Digital amplification method for quantifying and / or determining human male DNA integrity

Abstract

According to a first aspect of the invention there is provided a digital amplification method for detecting and quantifying DNA and for determining the degradation and / or integrity of DNA, in particular male DNA, in a sample wherein the method comprises the step of digitally amplifying at least two regions on at least one locus within the Y chromosome.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, diagnostics, more specifically to the field of analysis and forensics. The invention also belongs to the field of nucleic acid amplification and quantification, more specifically to the field of DNA quantification. Background Art

[0002] DNA-based detection methods are becoming increasingly important in many fields, such as in forensics. Human DNA isolated from various sources must be assessed for quantity, quality, and integrity prior to further forensic testing, such as short tandem repeat (STR) analysis or next-generation sequencing. Since these methods require a defined range of input DNA amounts and template qualities to perform accurately, DNA quantification and integrity assessment are important steps in the forensic workflow.

[0003] Furthermore, evidence collection from sexual assaults is crucial for prosecuting sex offenders. Physical evidence from semen is often used as the standard for confirming sex crimes. However, isolating and quantifying DNA from sexual assault samples is often challenging due to the presence of DNA molecules from both the female victim and the male assailant. In a typical sample, the amount of female DNA is several orders of magnitude higher than the amount of male DNA. Furthermore, evidence is often not collected immediately after a sex crime occurs, but rather hours or days later, which can result in the isolation of partially or completely degraded male DNA. Degraded male DNA can result in loss of amplification of longer amplicons or even complete failure of Y-chromosome STR (Y-STR) analysis.

[0004] Determining the amount of DNA recovered from forensic samples, as well as other samples, is a critical step in the entire DNA typing process and in detecting DNA in a variety of other scientific fields. A narrow range of 0.5 to 2 ng of input DNA is usually required to produce optimal results, such as with multiplex DNA typing kits. Therefore, quantification of DNA is absolutely important in order to ensure that positive results are positive results and / or negative results are negative results due to the absence of DNA. In addition, the quality of forensic DNA testing laboratory standards requires human-specific DNA quantification. This is due to the fact that isolation techniques can recover human DNA as well as bacterial and other foreign DNA. Many procedures have been developed to allow for the quantification of human-specific DNA, including prime blot techniques, liquid-based hybridization assays, and real-time polymerase chain reaction (PCR). Currently, real-time PCR is the dominant technique due to its wide dynamic range and ease of automation. However, for male DNA quantification by qPCR, a standard curve is required to calculate the amount of DNA in the sample. Typically, the standard curve is prepared by the user through serial dilutions. The preparation of the standard curve is essential for accurate DNA quantification of the sample. Depending on the skills of the user and the quality of the equipment used for standard curve preparation, the DNA dilution and DNA standard curve preparation process itself can be tedious, laborious, and prone to errors, which can lead to erroneous quantification results and outright failure of subsequent Y-STR analysis.

[0005] Furthermore, methods for quantifying human DNA using digital PCR are limited by the availability of different dye channels, thus preventing the simultaneous use of higher multiplexed approaches to assess DNA quantity and DNA integrity. Modern short tandem repeat (STR) kits have become more sensitive and can achieve good results even with small amounts of DNA. Therefore, there is a need for a method, kit, and nucleic acid region that can precisely and accurately quantify human male DNA even in low concentration samples.

[0006] Several quantification and detection kits are available. One such kit is the Quantifiler Human Kit (Applied Biosystems), another is the Quantifiler Duo Kit (Applied Biosystems), and a third is the Plexor HY Real-Time PCR Quantification Kit (Promega). Both the Quantifiler Duo Kit and the Plexor HY Kit target autosomal and sex chromosome (Y chromosome) targets on the genome.

[0007] However, there are some disadvantages in the kits currently on the market. According to LaSalle et al. (Forensic Science International: Genetics, (2011) 5: 185-193), Quantifiler Kit is more accurate in quantification, but the dynamic range is lower than Plexor HY. Due to the amplification of multi-copy targets, Plexor HY provides a higher dynamic range, but the accuracy is lower. This lower accuracy can be attributed to multi-copy targets. If the complete set of less than 20 copies on the genome is amplified due to reasons such as unstable target copy number, the amplification ratio between autosomes and sex chromosomes (Y) targets may be different. The dynamic range of the Plexor HY kit is slightly better than other kits (LaSalle et al., Forensic Science International: Genetics, (2011) 5: 185-193). In statistical comparisons, it has been shown that there are significant differences between the two kits (LaSalle et al., Forensic Science International: Genetics, (2011) 5: 185-193).

[0008] Another important parameter in forensics is the degree of degradation of the DNA to be analyzed. Since the amplicon size of Quantifiler Human and Plexor HY varies from 62 to 133 base pairs (bp), significant differences may occur when the kits are applied to degraded DNA. In addition, inhibitors must also be taken into account. It is very likely that DNA was present in the reaction, but no results were obtained due to the presence of inhibitory substances.

[0009] In the case of sexual assault samples, quantification of DNA is challenging due to the presence of DNA molecules from both the female victim and the male assailant. Furthermore, in a typical sample, the amount of female DNA is several orders of magnitude higher than the amount of male DNA. Therefore, there is great interest in a sensitive and precise male-specific DNA quantification method that can accurately detect and quantify male DNA even in the presence of a high background of female DNA.

[0010] This article reports a digital PCR (dPCR-based) DNA quantification system that has high sensitivity and accuracy to detect a small amount of male DNA against a high background of female DNA and simultaneously assess male DNA degradation and / or male DNA integrity. It should be emphasized here that, except for the system / method described in WO2018054783A1, there are currently no other known systems / methods for assessing the integrity of male DNA in a mixed sample containing male and female DNA, where the amount of female DNA far exceeds the amount of male DNA. However, the system / method described in WO2018054783A1 is based on qPCR and has all the disadvantages as described above. Summary of the invention

[0011] The present invention relates to a digital amplification method for detecting and quantifying DNA in a sample and for determining the degradation and / or integrity of DNA in a sample, especially male DNA, wherein the method comprises the step of digitally amplifying at least two regions on at least one locus within the Y chromosome.

[0012] In several embodiments of the invention, at least one locus within the Y chromosome may be a single copy and / or a multi-copy locus (MCL-Y).

[0013] In particular, the present invention relates to a method for i) detecting DNA, ii) quantifying DNA and iii) determining the integrity and / or degradation state of DNA, preferably male DNA in a sample comprising male DNA, wherein the method comprises the following steps: a) amplifying at least two regions at at least one locus within chromosome Y, wherein the amplification is performed by digital PCR, b) detecting at least two amplification products by using at least two probes, c) quantifying the amount of the at least two amplification products, and d) determining the integrity and / or degradation status of the DNA in the sample by calculating the degradation index, wherein at least one of the at least two probes binds to one of the at least two amplification products, and at least one other of the at least two probes binds to another of the at least two amplification products, and wherein at least one of the at least two amplification products is longer than another of the at least two amplification products.

[0014] The term "at least one" or "at least one" used in the present invention refers to 1, 2, 3 or more. For example, at least one region or at least one locus means including 1, 2, 3 or more regions or loci, respectively. Similarly, "at least two" or "at least two" used herein refers to 2, 3, 4 or more. For example, at least two regions or at least two loci mean including 2, 3, 4 or more regions or loci, respectively. In one embodiment of the present invention, at least two regions that are amplified are located at one locus within the Y chromosome but do not overlap with each other, or at least two of the two or more regions do not overlap.

[0015] In another embodiment of the present invention, the at least two regions amplified are located on at least two loci within chromosome Y. Preferably, the at least two loci within chromosome Y are single copy and / or multi-copy loci within chromosome Y or at least one single copy locus and at least one multi-copy locus (MCL-Y).

[0016] In another embodiment of the present invention, at least two regions that are amplified are located at one locus within the Y chromosome and overlap with each other.

[0017] In one embodiment of the invention, the amplification step is performed using at least one primer selected from one of the following groups: a. SEQ ID NO. 1 and SEQ ID NO. 2, b. the reverse complementary sequence of SEQ ID NO. 1 and SEQ ID NO. 2, and c. A primer having at least 90% sequence identity with one of the primers having SEQ ID NO. 1 and SEQ ID NO. 2 or their reverse complement sequences.

[0018] In several embodiments of the invention, the amplification step is performed using a primer pair selected from one of the following groups: a. SEQ ID NO. 1 and SEQ ID NO. 2, b. the reverse complementary sequence of SEQ ID NO. 1 and SEQ ID NO. 2, and c. A primer having at least 90% sequence identity with one of the primers having SEQ ID NO. 1 and SEQ ID NO. 2 or their reverse complement sequences.

[0019] In a preferred embodiment, the amplification is performed using a primer pair having sequences according to SEQ ID NO. 1 and SEQ ID NO. 2.

[0020] In several embodiments of the invention, the sample is derived from one of the following sample and / or tissue types: whole blood, blood fractions, plasma, serum, oral specimens, saliva, sputum, urine, human biopsy tissue, clothing samples containing biological material, vaginal swabs, sperm, skin or wound swabs, or other samples containing biological material or other parts of the human body that can be used to isolate genomes.

[0021] Preferably, the sample comprises male and female genomic DNA.

[0022] In one embodiment of the invention, at least two regions at at least one locus within the Y chromosome do not overlap.

[0023] In another embodiment of the present invention, at least two regions on at least one locus within chromosome Y overlap. Preferably, at least two overlapping regions on at least one locus within chromosome Y are amplified using at least one common primer.

[0024] In several embodiments of the invention, the at least one locus within the Y chromosome is a single copy and / or a multi-copy locus or at least one single copy locus and at least one multi-copy locus within the Y chromosome (MCL-Y).

[0025] In several embodiments of the invention, the amplifying step further comprises amplifying an internal amplification control (IC).

[0026] In one embodiment of the present invention, at least two amplified regions are located at at least two loci within the Y chromosome.

[0027] In several embodiments of the invention, the at least two loci within the Y chromosome are single copy and / or multi-copy loci or at least one single copy locus and at least one multi-copy locus within the Y chromosome (MCL-Y).

[0028] In one embodiment of the invention, at least one locus within the Y chromosome is a multicopy locus (MCL-Y), wherein the locus has at least 85% sequence identity with a sequence according to SEQ ID NO. 3 or its reverse complement over a stretch of at least 60 base pairs (bp), or wherein the locus is amplifiable using a primer pair according to SEQ ID NO. 1 and 2 or their reverse complement.

[0029] The present invention also relates to a kit for performing the method according to the present invention, wherein the kit comprises at least one primer selected from SEQ ID NO 1 and SEQ ID NO 2.

[0030] Digital polymerase chain reaction (dPCR; also abbreviated as, for example, digital PCR, DigitalPCR, ddPCR or dePCR) is an improvement on conventional polymerase chain reaction methods such as qPCR. Digital polymerase chain reaction (dPCR) enables absolute quantification of target nucleic acids present in a sample and mitigates the shortcomings of qPCR. Unlike qPCR, dPCR does not rely on a calibration curve for sample quantification. Therefore, it avoids the drawbacks associated with variations in reaction efficiency. dPCR is an absolute nucleic acid quantification method that relies on detecting an endpoint fluorescence signal and enumerating binomial events, i.e., the presence or absence of fluorescence in a partition. In dPCR, the sample is first partitioned into many independent PCR sub-reactions such that each partition contains a small amount, one, or no target sequence. Such partitions or microreactors can be arranged, for example (but not limited to), as small water-in-oil droplets or microfluidic nanoplates.

[0031] After PCR, the fraction of amplification-positive partitions is used to quantify the concentration of the target sequence with a statistically defined accuracy using Poisson statistics, where each partition needs to have 0, 1, or more target sequences for calculation to be performed. Interestingly, sample partitioning effectively concentrates the target sequences within separate microreactors. This concentration effect reduces template competition, enabling the detection of rare mutations in a background of wild-type sequences (Quan et al., 2018, MDPI, “dPCR: A Technology Review”).

[0032] dPCR can also allow for a higher tolerance to inhibitors present in the sample, since it does not require nearly 100% amplification efficiency per cycle as is the case with qPCR. Rather, it is sufficient if a detectable signal or no signal is present at the end of the amplification reaction. PCR performs one reaction per sample. dPCR also performs one reaction within a sample, but the sample is divided into a large number of partitions, and the reaction in each partition is performed separately. This separation allows for more reliable collection and sensitive measurement of nucleic acid quantities.

[0033] Instead of performing a single reaction in each well, dPCR partitions the PCR solution into at least a few hundred, but in most cases thousands or tens of thousands or more nanoliter-sized partitions, with a separate PCR reaction occurring in each partition. dPCR solutions are prepared similarly to quantitative assays, using fluorescent quencher probes or intercalating dyes and a PCR master mix containing optimal concentrations of DNA polymerase, dNTPs, MgCl2, and reaction buffer.

[0034] Several different approaches can be used to perform sample distribution, including microplates, microfluidic nanoplates, capillaries, oil emulsions, and microchamber arrays with nucleic acid-binding surfaces.

[0035] After multiple cycles of PCR amplification, the fluorescence of the sample is checked with a binary readout of "0" (absent) or "1" (present). The fraction of the fluorescence partitions is recorded. Partitioning of the sample allows one to estimate the number of distinct molecules by assuming that the population of molecules follows a Poisson distribution, thus accounting for the possibility that multiple target molecules inhabit a single partition. Using Poisson's law of decimals, the distribution of target molecules within the sample can be accurately approximated, allowing for quantification of the target strands in the PCR products.

[0036] Compared to qPCR reactions, dPCR reactions are endpoint PCR reactions. dPCR uses the number of fluorescent positive partitions divided by the total number to reversely calculate the target concentration. Compared to qPCR, sample quantification in dPCR does not require a calibration curve. In summary, compared to qPCR, dPCR provides more robust quantification, is less susceptible to inhibitors, and is independent of quantification standards.

[0037] Advantages of dPCR include increased precision through a large number of sample partitions, thereby ensuring reliable measurements of the desired DNA sequence due to reproducibility. Error rates are greater when detecting small fold-change differences using qPCR, whereas error rates are lower with dPCR because smaller fold-change differences can be detected in DNA sequences. Additionally, dPCR is highly quantitative because it does not rely on the relative fluorescence of the solution to determine the amount of target DNA amplified.

[0038] The inventors have now surprisingly found that applying dPCR to the method previously disclosed in WO2018054783A1 produces completely unexpectedly good results. The accuracy of the new method is about 4 times higher than the known method.

[0039] The maternal bloodstream contains a small amount of freely circulating cell-free fetal DNA (cffDNA). Analysis of cffDNA provides a non-invasive prenatal diagnosis and detection method that can be used, for example, to determine the sex of the fetus at an early stage. The method of the present invention is also capable of detecting and analyzing male cell-free fetal DNA and helps to identify the sex of the fetus. In addition, the method of the present invention significantly reduces the risk of incorrect sex identification of embryos because contaminating male genomic DNA (such as DNA introduced into the sample from the environment) can be evaluated by the degradation index generated for male targets by the small and large PCR systems used in the present invention. DETAILED DESCRIPTION

[0040] In forensic samples of sexual assault, the amount of female DNA usually exceeds that of male DNA. To select an appropriate genetic analysis method, it is recommended to test for the presence of male DNA in the samples collected from the crime scene and quantify the amount of male DNA, preferably while assessing the degradation status of male DNA, so as to know how much of this DNA should be used in genetic analysis (such as STR reaction). Typical STR kits detect genetic length polymorphisms on different autosomes, but in some cases, such as for sexual assault samples, it may be advantageous to analyze only the length polymorphisms on the Y chromosome, because female DNA does not contain these length polymorphisms.

[0041] The inventors have found that when used for detecting and / or quantifying nucleic acids, multi-copy loci on the Y chromosome are superior to single-copy loci because the sensitivity of the reaction can be enhanced. Surprisingly, the present invention now shows that, for example, in Figure 1 the method of the present invention using dPCR instead of qPCR for amplification is more accurate (as shown by lower %CV values) than the previous state-of-the-art methods. Due to its relevance in the field of forensic medicine, this is an important aspect of the present invention.

[0042] If the locus is a multi-copy locus on the Y chromosome, it may occur multiple times on the Y chromosome but not on other chromosomes. If the locus is a single-copy locus on the Y chromosome, it may occur only once on the Y chromosome but not on other chromosomes.

[0043] The present invention relates to a digital amplification method for detecting and quantifying DNA in a sample and determining the degradation and / or integrity of DNA, in particular male DNA in the sample, wherein the method comprises the step of performing digital amplification on at least two regions on at least one locus within the Y chromosome.

[0044] The present invention also relates to a method for i) detecting DNA, ii) quantifying DNA, and iii) determining the integrity and / or degradation status of DNA, preferably the male DNA in a sample containing male DNA, wherein the method comprises the following steps: a) amplifying at least two regions on at least one locus within the Y chromosome, wherein the amplification is performed by digital PCR, b) detecting at least two amplification products by using at least two probes, c) quantifying the amounts of the at least two amplification products, and d) determining the integrity and / or degradation status of the DNA of the sample by calculating a degradation index, wherein at least one of the at least two probes binds to one of the at least two amplification products, and at least one other of the at least two probes binds to another of the at least two amplification products, and wherein at least one of the at least two amplification products is longer than another of the at least two amplification products.

[0045] In one embodiment of the invention, the at least two regions amplified are located on at least one locus within the Y chromosome, but do not overlap each other, or at least two of the two or more regions do not overlap. The at least one locus may be a single copy or multi-copy locus (MCL-Y) within the Y chromosome.

[0046] In another embodiment of the present invention, the at least two regions that are amplified are located at at least two loci within chromosome Y. The loci may be single copy and / or multi-copy loci within chromosome Y (MCL-Y).

[0047] In another embodiment of the present invention, the at least two regions amplified are located on at least one locus within chromosome Y and overlap with each other. The at least one locus may be a single copy or multi-copy locus within chromosome Y (MCL-Y).

[0048] In particular, the inventors surprisingly discovered that the sequence identified in SEQ ID NO. 3 and / or a sequence having sequence similarity thereto, i.e., SEQ ID NO. 4, may occur multiple times on chromosome Y. In particular, the sequence SEQ ID NO. 3 or a sequence very similar thereto occurs nine times on chromosome Y of humans. This discovery provides valuable advantages for the method of the present invention.

[0049] In one embodiment of the invention, the amplification step is performed using at least one primer selected from one of the following groups: a. SEQ ID NO. 1 and SEQ ID NO. 2, b. the reverse complementary sequence of SEQ ID NO. 1 and SEQ ID NO. 2, and c. A primer having at least 90% sequence identity with one of the primers having SEQ ID NO. 1 and SEQ ID NO. 2 or their reverse complement sequences.

[0050] In several embodiments of the invention, the amplification step is performed using a primer pair selected from one of the following groups: a. SEQ ID NO. 1 and SEQ ID NO. 2, b. the reverse complementary sequence of SEQ ID NO. 1 and SEQ ID NO. 2, and c. A primer having at least 90% sequence identity with one of the primers having SEQ ID NO. 1 and SEQ ID NO. 2 or their reverse complement sequences.

[0051] In a preferred embodiment, the amplification is performed using a primer pair having sequences according to SEQ ID NO. 1 and SEQ ID NO. 2.

[0052] In several embodiments of the invention, the sample is derived from one of the following tissue types: whole blood, blood fraction, buccal specimen, urine, human biopsy tissue, or other parts of the human body that can be used to isolate genomes.

[0053] Preferably, the sample comprises male and female genomic DNA.

[0054] In one embodiment of the invention, at least two regions at at least one locus within the Y chromosome do not overlap.

[0055] In another embodiment of the present invention, at least two regions on at least one locus within chromosome Y overlap. Preferably, at least two overlapping regions on at least one locus within chromosome Y are amplified using at least one common primer.

[0056] In several embodiments of the invention, the at least one locus within the Y chromosome is a single copy and / or a multi-copy locus or at least one single copy locus and at least one multi-copy locus within the Y chromosome (MCL-Y).

[0057] In several embodiments of the present invention, the amplification step further comprises amplifying an internal amplification control (IC). In one embodiment, the internal amplification control is an artificial nucleic acid template. In an alternative embodiment, the internal amplification control comprises a sequence of an organism that is different from the source or suspected source of the sample nucleic acid to be analyzed. In a preferred embodiment, the internal amplification control comprises a sequence with very low identity to the sequence in the sample. In a preferred embodiment, the internal amplification control is generated using a random algorithm. In a more preferred embodiment, the internal amplification control is similar to SEQ ID NO 48. In a preferred embodiment, the length of the internal amplification control is between 70 and 2000 nucleotides. In a preferred embodiment, the length of the internal amplification control is between 150 and 1500 nucleotides. In a more preferred embodiment, the length of the internal amplification control is between 150 and 1000 nucleotides. In a more preferred embodiment, the length of the internal amplification control is between 200 and 500 nucleotides. More preferably, the length of the internal amplification control is between 50 and 2000 nucleotides. In a preferred embodiment, the length of the internal amplification control is between 50 and 1500 nucleotides. In a more preferred embodiment, the length of the internal amplification control is between 50 and 1000 nucleotides. In a more preferred embodiment, the length of the internal amplification control is between 50 and 500 nucleotides. Analysis of the target amplification product and the internal control fragment allows differential identification of the presence of inhibitors or degradation of the sample. A more detailed description of the structural and functional characteristics of the internal amplification control is provided in WO2018050835A1, which is incorporated herein by reference.

[0058] In one embodiment of the present invention, at least two amplified regions are located at at least two loci within the Y chromosome.

[0059] In several embodiments of the invention, the at least two loci within the Y chromosome are single copy and / or multi-copy loci or at least one single copy locus and at least one multi-copy locus within the Y chromosome (MCL-Y).

[0060] In one embodiment of the invention, at least one locus within the Y chromosome is a multicopy locus (MCL-Y), wherein the locus has at least 85% sequence identity with a sequence according to SEQ ID NO. 3 or its reverse complement over a stretch of at least 60 base pairs (bp), or wherein the locus is amplifiable using a primer pair according to SEQ ID NO. 1 and 2 or their reverse complement.

[0061] The present invention also relates to a kit for performing the method according to the present invention, wherein the kit comprises at least one primer selected from SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 13, SEQ ID NO 14 and / or SEQ ID NO 15 and / or their complementary sequences, and optionally at least one probe selected from SEQ ID NO 12 and / or SEQ ID NO 16 and / or their complementary sequences.

[0062] In the context of the present invention, the term "amplifiable" refers to the property that a region can be amplified by a dPCR amplification method. It is known to those skilled in the art that the achievement of an amplification reaction depends on the experimental conditions used.

[0063] The present invention relates to a method, wherein the digital amplification step is performed using at least one primer selected from one of the following groups: (i) SEQ ID NO. 1 and SEQ ID NO. 2, (ii) the reverse complement of SEQ ID NO. 1 and SEQ ID NO. 2 and (iii) a primer having at least 90% sequence identity with one of the primers having SEQ ID NO. 1 and SEQ ID NO. 2 or their reverse complement.

[0064] The present invention relates to a digital amplification method, wherein the digital amplification step is performed using a primer pair selected from one of the following groups: (i) SEQ ID NO. 1 and SEQ ID NO. 2, (ii) reverse complementary sequences of SEQ ID NO. 1 and SEQ ID NO. 2, and (iii) a primer having at least 90% sequence identity with one of the primers having SEQ ID NO. 1 and SEQ ID NO. 2 or their reverse complementary sequences.

[0065] The sequences distributed throughout the genome are not all identical. It is important that the selected primers also bind to nearly identical sequences. Therefore, ideally, the region has at least 60%, 70%, 80%, 90% or even 95% or 98% sequence identity with the sequence according to SEQ ID NO. 3 over a 60 bp stretch.

[0066] The region may also be selected from any one of SEQ ID NOs. 3 to 11. Therefore, if SEQ ID NO. 3 is claimed herein, the same applies to 4 to 11.

[0067] The inventors have surprisingly developed a widely used dPCR system for degradation analysis.

[0068] The degradation state / integrity of male DNA can be assessed by using, for example, at least two genomic regions of different sizes in dPCR in one container. Preferably, the amplified target either has a comparable copy number or takes into account the lack of comparable copy number in subsequent calculations. In the case of degraded male DNA, the average length of male DNA fragments in the sample will be reduced. The degradation index is calculated by dividing the number of smaller amplicons by the number of larger amplicons. The more fragmented the template DNA, the higher the degradation index, because the possible template molecules of the larger amplicons will be lost in large quantities. For example, the average DNA size of multiple DNA molecules is 150 bp, where the size of multiple DNA molecules follows a Gaussian distribution, which means that only a few molecules of 353 bp size and fewer molecules of 496 bp size exist. Therefore, the degradation index can infer the degradation state of unknown DNA in the customer sample. Therefore, in one aspect of the digital amplification method of the present invention, the state of DNA integrity and / or degradation is represented by the quantified ratio of at least two overlapping and / or non-overlapping regions within at least one locus.

[0069] Thus, in one aspect of the invention, the status of DNA integrity and / or degradation is represented by a quantified ratio of at least two overlapping and / or non-overlapping regions within at least one locus.

[0070] Here, smaller fragments are combined with different larger fragments, depending on the degree of degradation of the nucleic acid.

[0071] A larger snippet could be: (i) 359 bp or 357 bp fragment (primers SEQ ID NO. 2 and SEQ ID NO. 13), (ii) a 340 bp fragment or a 339 bp fragment (e.g., primers SEQ ID NO. 2 and SEQ ID NO. 14), or (iii) 359 bp fragment, 361 bp fragment or 362 bp fragment (SEQ ID NO. 2 and SEQ ID NO. 15).

[0072] Uniquely, the system is configured such that one primer in the primer pair is common to two or more fragments being amplified. Thus, two small fragments and a large fragment can have a common upstream or downstream primer. Here, preferably the upstream primer (SEQ ID NO. 2) is common to all amplifications.

[0073] The percentage identity between two sequences was determined using the mathematical algorithm of Karlin and Altschul (Proc. Natl. Acad. Sci. USA (1993) 90:5873-5877). This algorithm is the basis of the BLASTN and BLASTP programs of Altschul et al. (J. Mol. Biol. (1990) 215: 403-410). The BLASTN program was used to perform a BLAST nucleotide search with a score of 100 and a word length of 12 to obtain a nucleotide sequence homologous to SEQ ID NO. 1. In order to obtain a gap comparison for comparison purposes, the gap BLAST (Nucleic Acids Res. (1997) 25: 3389-3402) described by Altschul et al. was used. When using BLAST and gap BLAST programs, the default parameters of each program were used.

[0074] The forensic workflow for sexual assault samples recommends quantifying male DNA before performing STR reactions. This is done first to help decide which STR kit must be used for genetic analysis and then to determine how much DNA is available from a sample (such as one collected from a crime scene) and how much of this DNA should be used in the STR reaction. There are different STR kits available, and typical STR kits detect genetic length polymorphisms on different autosomes, but in some cases, such as for sexual assault samples, it may be advantageous to analyze only the length polymorphisms of the Y chromosome, since female DNA does not have a Y chromosome.

[0075] Typical STR reactions work best with a certain range of template DNA, and the entire analytical process is very labor intensive, so methods are needed to ensure a very high success rate for STR analysis. Therefore, it would be a real advantage if the quantification kit allowed the user to not only determine the amount of DNA present, but also assess the absence of inhibitors, which can affect STR reaction results, leading to failure or loss of precious sample material, and further purification of sample material if severe inhibition is observed.

[0076] According to one embodiment of the present invention, the region length on the multicopy locus (MCL-Y) in human chromosome Y is about 81 bp. As used herein, the term "about" refers to a range of + / - 20% of the reference value. Therefore, the length range of the region on the multicopy locus can be 65 to 95 bp.

[0077] Preferably, the method comprises the step of digitally amplifying at least two regions on at least one multicopy locus (MCL-Y) within chromosome Y, wherein the locus has at least 85%, 90%, 95% or 99% sequence identity with the sequence according to SEQ ID NO. 3 or its reverse complement over a stretch of at least 60 base pairs (bp).

[0078] The digital PCR method of the present invention shows improved accuracy over other commercially available methods.

[0079] According to another embodiment of the digital application of the present invention, the length of the amplification product of at least one nucleic acid is between 20 and 200 bp.

[0080] Preferably, the digital amplification step is performed using at least one primer selected from the group consisting of: (i) SEQ ID NO. 1 and SEQ ID NO. 2, (ii) the reverse complement of SEQ ID NO. 1 and SEQ ID NO. 2, and (iii) a primer having at least 90% sequence identity to one of the primers having SEQ ID NO. 1 and SEQ ID NO. 2 or their reverse complement. These may be combined with a second overlapping amplicon, wherein the primer pairs used have sequences according to: (iv) SEQ ID NO. 2 and SEQ ID NO. 13, SEQ ID NO. 2 and SEQ ID NO. 14, (v) and SEQ ID NO. 2 and SEQ ID NO. 15; see Figure 2 When additional degradation is measured, amplicons SEQ ID NOs. 1 and 2 are combined with an amplicon selected from the group consisting of: (i) SEQ ID NO. 2 and SEQ ID NO. 13, (ii) SEQ ID NO. 2 and SEQ ID NO. 14, or (iii) SEQ ID NO. 2 and SEQ ID NO. 15.

[0081] In a preferred embodiment, the digital amplification reaction comprises amplifying at least two overlapping regions using at least one common primer, or two common primers, or three or more common primers.

[0082] Preferably, the amplification step is performed using a primer pair selected from one of the following groups: (i) SEQ ID NO. 1 and SEQ ID NO. 2, (ii) the reverse complement of SEQ ID NO. 1 and SEQ ID NO. 2 and (iii) a primer having at least 90% sequence identity with one of the primers having SEQ ID NO. 1 and SEQ ID NO. 2 or their reverse complement, optionally in combination with one or more pairs selected from the following: (i) SEQ ID NO. 2 and SEQ ID NO. 13, (ii) SEQ ID NO. 2 and SEQ ID NO. 14 or (iii) SEQ ID NO. 2 and SEQ ID NO. 15.

[0083] Ideally, digital amplification is performed using a primer pair having sequences according to SEQ ID NO. 1 and SEQ ID NO. 2.

[0084] In some embodiments, amplified product can be at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50% longer than another amplified product. If there are three amplified products, the 3rd amplified product can be at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50% longer than the second amplified product. If there are four amplified products, the 4th amplified product can be at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50% longer than the 3rd amplified product, and the rest can be deduced by analogy. Therefore, preferably, amplified product has different sizes separately. Or, in at least two amplified products, a kind of has different sizes, which may be at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50% longer than at least one other amplified product.

[0085] Preferably, the sample is derived from one of the following sample and / or tissue types: whole blood, blood fractions, plasma, serum, oral specimens, saliva, sputum, urine, human biopsy tissue, clothing samples containing biological material, vaginal swabs, sperm, skin or wound swabs or other samples containing biological material or other parts of the human body that can be used to isolate the genome.

[0086] The method of the present invention is also capable of detecting and analyzing the degradation state of male DNA in undegraded or degraded female DNA.

[0087] Preferably, the digital amplification method is digital polymerase chain reaction (PCR).

[0088] According to another embodiment, the sample for the method of the present invention is derived from one of the following specimens: whole blood, blood fractions, oral fluid, body fluid, human biopsy tissue, or other parts of the human body that can be used to isolate genomes. The terms "oral fluid" and "body fluid" used herein refer to fluids discharged or secreted from the mouth and body, respectively, from which genomes can be isolated. As non-limiting examples, oral fluid and body fluid can include saliva, sputum, swabs, urine.

[0089] In a preferred embodiment, the DNA or RNA analyzed is fragmented. In another embodiment, the DNA or RNA analyzed is present in a composition together with an inhibitor.

[0090] As described above, a typical forensic sample contains a mixture of male and female DNA, wherein the amount of female DNA is several orders of magnitude higher than the amount of male DNA. Thus, according to another embodiment, the sample contains one or more additional nucleic acids from different genomes. As used herein, the term "different genome" refers to genomes isolated from different subjects, typically identified as female DNA.

[0091] According to another embodiment of the present invention, the digital amplification method is a digital polymerase chain reaction (PCR).

[0092] The amplification reaction according to the method of the present invention can be a non-isothermal method or an isothermal method.

[0093] Amplification methods will include buffers, dNTPs or NTPs in addition to the required enzymes.

[0094] As used herein, the term "dNTP" refers to deoxyribonucleoside triphosphates. Non-limiting examples of such dNTPs are dATP, dGTP, dCTP, dTTP, dUTP, which may also exist in the form of labeled derivatives, such as fluorescent labels, radioactive labels, biotin labels. Also contemplated are dNTPs with modified nucleotide bases, wherein the nucleotide bases are, for example, hypoxanthine, xanthine, 7-methylguanine, inosine, xanthine nucleoside, 7-methylguanosine, 5,6-dihydrouracil, 5-methylcytosine, pseudouridine, dihydrouridine, 5-methylcytidine. In addition, the present invention contemplates ddNTPs of the above-mentioned molecules.

[0095] As used herein, the term "NTP" refers to ribonucleoside triphosphates. Non-limiting examples of such NTPs are ATP, GTP, CTP, TTP, UTP, which may also exist in the form of labeled derivatives, such as fluorescent labels, radioactive labels, biotin labels.

[0096] According to one embodiment of the present invention, the amplification reaction comprises: (a) a buffer having a pH value between 7.8 and 9 or between 8 and 8.8 (at 20°C), and / or (b) a potassium salt selected from potassium chloride and potassium sulfate, and / or (c) an ammonium salt, preferably ammonium chloride or ammonium sulfate, and / or (d) magnesium chloride, and / or (e) a polymerase, preferably a hot-start polymerase.

[0097] Suitable buffers may be Tris-HCl-, HEPES-, TEA- and / or MOPS-buffers, but any other suitable buffer may be used.

[0098] According to another embodiment of the present invention, the amplification reaction comprises: (a) Tris-HCl with a pH value between 8 and 8.8 (at 20°C), and / or (b) a potassium salt selected from potassium chloride and potassium sulfate, and / or (c) an ammonium salt, preferably ammonium chloride or ammonium sulfate, and / or (d) magnesium chloride, and / or (e) a hot-start polymerase.

[0099] Preferably, the concentration of Tris-HCl is in the range of 10 to 100 mM, most preferably in the range of 20 to 70 mM, K + The concentration of NH 4 + The concentration of Mg is in the range of 1 to 40 mM, most preferably in the range of 2.5 to 30 mM. 2+ The concentration of Mg is 0.5 mM to 8 mM higher than the concentration of the four dNTPs, with Mg being the most preferred 2+ The concentration of the dNTPs is 0.7 mM to 5 mM higher than the concentration of the four dNTPs, and the hot-start polymerase is preferably one that allows a hot-start time of less than 5 minutes, most preferably less than 2 minutes.

[0100] A second aspect of the present invention relates to a primer or primer pair for digitally amplifying at least one region within a multicopy locus (MLC-Y) within human chromosome Y, selected from: 5' GAAAGGCCTCATCAGGGCTCAG 3' (SEQ ID NO 1) and 5' TCCTCACTGGGAAACATGAGGAATGAC 3' (SEQ ID NO 2).

[0101] According to one embodiment of the second aspect, at least one primer hybridizes under stringent conditions to a region of the Y chromosome, said region being represented by a region on a multi-copy locus according to SEQ ID NO. 3 to SEQ ID NO. 11.

[0102] The primers and probes according to the invention may be included in a kit, which optionally also includes primers and probes for internal amplification controls. Therefore, the present invention also relates to a kit for detecting and quantifying DNA and for determining the degradation and / or integrity of DNA in a sample, in particular male DNA, wherein the method comprises the step of digitally amplifying at least two regions within at least one locus within the Y chromosome.

[0103] The at least one locus within the Y chromosome may be a single copy and / or a multi-copy locus (MCL-Y).

[0104] The kit comprises at least one primer which binds under stringent conditions to a sequence having at least 80% sequence identity to a sequence according to SEQ ID NOs. 3 to 11 over an 80 bp stretch, wherein in a digital amplification reaction, at least one region within at least one locus within the Y chromosome is amplified. The locus is a single copy and / or multi-copy locus within the human Y chromosome. The at least one primer may bind to at least SEQ ID NOs. 3, 4, 5, 6, 7, 8, 9, 10 and / or SEQ ID NO. 11 or all of the above.

[0105] Specifically, the present invention relates to a kit comprising at least one primer selected from SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 13, SEQ ID NO 14 and / or SEQ ID NO 15 and / or their complementary sequences, and optionally at least one probe selected from SEQ ID NO 12 and / or SEQ ID NO 16 and / or their complementary sequences, for detecting and quantifying DNA in a digital amplification reaction of at least one region within at least one locus within chromosome Y and for determining the degradation and / or integrity of DNA (particularly male DNA) in a sample. The kit optionally further comprises one or more reagents required for performing the method of the present invention, such as one or more intercalating dyes, DNA polymerase, dNTP, MgCl2 and reaction buffer.

[0106] The present invention also relates to a kit for at least triple dPCR reactions, the kit comprising primers and / or probes for detecting and quantifying DNA in a digital amplification reaction of at least one region within at least one locus within the Y chromosome and for determining the degradation and / or integrity of DNA in a sample (particularly male DNA), the kit also comprising an internal amplification control (IC) and primers and / or probes for detecting and quantifying the internal amplification control.

[0107] Specifically, the present invention also relates to a kit for at least triple dPCR reactions, the kit comprising at least one primer selected from SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 13, SEQ ID NO 14 and / or SEQ ID NO 15 and / or their complementary sequences, and optionally at least one probe selected from SEQ ID NO 12 and / or SEQ ID NO 16 and / or their complementary sequences, for detecting and quantifying DNA in a digital amplification reaction of at least one region within at least one locus within the Y chromosome and for determining the degradation and / or integrity of DNA (especially male DNA) in a sample, the kit also comprising an internal amplification control (IC) according to SEQ ID NO 48 and primers and / or probes according to SEQ ID NO 46, SEQ ID NO 47 and / or SEQ ID NO 49 for detecting and quantifying the internal amplification control.

[0108] In another embodiment, the present invention relates to a kit for at least five-plex (5-plex) dPCR reactions, the kit comprising primers and / or probes for detecting and quantifying DNA and for determining the degradation and / or integrity of DNA (particularly male DNA) in a digital amplification reaction of at least one region within at least one locus within the Y chromosome, the kit also comprising an internal amplification control (IC) and primers and / or probes for detecting and quantifying the internal amplification control and primers and / or probes for detecting and quantifying DNA and for determining the degradation and / or integrity of DNA (particularly human or female DNA).

[0109] Specifically, the present invention also relates to a kit for tracking at least five-plex (5-plex) dPCR reactions, the kit comprising at least one primer selected from SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 13, SEQ ID NO 14 and / or SEQ ID NO 15 and / or their complementary sequences, and optionally at least one probe selected from SEQ ID NO 12 and / or SEQ ID NO 16 and / or their complementary sequences, for detecting and quantifying DNA in a digital amplification reaction of at least one region within at least one locus within the Y chromosome and for determining the degradation and / or integrity of DNA (especially male DNA) in a sample, the kit also comprising an internal amplification control (IC) according to SEQ ID NO 48 and primers and / or probes according to SEQ ID NO 46, SEQ ID NO 47 and / or SEQ ID NO 49 for detecting and quantifying the internal amplification control, and the kit also comprising at least one primer selected from SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53 and / or SEQ ID NO 54 and / or its complementary sequence, and / or at least one probe selected from SEQ ID NO 55, SEQ ID NO 56 and / or SED ID NO 57, for detecting and quantifying DNA in a digital amplification reaction and for determining the degradation and / or integrity of DNA (especially human or female DNA) in a sample.

[0110] In one embodiment of the invention, the digital amplification amplification reaction is a multiplex dPCR, wherein at least 5 different targets (human, degraded, male, male degraded, and an internal amplification control (IC)) are amplified.

[0111] Surprisingly, the inventors found that the present invention is highly multiplexable. Thus, they were able to run at least 5 different targets (human, degraded, male, male degraded and internal amplification control (IC)) which were successfully amplified in parallel (Examples 5 and Figure 5 ). With higher multiplexing, other single-copy and / or multi-copy loci and / or biomarkers can also be detected in parallel, e.g. for forensics, prenatal diagnosis, human identification.

[0112] The present invention also relates to a method for obtaining a male DNA degradation index, wherein the degradation index is at least 7 when measuring degraded DNA having a length of 300 bp, and the degradation index is at least 237 when measuring degraded male DNA having a length of 150 bp.

[0113] Preferably, in the digital amplification method according to the present invention, the evaluation of the degradation state of male DNA and / or the integrity of one or more nucleic acids in the sample is performed simultaneously with the detection of the quantified one or more nucleic acids. Preferably, the method solves the problem of the state of male DNA degradation and / or integrity even in the presence of high background female DNA. In another embodiment, the method can also be used for non-invasive early determination of fetal sex.

[0114] The present invention also particularly relates to evaluating the state of male DNA in a sample. This is done to evaluate the integrity or degradation state of male DNA in the sample. EXAMPLES AND DRAWINGS

[0115] Example 1 and Figure 1 Shown are precise data for quantification of male DNA by digital PCR compared to state-of-the-art qPCR methods.

[0116] Data for male DNA quantification are shown, including the mean, standard deviation and coefficient of variation (CV) for digital PCR as well as for two different state-of-the-art qPCR quantification methods for male DNA (QIAGEN Investigator Quantiplex Pro Kit and QIAGEN Investigator QuantiplexHYres Kit). The coefficient of variation (CV) is defined as the ratio of the standard deviation divided by the mean. It shows the degree of variation relative to the overall mean. The lower the CV value, the higher the accuracy of the quantification and prediction of the degree of degradation, even when only a single replicate of one sample is used. It is noteworthy that the method according to the present invention (dPCR) shows a higher accuracy compared to qPCR, with a CV of 2.6% for the male target (male) in digital PCR, while the male CV for QPro in qPCR is 5.2% and even 10.5% in QHYres. For the male degradation target, the coefficient of variation is 2.9% for digital PCR and 8.9% for QPro in qPCR. These data clearly show that the present invention has a higher accuracy and reliability for the quantification of male DNA (na = not available).

[0117] Example 2 and Figure 2 The measurement of male DNA integrity by degradation index according to the present invention is shown.

[0118] Degraded male DNA with average fragment lengths of 1500 bp, 1000 bp, 800 bp, 500 bp, 400 bp, 300 bp, 200 bp and 150 bp has been applied to the method of the present invention. The male degradation index (MDI) is calculated by dividing the quantified value of the male target (small target) by the quantified value of the male degraded target (larger target). The higher the degree of degradation of the quantified DNA, the greater the MDI value. The MDI produced by the method of the present invention has a large difference between the degraded male DNA fragments of 400 bp compared to 300 bp compared to 200 bp compared to 150 bp size.

[0119] Example 3 and Figure 3 A comparison of the male degradation index between the present invention and the prior art methods is shown. Figure 3 The male degradation index (i.e. the ratio of the amount of short fragments to the amount of long fragments (male / male degradation)) for the different tested systems is shown. It is noteworthy that the method according to the invention (second column) consistently obtains higher indices compared to the other systems on qPCR, especially for smaller fragments in the range of 300 bp and 150 bp (values ​​over 237). This indicates a higher sensitivity / precision for the detection of degraded male DNA and a better resolution of male DNA integrity.

[0120] Example 4 and Figure 4 Shown is the measurement of degraded male DNA against a background of non-degraded female DNA.

[0121] Figure 4 Shows the measurement of degraded male DNA in a background of undegraded female DNA. Different fragmented male DNA (0.04ng / RxN each) has been spiked into undegraded female DNA (40 ng / RxN). The present invention shows a significant increase in MDI values ​​from fragment length 500bp to 200bp, while the human degradation index cannot detect degraded male DNA in a background of female DNA and reports male DNA degradation. The present invention can accurately assess the degradation or integrity status of male DNA in a background of female DNA.

[0122] Example 5 and Figure 5 Multiplex amplification of the human target, degradation target, male target, male degradation target, and internal amplification control are shown. Figure 5Multiplex amplification of human target, degradation target, male target, male degradation target and internal amplification control is shown. A multiplex amplification setup according to the present invention wherein 5 different targets (5-plex: human, degradation, male, male degradation and internal amplification control (IC)) have been successfully amplified in parallel. Notably, the method according to the present invention is able to quantify human DNA, assess human DNA integrity, quantify male DNA and assess male DNA integrity in parallel and report successful digital PCR amplification by using an internal amplification control.

[0123] A schematic diagram of Y chromosome DNA amplification for DNA integrity assessment is shown in Example 6 and Figure 6. A schematic diagram showing a possible amplification setup is depicted. Fig. 6A Different primer pair combinations for amplifying overlapping regions at a locus, such as a multi-copy or single-copy locus located on the Y chromosome, are shown.

[0124] Figure 6B Different primer pair combinations used to amplify two non-overlapping regions at a locus located on the Y chromosome are shown.

[0125] Figure 6C Different primer pair combinations used to amplify two regions located at two loci on the Y chromosome are shown.

[0126] Figure 7 The sequences used are shown with their numbers and names.

Claims

1. A method for i) detecting DNA, ii) quantifying DNA and iii) determining the integrity and / or degradation state of DNA, preferably said DNA is said male DNA in a sample comprising male DNA, wherein said method The following steps are involved: a) amplifying at least two regions at at least one locus within chromosome Y, wherein the amplification is performed by digital PCR, b) detecting at least two amplification products by using at least two probes, c) quantifying the amount of the at least two amplification products, and d) determining the integrity and / or degradation status of the DNA in the sample by calculating the degradation index, wherein at least one of the at least two probes binds to one of the at least two amplification products, and at least one other of the at least two probes binds to another of the at least two amplification products, and wherein at least one of the at least two amplification products is longer than another of the at least two amplification products.

2. The method according to claim 1, wherein the amplification step is performed using at least one primer selected from one of the following groups: a. SEQ ID NO. 1 and SEQ ID NO. 2, b. the reverse complementary sequence of SEQ ID NO. 1 and SEQ ID NO. 2, and c. A primer having at least 90% sequence identity with one of the primers having SEQ ID NO. 1 and SEQ ID NO. 2 or their reverse complement sequences.

3. The method according to any one of claims 1 to 2, wherein the amplification step is performed using a primer pair selected from one of the following groups: a. SEQ ID NO. 1 and SEQ ID NO. 2, b. the reverse complementary sequence of SEQ ID NO. 1 and SEQ ID NO. 2, and c. A primer having at least 90% sequence identity with one of the primers having SEQ ID NO. 1 and SEQ ID NO. 2 or their reverse complement sequences.

4. The method according to any one of claims 1 to 3, wherein amplification is performed using a primer pair having sequences according to SEQ ID NO. 1 and SEQ ID NO.

2.

5. The method according to any one of claims 1 to 4, wherein the sample is derived from one of the following sample and / or tissue types: whole blood, blood fractions, plasma, serum, oral specimens, saliva, sputum, urine, human biopsy tissue, clothing samples containing biological material, vaginal swabs, sperm, skin or wound swabs or other samples containing biological material or other parts of the human body that can be used to isolate genomes.

6. The method according to any of the preceding claims, wherein the sample comprises male and female genomic DNA.

7. The method of claim 1, wherein at least two regions on at least one locus within the Y chromosome do not overlap.

8. The method of claim 1, wherein at least two regions on at least one locus within the Y chromosome overlap.

9. The method of claim 8, wherein at least two overlapping regions on at least one locus within the Y chromosome are amplified using at least one common primer.

10. The method according to any one of the preceding claims, wherein the at least one locus within the Y chromosome is a single copy and / or multi-copy locus or at least one single copy locus and at least one multi-copy locus (MCL-Y) within the Y chromosome.

11. The method of claim 1, wherein the amplifying step further comprises amplifying an internal amplification control (IC).

12. The method of claim 1, wherein at least two amplified regions are located at at least two loci within the Y chromosome.

13. The method according to claim 12, wherein the at least two loci within the Y chromosome are single copy and / or multi-copy loci or at least one single copy locus and at least one multi-copy locus (MCL-Y) within the Y chromosome.

14. A method according to claim 1, wherein at least one locus within the Y chromosome is a multicopy locus (MCL-Y), wherein the locus has at least 85% sequence identity with a sequence according to SEQ ID NO. 3 or its reverse complement over a stretch of at least 60 base pairs (bp), or wherein the locus is amplifiable using a primer pair according to SEQ ID NO. 1 and SEQ ID NO 2 or its reverse complement.

15. A kit for performing the method according to any one of claims 1 to 14, wherein the kit comprises at least one primer selected from SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 13, SEQ ID NO 14 and / or SEQ ID NO 15 and / or their complementary sequences, and optionally at least one probe selected from SEQ ID NO 12 and / or SEQ ID NO 16 and / or their complementary sequences.

Images