMEM-GlutaMAX 1g / L glucose, HEPES 15mMpH7.4, penicillin / streptomycin 1%, 5mg / mouse collagenase IV (C5138Sigma)). After resection, the liver was placed in a plate culture medium (M199, FBS10%, penicillin / streptomycin 1%, sodium pyruvate 1%, L-glutamine 1%, 1nM insulin, 1mM dexamethasone, 2mg / ml BSA) on ice. The tissue was homogenized using forceps and then filtered into the plate culture medium. The cells were then washed twice in the plate culture medium and then subjected to a 1:3 Percol gradient (Sigma Aldrich). The cells were plated on a collagen-coated plate (ThermoFisher Scientific) in the plate culture medium. After 3 hours, the medium was changed to maintenance medium (DMEM 4.5 g glucose / L, penicillin / streptomycin 1%, L-glutamine 1%, 100 nM dexamethasone, 2 mg / ml BSA) for 12 hours and hepatocytes were treated as indicated. Generation of cell lines expressing pGIPZ lentiviral shRNA

[0170] Lentiviral shRNA (sh1-Foxa1—v2lmm14620, sh4-Foxa2—v2lmm71498) clones were recovered from the pGIPZ library following the manufacturer's protocol (ThermoFisher) and used to obtain lentivirus and generate stable Hepa1-6 cells. Antisense Oligonucleotides

[0171] RNA splicing switching oligonucleotides (SSOs) with 2'O-ME modification and phosphorothioate backbone were synthesized (Eurogentec). A list of SSO sequences is provided in Table 1. 100 nM SSOs were transfected by incubating cells with Lipofectamine 2000 in OptiMEM (Thermo Fisher scientific). For in vivo studies, 40 mg / kg / week of oligonucleotides or saline were injected subcutaneously weekly for four consecutive weeks. CAGE-seq and ChIP-sea data processing

[0172] Mapped CAGE-supported transcription start sites (CTSS) from the FANTOM5 project 73-75 Import into R (http: / / www.R-project.org / ) as a CTSS table. Use the CAGEr package 76 Duplicate samples were merged and normalized within the standard workflow. From the ENCODE portal 77 Obtain processed bigwig file corresponding to p-values ​​of human adult liver ChIP-seq signals: FOXA1 (ENCFF058DKS) 78 、FOXA2(ENCFF902TMK) 78 、K3K4me3(ENCFF610REU) 79 and H3K27ac(ENCFF012XAP) 79 Mouse liver FOXA1 ChIP-seq data (GSE106379) were obtained from 80 Search in. RT-PCR analysis

[0173] RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Taqman gene expression assays (Thermo Fisher Scientific) with probes from Roche Universal Probe Library or Fast SYBR-Green Mix (ThermoFisher Scientific) were used for quantification on a QuantStudio 7Flex real-time PCR system ((Thermo Fisher Scientific). All data were analyzed using relative standard curves or the ΔCT method. In all cases, ribosomal 18S RNA was used to normalize samples. Variable splicing analysis was performed using primers designed to detect more than one mRNA isoform. Targets were amplified by PCR and analyzed by capillary electrophoresis using a QIAxcel Advanced system (Qiagen). AS was calculated as the percentage of splicing (PSI) of a specific splicing event in a sample (PSI = (long isoform) / (long isoform + short isoform) * 100). The probes and primers used in this analysis are described in Supplementary Table 3 (see Paterson et al., Nature Metabolism). Enhanced single nucleotide resolution UV cross-linking and immunoprecipitation (eiCLIP)

[0174] Perform the previously described non-isotopic single nucleotide resolution UV cross-linking and immunoprecipitation (iCLIP) workflow 81A revised version with new modifications that enhance speed and efficiency. Specifically, a shortened Cy5.5-labeled adaptor ( / 5Phosphate / A[XXXXXX]NNNAGATCGGAAGAGCACACG / 3Cy55Sp / ) (SEQ ID NO: 26) was incorporated, and a high concentration of T4 RNA ligase (New England Biolabs) was used to enhance adaptor ligation. Unligated adaptors were removed using RecJf exonuclease (New England Biolabs) prior to SDS-PAGE. SDS-PAGE was visualized in the 700 nm channel. Reverse transcription was performed with a biotinylated primer homologous to the adaptor ( / 5BiotinTEG / CGTGTGCTCTTCCGA / ) (SEQ ID NO: 27). Unincorporated RT primers were removed by Exonuclease III (New England Biolabs) after annealing with the reverse complement. cDNA was captured by MyOne Streptavidin C1 beads (Thermo Fisher Scientific). The bead-bound cDNA was ligated to a 3’ adaptor ( / 5Phosphate / ANNNNNNNAGATCGGAAGAGCGTCGTG / 3ddC / ) (SEQ ID NO: 28) instead of the previously employed intramolecular ligation, and the cDNA was eluted from the streptavidin beads using nuclease and cation-free water at high temperature. 5% size-matched input was prepared by capturing the cellular proteome on SeraMag carboxylated beads (Sigma Aldrich) and performing the eiCLIP protocol in parallel with the RBFOX2 immunoprecipitation complex. Using isolated primary hepatocytes, RBFOX2 eiCLIP was performed using 1 μg / μl of RBM9 antibody (A300-A864A, Bethyl Laboratories) - total protein was quantified at 4 μg / μl and 8 μg / ml of antibody was added. Samples from three independent hepatocyte cultures each obtained from two mice were sequenced using paired-end reads on a MiSeq system (Illumina). Mapping and identification of cross-linked clusters from eCLIP and eiCLIP experiments

[0175] To map the eCLIP and eiCLIP RBFOX2 sequencing data, we used the GENCODE assembly annotation version "GRCm38.VM20" for mouse samples and "GRCh38.p7" for human samples. For eCLIP samples, double adapter removal was used following the recommended ENCODE eCLIP pipeline: (https: / / www.encodeproject.org / pipelines / ENCPL357ADL / ). For adapter removal of eiCLIP sequencing samples, we also used the "cutadapt" tool (https: / / cutadapt.readthedocs.io / en / stable / ) with the following parameters: "cutadapt-ffastq --match-read-wildcards --times 1 -e 0.1 -O 1 --quality-cutoff 6 -m 18 -aAGATCGGAAG $INPUT.fastq>$OUTPUT.adapterTrim.fastq 2>$OUTPUT.adapterTrim.metrics". Both eCLIP and eiCLIP samples were aligned by the STAR alignment tool (version 2.4.2a) (https: / / github.com / alexdobin / STAR) with the following parameters: “STAR -runThreadN 8 -runMode alignReads -genomeDir GRCh38 Gencode v25 -genomeLoad LoadAndKeep -readFilesIn read1,read2, -readFilesCommand zcat -outSAMunmapped Within -outFilterMultimapNmax 1 -outFilterMultimapScoreRange 1 -outSAMattributes All -outSAMtype BAM Unsorted -outFilterType BySJout -outFilterScoreMin 10 -alignEndsType EndToEnd -outFileNamePrefixoutfile”.

[0176] For over-amplification correction of eCLIP samples, we used the barcode collapse python script "barcode_collapse_pe.py" available on GitHub (https: / / github.com / YeoLab / gscripts / releases / tag / 1.0). And for eiCLIP samples, we used a custom python script to swap the random barcodes from the first 7nt of the FASTQ sequence line to the FASTQ header line. Uniquely mapped reads with the same genomic position and the same random barcode were subsequently removed as PCR duplicates.

[0177] To identify binding clusters, we used cDNA-starts as crosslink positions and as input for the false discovery rate clustering tool available from iMaps (https: / / imaps.genialis.com / iclip).

[0178] Clusters were identified by using default parameters and the Paraclu clustering algorithm (http: / / cbrc3.cbrc.jp / ~martin / paraclu / ). 82 Visualization of the semantic space of RBFOX2 eiCLIP targets. Motif enrichment relative to eCLIP and eiCLIP cross-linking sites

[0179] To identify enrichment of RBFOX2 binding motifs relative to crosslinking sites, we used density plots of known (U)GCAUG binding motifs relative to eiCLIP cDNA-initiations from mouse liver samples and eCLIP cDNA-initiations from HepG2 samples from ENCODE. 22,83 Each position on the map was normalized by the total number of mapped cDNAs from all three replicates. Comparison of human and mouse RBFOX2 binding sites

[0180] For the lift over of RBFOX2 cross-linked clusters from mouse (mm10) to human (hg38), we used the UCSC online tool (https: / / genome.ucsc.edu / cgi-bin / hgLiftOver). 84 , 85 Overlap analysis between binding sites was performed. Enrichment analysis of orthologous RBFOX2 target genes

[0181] Human orthologs of mouse RBFOX2 targets detected by eiCLIP were obtained from BioMart 86 Retrieve and use EnrichR87,88 Study the enrichment of genes associated with common traits / diseases. RNA profiles surrounding RBFOX2-regulated exons

[0182] The alternatively spliced ​​exons and control exons were selected from L sequences analyzed by the splicing event table MATS.SE using the “junctionSeq” Bioconductor package (https: / / www.bioconductor.org / packages / release / bioc / html / JunctionSeq.html) with the following parameters: WT and L ΔRbfox2 Liver RNAseq samples: - Upregulated exons: p-value < 0.05, FDR < 0.1, IncLevelDifference > 0.2 - Downregulated exons: p-value < 0.05, FDR < 0.1, IncLevelDifference < -0.2 - Control exon: p value < 0.05, FDR < 0.1, absolute value (IncLevelDifference) < 0.1 For splicing regulation analysis of RBFOX2 eiCLIP, we used a previously published RNAmaps method 89 Chakrabarti, 2018 #1261}. Density plots were plotted as the distribution of cDNA-starts relative to the 5' and 3' splice sites for the RBFOX2 eiCLIP samples. All three replicates were clustered together and each group of exons was normalized by the total number of exons in each group. Statistical analysis

[0183] The statistical significance of the differences between the dietary groups and gene targets was analyzed using one-way or two-way ANOVA tests. Pairwise comparisons were analyzed using the Mann-Whitney U test or two-sided Student's t-test, if applicable. Results are expressed as mean ± SEM. Data availability:

[0184] The mass spectrometry data have been made available through the PRIDE partner repository 90 The RNAseq data and eiCLIP data generated in this study have been deposited in GEO under the accession number GSE151753. Code availability

[0185] Corresponds to Figure 1 EG and Figure 3 The code for B and C is publicly available in the GitHub repository (https: / / github.com / nebo56 / RBFOX2-data_analysis). References 1 Pan, Q., Shai, O., Lee, LJ, Frey, BJ and Blencowe, BJ Deep surveying of alternative splicing complexity in the human transcriptome by high-throughputsequencing. Nat Genet 40, 1413-1415 (2008). https: / / doi.org: 10.1038 / ng.259 2 Wang, ET et al. Alternative isoform regulation in human tissue transcriptomes. Nature 456, 470-476 (2008). https: / / doi.org:10.1038 / nature07509 3 Blencowe, BJReflections for the 20th anniversary issue of RNAjournal.RNA 21, 573-575(2015).https: / / doi.org:10.1261 / rna.051003.115 4 Buljan, M et al. Tissue-specific splicing of disordered segments thatembed binding motifs rewires protein interaction networks. Mol Cell 46, 871-883 (2012). https: / / doi.org:10.1016 / j.molcel.2012.05.039 5 Ellis, J.D et al. Tissue-specific alternative splicing remodels protein-protein interaction networks. Mol Cell 46, 884-892 (2012). https: / / doi.org:10.1016 / j.molcel.2012.05.037 6 Yang, X et al. Widespread Expansion of Protein Interaction Capabilities by Alternative Splicing. Cell 164, 805-817 (2016). https: / / doi.org:10.1016 / j.cell.2016.01.029 7 Raal, F.J et al. Mipomersen, an apolipoprotein B synthesis inhibitor, for lowering of LDL cholesterol concentrations in patients with homozygous familial hypercholesterolaemia: a randomised, double-blind, placebo-controlled trial. Lancet 375, 998-1006 (2010). https: / / doi.org:10.1016 / S0140-6736(10)60284-X 8 Ray, K.K et al. Inclisiran in Patients at High Cardiovascular Risk with Elevated LDL Cholesterol. N Engl J Med 376, 1430-1440 (2017). https: / / doi.org:10.1056 / NEJMoa1615758 9 Eslam, M., Sanyal, A.J., George, J. and International Consensus, P. MAFLD: A Consensus-Driven Proposed Nomenclature for Metabolic Associated Fatty Liver Disease. Gastroenterology 158, 1999 - 2014 e1991 (2020). https: / / doi.org:10.1053 / j.gastro.2019.11.312 10 Friedman, S.L., Neuschwander-Tetri, B.A., Rinella, M. and Sanyal, A.J. Mechanisms of NAFLD development and therapeutic strategies. Nat Med 24, 908 - 922 (2018). https: / / doi.org:10.1038 / s41591-018-0104-9 11 Turpin-Nolan, S.M. and Bruning, J.C. The role of ceramides in metabolic disorders: when size and localization matters. Nat Rev Endocrinol 16, 224 - 233 (2020). https: / / doi.org:10.1038 / s41574-020-0320-5 12 Hall, Z et al. Lipid zonation and phospholipid remodeling in nonalcoholic fatty liver disease. Hepatology 65, 1165 - 1180 (2017). https: / / doi.org:10.1002 / hep.28953 13 Ioannou, G.N. The Role of Cholesterol in the Pathogenesis of NASH. Trends Endocrinol Metab 27, 84 - 95 (2016). https: / / doi.org:10.1016 / j.tem.2015.11.008 14 Corey, K.E. and Chalasani, N. Management of dyslipidemia as a cardiovascular risk factor in individuals with nonalcoholic fatty liver disease. Clin Gastroenterol Hepatol 12, 1077 - 1084; quiz e1059 - 1060 (2014). https: / / doi.org:10.1016 / j.cgh.2013.08.014 15 Collaborators, G.B.D.O et al. Health Effects of Overweight and Obesity in 195 Countries over 25 Years. N Engl J Med 377, 13 - 27 (2017). https: / / doi.org:10.1056 / NEJMoa1614362 16 Zhang, G et al. Differential metabolic and multi - tissue transcriptomic responses to fructose consumption among genetically diverse mice. Biochim Biophys Acta Mol Basis Dis 1866, 165569 (2020). https: / / doi.org:10.1016 / j.bbadis.2019.165569 17 Van Nostrand, E.L et al. Robust transcriptome - wide discovery of RNA - binding protein binding sites with enhanced CLIP (eCLIP). Nat Methods 13, 508 - 514 (2016). https: / / doi.org:10.1038 / nmeth.3810 18 Tabula Muris, C et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature 562, 367 - 372 (2018). https: / / doi.org:10.1038 / s41586-018-0590-4 19 Damianov, A. and Black, D. L. Autoregulation of Foc protein expression to produce dominant negative splicing factors. RNA 16, 405 - 416 (2010). https: / / doi.org:10.1261 / rna.1838210 20 Jangi, M., Boutz, P. L, Paul, P. and Sharp, P. A. Rbfox2 controls autoregulation in RNA-binding protein networks. Genes Dev 28, 637 - 651 (2014). https: / / doi.org:10.1101 / gad.235770.113 21 Irimia, M. and Blencowe, B. J. Alternative splicing: decoding an expansive regulatory layer. Curr Opin Cell Biol 24, 323 - 332 (2012). https: / / doi.org:10.1016 / j.ceb.2012.03.005 22 Jin, Y et al. A vertebrate RNA-binding protein Foc-1 regulates tissue-specific splicing via the pentanucleotide GCAUG. EMBO J 22, 905 - 912 (2003). https: / / doi.org:10.1093 / emboj / cdg089 23 Yeo, G.W et al. An RNA code for the FOX2 splicing regulator revealed by mapping RNA-protein interactions in stem cells. Nat Struct Mol Biol 16, 130 - 137 (2009). https: / / doi.org:10.1038 / nsmb.1545 24 Zhang, C et al. Defining the regulatory network of the tissue-specific splicing factors Foc-1 and Fox-2. Genes Dev 22, 2550 - 2563 (2008). https: / / doi.org:10.1101 / gad.1703108 25 Underwood, J.G., Boutz, P.L., Dougherty, J.D., Stoilov, P. and Black, D.L. Homologues of the Caenorhabditis elegans Fox-1 protein are neuronal splicing regulators in mammals. Mol Cell Biol 25, 10005 - 10016 (2005). hups: / / doi.org:10.1128 / MCB.25.22.10005 - 10016.2005 26 Nakahata, S. and Kawamoto, S. Tissue-dependent isoforms of mammalian Fox-1 homologs are associated with tissue-specific splicing activities. Nucleic Acids Res 33, 2078 - 2089 (2005). https: / / doi.org:10.1093 / nar / gki338 27 Modafferi, E.F. and Black, D.L. A complex intronic splicing enhancer from the c-src pre-mRNA activates inclusion of a heterologous exon. Mol Cell Biol 17, 6537-6545 (1997). https: / / doi.org:10.1128 / MCB.17.11.6537 28 Kozarsky, K.F. et al. Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 387, 414-417 (1997). https: / / doi.org:10.1038 / 387414a0 29 Acton, S. et al. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science 271, 518-520 (1996). https: / / doi.org:10.1126 / science.271.5248.518 30 Dennis, E.A., Cao, J., Hsu, Y.H., Magrioti, V. and Kokotos, G. Phospholipase A2 enzymes: physical structure, biological function, disease implication, chemical inhibition, and therapeutic intervention. Chem Rev 111, 6130-6185 (2011). https: / / doi.org:10.1021 / cr200085w 31 Han, J. et al. The CREB coactivator CRTC2 controls hepatic lipid metabolism by regulating SREBP1. Nature 524, 243-246 (2015). https: / / doi.org:10.1038 / nature14557 32 Gusarova, V., Brodsky, J.L., and Fisher, E.A. Apolipoprotein B100 exit from the endoplasmic reticulum (ER) is COPII-dependent, and its lipidation to very low density lipoprotein occurs post-ER. J Biol Chem 278, 48051-48058 (2003). https: / / doi.org:10.1074 / jbc.M306898200 33 Temel, R.E., et al. Hepatic Niemann-Pick C1-like 1 regulates biliary cholesterol concentration and is a target of ezetimibe. J Clin Invest 117, 1968-1978 (2007). https: / / doi.org:10.1172 / JCI30060 34 Horton, J.D., Goldstein, J.L., and Brown, M.S. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest 109, 1125-1131 (2002). https: / / doi.org:10.1172 / JCI15593 35 Bochkis, I.M., et al. Hepatocyte-specific ablation of Foxa2 alters bile acid homeostasis and results in endoplasmic reticulum stress. Nat Med 14, 828-836 (2008). https: / / doi.org:10.1038 / nm.1853 36 Moya, M et al. Foxa1 reduces lipid accumulation in human hepatocytes and is downregulated in nonalcoholic fatty liver. PLoS One 7, e30014 (2012). https: / / doi.org:10.1371 / journal.pone.0030014 37 Webb, N.R et al. SR-BII, an isoform of the scavenger receptor BI containing an alternate cytoplasmic tail, mediates lipid transfer between high density lipoprotein and cells. J Biol Chem 273, 15241-15248 (1998). https: / / doi.org:10.1074 / jbc.273.24.15241 38 Puri, P et al. A lipidomic analysis of nonalcoholic fatty liver disease. Hepatology 46, 1081-1090 (2007). https: / / doi.org:10.1002 / hep.21763 39 Trigatti, B et al. Influence of the high density lipoprotein receptor SR-BI on reproductive and cardiovascular pathophysiology. Proc Natl Acad Sci USA 96, 9322-9327 (1999). https: / / doi.org:10.1073 / pnas.96.16.9322 40 Huby, T et al. Knockdown expression and hepatic deficiency reveal anatheroprotective role for SR-BI in liver and peripheral tissues. J Clin Invest 116, 2767 - 2776 (2006). https: / / doi.org:10.1172 / JCI26893 41 Sen, S., Jumaa, H. and Webster, N.J. Splicing factor SRSF3 is crucial forhepatocyte differentiation and metabolic function. Nat Commun 4, 1336 (2013). https: / / doi.org:10.1038 / ncomms2342 42 Wei, N et al. SRSF10 Plays a Role in Myoblast Differentiation andGlucose Production via Regulation of Alternative Splicing. Cell Rep 13, 1647 - 1657 (2015). https: / / doi.org:10.1016 / j.celrep.2015.10.038 43 Benegiamo, G et al. The RNA - Binding Protein NONO Coordinates HepaticAdaptation to Feeding. Cell Metab 27, 404 - 418 e407 (2018). https: / / doi.org:10.1016 / j.cmet.2017.12.010 44 J et al. Expression of the splicing factor gene SFRS10 isreduced in human obesity and contributes to enhanced lipogenesis. CellMetabolism 14, 208 - 218 (2011). https: / / doi.org:10.1016 / j.cmet.2011.06.007 45 Nikolaou, K.C et al. The RNA-Binding Protein A1CF Regulates Hepatic Fructose and Glycerol Metabolism via Alternative RNA Splicing. Cell Rep 29, 283 - 300 e288 (2019). https: / / doi.org:10.1016 / j.celrep.2019.08.100 46 Kuroyanagi, H. Fox-1 family of RNA-binding proteins. Cell Mol Life Sci 66, 3895 - 3907 (2009). https: / / doi.org:10.1007 / s00018-009-0120-5 47 Min, H.K et al. Increased hepatic synthesis and dysregulation of cholesterol metabolism is associated with the severity of nonalcoholic fatty liver disease. Cell Metab 15, 665 - 674 (2012). https: / / doi.org:10.1016 / j.cmet.2012.04.004 48 Eckhardt, E.R et al. High density lipoprotein endocytosis by scavenger receptor SRBII is clathrin-dependent and requires a carboxyl-terminal dileucine motif. J Biol Chem 281, 4348 - 4353 (2006). https: / / doi.org:10.1074 / jbc.M513154200 49 Emerging Risk Factors, C et al. Major lipids, apolipoproteins, and risk of vascular disease. JAMA 302, 1993 - 2000 (2009). https: / / doi.org:10.1001 / jama.2009.1619 50 Zanoni, P et al. Rare variant in scavenger receptor BI raises HDL cholesterol and increases risk of coronary heart disease. Science 351, 1166 - 1171 (2016). https: / / doi.org:10.1126 / science.aad3517 51 Gehman, L.T et al. The splicing regulator Rbfox2 is required for both cerebellar development and mature motor function. Genes Dev 26, 445 - 460 (2012). https: / / doi.org:10.1101 / gad.182477.111 52 Postic, C et al. Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell - specific gene knock - outs using Cre recombinase. J Biol Chem 274, 305 - 315 (1999). https: / / doi.org:10.1074 / jbc.274.1.305 53 Nguyen, A.T et al. UBE2O remodels the proteome during terminal erythroid differentiation. Science 357(2017). https: / / doi.org:10.1126 / science.aan0218 54 Rappsilber, J., Ishihama, Y., and Mann, M. Stop and go extraction tips formatrix-assisted laser desorption / ionization, nanoelectrospray, and LC / MS sample pretreatment in proteomics. Anal Chem 75, 663-670 (2003). https: / / doi.org:10.1021 / ac026117i 55 McAlister, G.C et al. MultiNotch MS3 enables accurate, sensitive, and multiplexed detection of differential expression across cancer cell line proteomes. Anal Chem 86, 7150-7158 (2014). https: / / doi.org:10.1021 / ac502040v 56 Eng, J.K., Jahan, T.A., and Hoopmann, M.R. Comet: an open-source MS / MS sequence database search tool. Proteomics 13, 22-24 (2013). https: / / doi.org:10.1002 / pmic.201200439 57 Huttlin, E.L et al. A tissue-specific atlas of mouse protein phosphorylation and expression. Cell 143, 1174-1189 (2010). https: / / doi.org:10.1016 / j.cell.2010.12.001 58 Blackford, S.J.I et al. Validation of Current Good Manufacturing Practice Compliant Human Pluripotent Stem Cell-Derived Hepatocytes for Cell-Based Therapy. Stem Cells Translational Medicine 8, 124-137 (2019). https: / / doi.org:10.1002 / sctm.18-0084 59 Jobbins, A.M et al. Dysregulated RNA polyadenylation contributes to metabolic impairment in non-alcoholic fatty liver disease. Nucleic Acids Res (2022). https: / / doi.org:10.1093 / nar / gkac165 60 Wu, J.C., Merlino, G and Fausto, N. Establishment and characterization of differentiated, nontransformed hepatocyte cell lines derived from mice transgenic for transforming growth factor alpha. Proc Natl Acad Sci USA 91, 674-678 (1994). https: / / doi.org:10.1073 / pnas.91.2.674 61 Kim, D et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol 14, R36 (2013). https: / / doi.org:10.1186 / gb-2013-14-4-r36 62 Liao, Y., Smyth, G.K. and Shi, W. featureCounts: an efficient general-purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930 (2014). https: / / doi.org:10.1093 / bioinformatics / btt656 63 Love, M.I., Huber, W. and Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology 2014 15:12 15, 1-21 (2014). https: / / doi.org:10.1186 / S13059-014-0550-8 64 Robinson, M.D., McCarthy’D.J. and Smyth, G.K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140 (2010). https: / / doi.org:10.1093 / bioinformatics / btp616 65 Law, C.W., Chen, Y, Shi, W. and Smyth, G.K. voom: Precision weights unlock linear model analysis tools for RNA-seq read countts. Genome Biol 15, R29 (2014). https: / / doi.org:10.1186 / gb-2014-15-2-r29 66 Ritchie, M.E et al. limma powers differential expression analyses for RNA sequencing and microarray studies. Nucleic Acids Res 43, e47 (2015). https: / / doi.org:10.1093 / nar / gkv007 67 Huber, W et al. Orchestrating high-throughput genomic analysis with Bioconductor. Nat Methods 12, 115 - 121 (2015). https: / / doi.org:10.1038 / nmeth.3252 68 Shen, S et al. rMATS: robust and flexible detection of differential alternative splicing from replicate RNA-Seq data. Proc Natl Acad Sci USA 111, E5593 - 5601 (2014). https: / / doi.org:10.1073 / pnas.1419161111 69 Young, M.D., Wakefield, M.J., Smyth, G.K. and Oshlack, A. Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol 11, R14 (2010). https: / / doi.org:10.1186 / gb-2010-11-2-r14 70 McCarthy, D.J., Chen, Y. and Smyth, G..K. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Res 40, 4288 - 4297 (2012). https: / / doi.org:10.1093 / nar / gks042 71 Folch, J., Lees, M., and Sloane Stanley, G. H. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226, 497 - 509 (1957). 72 Smith, C. A., Want, E. J., O′Maille, G, Abagyan, R., and Siuzdak, G. XCMS: processing mass spectrometry data for metabolite profiling using nonlinear peak alignment, matching, and identification. Anal Chem 78, 779 - 787 (2006). https: / / doi.org:10.1021 / ac051437y 73 Lizio, M et al. Gateways to the FANTOM5 promoter level mammalian expression atlas. Genome Biol 16, 22 (2015). https: / / doi.org:10.1186 / s13059 - 014 - 0560 - 6 74 Noguchi, S et al. FANTOM5 CAGE profiles of human and mouse samples. SciData 4, 170112 (2017). https: / / doi.org:10.1038 / sdata.2017.112 75 Lizio, M et al. Update of the FANTOM web resource; expansion to provide additional transcriptome atlases. Nucleic Acids Res 47, D752 - D758 (2019). https: / / doi.org:10.1093 / nar / gky1099 76 Haberle, V., Forrest, A.R., Hayashizaki, Y, Carninci, P. and Lenhard, B. CAGEr: precise TSS data retrieval and high-resolution promoterome mining for integrative analyses. Nucleic Acids Res 43, e51 (2015). https: / / doi.org:10.1093 / nar / gkv054 77 Sloan, C.A et al. ENCODE data at the ENCODE portal. Nucleic Acids Res 44, D726-732 (2016). https: / / doi.org:10.1093 / nar / gkv1160 78 Dunham, I et al. An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74 (2012). https: / / doi.org:10.1038 / nature11247 79 Bernstein, B.E et al. The NIH Roadmap Epigenomics Mapping Consortium. Nat Biotechnol 28, 1045-1048 (2010). https: / / doi.org:10.1038 / nbt1010-1045 80 Grimm, S.A et al. DNA methylation in mice is influenced by genetics as well as sex and life experience. Nat Commun 10, 305 (2019). https: / / doi.org:10.1038 / s41467-018-08067-z 81 Sibley, C.R. Individual Nucleotide Resolution UV Cross-Linking and Immunoprecipitation (iCLIP) to Determine Protein-RNA Interactions. Methods Mol Biol 1649, 427-454 (2018). https: / / doi.org:10.1007 / 978-1-4939-7213-5_29 82 Supek, F., Bosnjak, M., Skunca, N. and Smuc, T. REVIGO summarizes and visualizes long lists of gene ontology terms. PLoS One 6, e21800 (2011). https: / / doi.org:10.1371 / journal.pone.0021800 83 Auweter, S.D et al. Molecular basis of RNA recognition by the human alternative splicing factor Foc-1. EMBO J 25, 163-173 (2006). https: / / doi.org:10.1038 / sj.emboj.7600918 84 Quinlan, A.R. and Hall, I.M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842 (2010). https: / / doi.org:10.1093 / bioinformatics / btq033 85 Dale, R.K., Pedersen, B.S. and Quinlan, A.R. Pybedtools: a flexible Python library for manipulating genomic datasets and annotations. Bioinformatics 27, 3423-3424 (2011). https: / / doi.org:10.1093 / bioinformatics / btr539 86 Smedley, D et al. BioMart--biological queries made easy. BMC Genomics 10, 22 (2009). https: / / doi.org:10.1186 / 1471-2164-10-22 87 Chen, E.Y et al. Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinformatics 14, 128 (2013). https: / / doi.org:10.1186 / 1471-2105-14-128 88 Kuleshov, M.V et al. Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res 44, W90-97 (2016). https: / / doi.org:10.1093 / nar / gkw377 89 Haberman, N et al. Insights into the design and interpretation of iCLIP experiments. Genome Biol 18, 7 (2017). https: / / doi.org:10.1186 / s13059-016-1130-x 90 Vizcaino, J.A et al. 2016 update of the PRIDE database and its related tools. Nucleic Acids Res 44, D447-456 (2016). https: / / doi.org:10.1093 / nar / gkv1145。

Claims

1. Antisense oligomers capable of inducing skipping of exon 12 of scavenger receptor class B type 1 (SCARB1). 2 . The antisense oligomer of claim 1 , wherein the antisense oligomer is capable of inducing skipping of exon 12 of human SCARB1.

3. The antisense oligomer of claim 1 or claim 2, wherein the antisense oligomer is 10-45 nucleobases, 12-40 nucleobases, 15-35 nucleobases, 18-30 nucleobases, or 19-25 nucleobases in length.

4. The antisense oligomer of any one of claims 1 to 3, wherein the antisense oligomer comprises a nucleobase sequence according to any one of SEQ ID NO: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19, and comprises 5, 4, 3, 2, 1 or fewer substitutions, deletions or insertions.

5. The antisense oligomer of any one of claims 1 to 4, wherein the antisense oligomer comprises a nucleobase sequence according to any one of SEQ ID NO: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19, and one or more nucleobases are substituted with a modified nucleobase capable of base pairing with a nucleobase of the same type.

6. The antisense oligomer of any one of claims 1 to 3, wherein the antisense oligomer comprises a nucleobase sequence according to any one of SEQ ID NO: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19.

7. The antisense oligomer of any one of claims 1 to 3, wherein the antisense oligomer comprises a nucleobase sequence according to any one of SEQ ID NOs: 5, 8, 10, 11, 18 or 19.

8. The antisense oligomer of claim 1 or claim 2, wherein the nucleobase sequence of the antisense oligomer is according to any one of SEQ ID NO: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19.

9. The antisense oligomer of any preceding claim, wherein the antisense oligomer is complementary to 5, 10, 15, 16, 17, 18, 19, 20 or all bases to which the antisense oligomer according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19 is complementary.

10. The antisense oligomer of any preceding claim, wherein the antisense oligomer is complementary to 5, 10, 15, 16, 17, 18, 19 or all 20 bases to which SSO8.18 (SEQ ID NO: 51) is complementary.

11. The antisense oligomer of any preceding claim, wherein the antisense oligomer comprises at least one 2'-O-methyl nucleotide and / or at least one 2'-O-methoxyethyl nucleotide.

12. The antisense oligomer of any preceding claim, wherein the antisense oligomer is a 2'-O-methyl nucleic acid oligomer and / or a 2'-O-methoxyethyl nucleic acid oligomer.

13. The antisense oligomer of any preceding claim, wherein the antisense oligomer comprises at least one phosphorothioate internucleotide linkage.

14. The antisense oligomer of any preceding claim, wherein all internucleotide linkages in the antisense oligomer are phosphorothioate internucleotide linkages.

15. The antisense oligomer of any preceding claim, wherein the antisense oligomer is an oligonucleotide and has a nucleobase sequence according to SEQ ID NO: 5, 8, 10, 11, 18 or 19, and wherein -O-CH 3 or -O-CH 2 -CH 2 -O-CH 3 Attached to the 2' position of the sugar moiety of each nucleotide.

16. An antisense oligonucleotide having a sequence according to any one of SEQ ID NOs: 4, 5, 7, 8, 9, 10, 11, 12, 18 or 19, wherein the internucleotide linkage is a phosphorothioate internucleotide linkage, and wherein -O-CH 3 or -O-CH 2 -CH 2 -O-CH 3 Attached to the 2' position of the sugar moiety of each nucleotide.

17. The antisense oligomer of any preceding claim, wherein the antisense oligomer is SSO8.5 (SEQ ID NO: 38), SSO8.8 (SEQ ID NO: 41), SSO8.10 (SEQ ID NO: 43), SSO8.11 (SEQ ID NO: 44), SSO8.18 (SEQID NO: 51), SSO8.19 (SEQ ID NO: 52) or SSO8.21 (SEQ ID NO: 54) or comprises thereof.

18. The antisense oligomer of any preceding claim, wherein the antisense oligomer is or comprises SSO8.18 (SEQ ID NO: 51).

19. A pharmaceutical composition comprising the antisense oligomer or antisense oligonucleotide according to any one of claims 1 to 18.

20. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition according to any one of claims 1 to 19 for use as a medicament.

21. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition of any one of claims 1 to 19, for use in a method for treating or preventing a metabolic-related disease.

22. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition of any one of claims 1 to 19 for use in a method for treating or preventing the pathological effects of obesity and / or an obesogenic diet.

23. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition for use according to claim 22, wherein the pathological effect is liver inflammation, lipotoxicity, hepatocellular damage and / or fibrosis.

24. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition of any one of claims 1 to 19 for use in a method for treating or preventing liver inflammation.

25. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition for use according to claim 24, wherein the liver inflammation is obesity-induced.

26. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition of any one of claims 1 to 19 for use in a method of treating or preventing metabolic associated fatty liver disease (MAFLD).

27. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition of any one of claims 1 to 19 for use in a method for treating or preventing presymptomatic hepatic steatosis.

28. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition of any one of claims 1 to 19 for use in a method of treating or preventing non-alcoholic steatohepatitis (NASH).

29. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition of any one of claims 1 to 19, for use in a method of treating or preventing hepatocellular carcinoma (HCC) in a subject.

30. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition for use according to claim 29, wherein the subject suffers from liver inflammation, presymptomatic hepatic steatosis, or NASH.

31. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition of any one of claims 1 to 19 for use in treating or preventing any one or a combination of gallstone disease, type 2 diabetes, cardiovascular disease and coronary artery disease.

32. The antisense oligomer, antisense oligonucleotide or pharmaceutical composition of any one of claims 1 to 19 for use in a method of treatment, wherein the method comprises lowering cholesterol levels in a subject in need thereof.

33. A method for increasing expression of the class B type I scavenger receptor (Scarbl) subtype SR-BII relative to subtype SR-BI in a cell, the method comprising contacting the cell with a composition comprising the antisense oligomer or antisense oligonucleotide of any one of claims 1 to 18.

34. The method of claim 33, wherein the method is in vivo and the composition is administered to a subject in need thereof.

Images