Improved filamentous fungal host cells

Abstract

The present invention relates to an isolated variant Ire1 polypeptide comprising (a) an amino acid substitution at position 153 in a Trichoderma reesei Ire1 polypeptide of SEQ ID NO: 2; or (b) an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO: 2 and having at least 70% but less than 100% sequence identity to the amino acid sequence of SEQ ID NO: 2. The invention also relates to a recombinant filamentous fungal host cell comprising a mutant ire1 gene encoding the variant Ire1 polypeptide to produce a secreted heterologous polypeptide of interest, a method for producing a heterologous polypeptide of interest secreted in a recombinant filamentous fungal host cell, and a method of improving the productivity or yield of a heterologous polypeptide of interest secreted in a recombinant filamentous fungal host cell.

Description

[0001] This application is a divisional application of a Chinese patent application with an application date of November 26, 2019, an application number of 201980077510.X, and an invention title of "Improved Filamentous Fungal Host Cells".

[0002] Reference to the Sequence Listing

[0003] This application contains a sequence listing in computer-readable form, which is incorporated herein by reference. BACKGROUND OF THE INVENTION TECHNICAL FIELD

[0005] The present invention relates to a filamentous fungal host cell comprising a variant Ire1 polypeptide that improves the productivity and / or yield of a polypeptide of interest. BACKGROUND ART

[0006] Filamentous fungi can be used as host cells for the recombinant production of bioactive heterologous polypeptides, such as enzymes and other valuable proteins. In industrial and commercial applications, the protein productivity of such filamentous fungal host cells is an important factor in production costs.

[0007] The unfolded protein response transducer Ire1p promotes the secretion of heterologous proteins in yeast (Howard et al., 1995, J. Cell. Biochem. Suppl. [Supplement of Journal of Cellular Biochemistry] Vol. 19B, p. 209). Ire1p is an endoplasmic reticulum (ER) stress sensor in all eukaryotes and catalyzes the splicing of hac1 mRNA in yeast, bZIP60 in plants, and xbp1 in metazoans. Hac1 and its orthologs act as transcriptional activators for the transcription of unfolded protein response (UPR)-related genes, which play important roles not only in the efficient expression of endogenous proteins but also in the efficient expression of foreign or recombinant proteins.

[0008] WO 2018 / 015443 discloses a mutant Aspergillus niger ireA gene encoding a variant IreA polypeptide containing amino acid substitutions at positions 81 and 84.

[0009] There is a need in the art for alternatives to increase the secretion of heterologous proteins in filamentous fungal host cells.

[0010] The present invention provides a variant Ire1 polypeptide that increases the productivity and / or yield of a heterologous polypeptide of interest secreted by a filamentous fungal host cell. SUMMARY OF THE INVENTION

[0011] The present invention relates to an isolated variant Ire1 polypeptide comprising (a) an amino acid substitution at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and having at least 70% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0012] The present invention also relates to an isolated polynucleotide comprising a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and having at least 70% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0013] The present invention also relates to a recombinant filamentous fungal host cell comprising and expressing a first polynucleotide encoding a heterologous polypeptide of interest and a second polynucleotide comprising a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and having at least 70% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0014] The present invention also relates to a method for producing a secreted heterologous polypeptide of interest, the method comprising the steps of:

[0015] (a) culturing such a recombinant filamentous fungal host cell under conditions suitable for producing and secreting the heterologous polypeptide; and, optionally

[0016] (b) recovering the secreted heterologous polypeptide of interest.

[0017] The present invention further relates to a method for improving the productivity or yield of a secreted heterologous polypeptide of interest in a filamentous fungal host cell, the method comprising the steps of:

[0018] (a) providing a filamentous fungal host cell comprising and expressing an ire1 gene encoding an Ire1 polypeptide; and

[0019] (b) Mutate the ire1 gene to provide a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at the position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and has at least 70% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2, wherein the productivity or yield of the secreted heterologous polypeptide of interest is improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Shows the map of plasmid pJfyS207.

[0021] Figure 2 Shows the map of plasmid pSaMF123.

[0022] Figure 3 Shows the map of plasmid pSaMF128.

[0023] Figure 4 Shows the map of plasmid pAMFS210.

[0024] DEFINITIONS

[0025] For the purposes of this detailed description, the following definitions apply. Note that the singular forms "a / an" and "the" include plural referents unless the context clearly dictates otherwise.

[0026] References herein to "about" a value or parameter include aspects that pertain to the value or parameter itself. For example, a description of "about X" includes the aspect "X".

[0027] Unless otherwise defined or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0028] cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcribing a mature, spliced mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks the intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is the precursor of mRNA, which is processed through a series of steps (including splicing) and then presented as mature, spliced mRNA.

[0029] Coding sequence: The term "coding sequence" means a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of a coding sequence are typically determined by a reading frame that begins with a start codon (e.g., ATG, GTG, or TTG) and ends with a stop codon (e.g., TAA, TAG, or TGA). A coding sequence can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0030] Control sequence: The term "control sequence" means a nucleic acid sequence that is necessary for the expression of a polynucleotide encoding a polypeptide. Each control sequence can be native (i.e., from the same gene) or heterologous (i.e., from a different gene) to the polynucleotide encoding the polypeptide, or native or heterologous to each other. Such control sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, and a transcription terminator. At a minimum, the control sequence includes a promoter, and transcription and translation termination signals. For the purpose of introducing specific restriction sites that facilitate the ligation of the control sequences to the coding region of the polynucleotide encoding the polypeptide, these control sequences can be provided with multiple linkers.

[0031] Expression: The term "expression" means any step involved in the production of a polypeptide, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0032] Expression vector: The term "expression vector" means a linear or circular DNA molecule that contains a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.

[0033] Heterologous: For a host cell, the term "heterologous" means that a polypeptide or nucleic acid is not naturally present in the host cell. For a polypeptide or nucleic acid, the term "heterologous" means that a control sequence (e.g., a promoter or domain of a polypeptide or nucleic acid) is not naturally associated with the polypeptide or nucleic acid, i.e., the control sequence is from a gene other than the gene encoding the polypeptide.

[0034] Host cell: The term "host cell" means any microbial cell into which a nucleic acid construct or expression vector containing a polynucleotide has been introduced. Methods of introduction include, but are not limited to, protoplast fusion, transfection, transformation, electroporation, conjugation, and transduction. In some embodiments, the host cell is an isolated recombinant host cell that is partially or completely separated from at least one other component, including but not limited to, for example, a protein, a nucleic acid, a cell, etc.

[0035] Inositol-requiring enzyme 1 (Ire1): The term "inositol-requiring enzyme 1", "Ire1", or "Ire1 polypeptide" is a transmembrane protein kinase that acts as a sensor for misfolded proteins in the endoplasmic reticulum (ER) and triggers an intracellular signaling pathway called the unfolded protein response (UPR). The UPR is a conserved ER stress response from yeast to mammals and activates genes involved in the degradation of misfolded proteins, regulation of protein synthesis, and activation of molecular chaperones to restore ER homeostasis (Sidrauski et al., 1998, Trends Cell Biol. 8:245-249; Kauman, 1999, Genes Dev. 13:1211-1233; Welihinda et al., 1999, Gene Expr. 7:293-300). IRE1 contains: an ER lumen domain that is involved in the recognition of misfolded proteins; and a cytoplasmic endoribonuclease and kinase domain that is involved in the activation of downstream pathways (Sidrauski and Walther, 1997, Cell 90:1031-1039). Activated IRE1 specifically mediates the unconventional splicing and activation of the stress response transcription factor Hac1 in yeast and filamentous fungi, which in turn regulates the expression of ER chaperones and other target genes (Cox et al., 1993, Cell 73:1197-1206; Kawahara et al., 1997, Mol. Biol. Cell 8:1845-1862; Saloheimo et al., 2003, Mol. Microbiol. 47(4):1149-1161).

[0036] Isolated: The term "isolated" means a polypeptide, nucleic acid, cell, or other specific material or component that is separated from at least one other material or component with which it is naturally associated in nature (including but not limited to, for example, other proteins, nucleic acids, cells, etc.). Isolated polypeptides include but are not limited to culture broths containing secreted polypeptides.

[0037] Mature polypeptide: The term "mature polypeptide" means a polypeptide in its mature form after N-terminal processing (e.g., removal of the signal peptide).

[0038] Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature polypeptide.

[0039] Native: The term "native" means a nucleic acid or polypeptide that is naturally present in a host cell.

[0040] Nucleic acid construct: The term "nucleic acid construct" means a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene, modified to contain segments of nucleic acids in a manner not otherwise found in nature, or synthesized, and that contains one or more control sequences.

[0041] Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.

[0042] Recombinant: When used in reference to a cell, nucleic acid, protein, or vector, the term "recombinant" means that it has been modified from its natural state. Thus, for example, a recombinant cell expresses a gene not found in the natural (non-recombinant) form of the cell, or expresses a natural gene at a different level or under different conditions compared to that found in nature. A recombinant nucleic acid differs from the natural sequence in one or more nucleotides and / or is operably linked to a heterologous sequence (e.g., a heterologous promoter in an expression vector). A recombinant protein differs from the natural sequence in one or more amino acids and / or is fused to a heterologous sequence. A vector containing a nucleic acid encoding a polypeptide is a recombinant vector. The terms "recombinant" and "genetically modified" and "transgenic" are synonymous.

[0043] Sequence identity: The degree of relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity".

[0044] For the purposes of the present invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), as implemented in the Needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (preferably version 6.6.0 or later), is used to determine the sequence identity between two amino acid sequences as the output of "longest identity". The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. In order for the Needle program to report the longest identity, the non-simplified (nobrief) option must be specified on the command line. The output of the Needle-labeled "longest identity" is calculated as follows:

[0045] (Identical residues x 100) / (Alignment length - Total number of gaps in the alignment)

[0046] For the purposes of the present invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra), as implemented in the needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra) (preferably version 6.6.0 or later), is used to determine the sequence identity between two polynucleotide sequences as the output of "longest identity". The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. In order for the needle program to report the longest identity, the non-simplified (nobrief) option must be specified on the command line. The output of the "longest identity" marked by needle is calculated as follows:

[0047] (Identical deoxyribonucleotides x 100) / (Alignment length - Total number of gaps in the alignment)

[0048] Variant: The term "variant" means a polypeptide that is biologically active and contains engineered mutations (i.e., substitutions, insertions, and / or deletions (e.g., truncations)) at one or more (e.g., several) positions. Substitution means replacing the amino acid occupying a position with a different amino acid; deletion means removing the amino acid occupying a position; and insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.

[0049] Wild-type: The term "wild-type" with respect to an amino acid sequence or a nucleic acid sequence means that the amino acid sequence or nucleic acid sequence is a natural or naturally occurring sequence. As used herein, the term "naturally occurring" refers to any substance found in nature (e.g., a protein, amino acid, or nucleic acid sequence). In contrast, the term "non-naturally occurring" refers to any substance not found in nature (e.g., recombinant nucleic acid and protein sequences produced in the laboratory, or modifications of wild-type sequences).

[0050] Variant Naming Convention

[0051] For the purposes of the present invention, the Ire1 polypeptide disclosed in SEQ ID NO:2 is used to identify corresponding amino acid residues in another Ire1 polypeptide. The amino acid sequence of the other Ire1 polypeptide is aligned with the Ire1 polypeptide disclosed in SEQ ID NO:2, and based on this alignment, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (preferably version 5.0.0 or later), is used to determine the amino acid position numbers corresponding to any amino acid residues in the Ire1 polypeptide disclosed in SEQ ID NO:2. The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (the BLOSUM62 version of EMBOSS) substitution matrix.

[0052] The identification of corresponding amino acid residues in another Ire1 polypeptide can be determined by aligning multiple polypeptide sequences using several computer programs with their corresponding default parameters, including but not limited to MUSCLE (Multiple Sequence Comparison by Log-Expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32:1792-2797), MAFTT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30:3059-3066; Katoh et al., 2005, Nucleic Acids Research 33:511-518; Katoh and Toh, 2007, Bioinformatics 23:372-374; Katoh et al., 2009, Methods in Molecular Biology 537:39-64; Katoh and Toh, 2010, Bioinformatics 26:1899-1900), and EMBOSS EMMA using ClustalW (version 1.83 or later; Thompson et al., 1994, Nucleic Acids Research 22:4673-4680).

[0053] When another Ire1 polypeptide diverges from the Ire1 polypeptide of SEQ ID NO:2 such that traditional sequence-based comparison methods cannot detect their relationship (Lindahl and Elofsson, 2000, J. Mol. Biol. 295:613-615), other pairwise sequence comparison algorithms can be used. Higher sensitivity in sequence-based searches can be obtained using search programs that utilize the probabilistic representations (profiles) of polypeptide families to search databases. For example, the PSI-BLAST program generates multiple profiles through an iterative database search process and is able to detect distant homologs (Atschul et al., 1997, Nucleic Acids Res. 25:3389-3402). Even higher sensitivity can be achieved if the polypeptide family or superfamily has one or more representatives in the protein structure database. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287:797-815; McGuffin and Jones, 2003, Bioinformatics 19:874-881) utilize information from multiple sources (PSI-BLAST, secondary structure prediction, structure alignment profiles, and solvation potential) as input to a neural network that predicts the structural fold of a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313:903-919 can be used to align sequences of unknown structure to superfamily models present in the SCOP database. These alignments can then be used to generate homology models of the polypeptide, and the accuracy of such models can be evaluated using a variety of tools developed for that purpose.

[0054] For proteins of known structure, several tools and resources are available for retrieving and generating structure alignments. For example, the SCOP superfamilies of proteins have been structurally aligned, and those alignments are accessible and downloadable. Multiple algorithms such as the distance alignment matrix (Holm and Sander, 1998, Proteins 33:88-96) or combinatorial extension (Shindyalov and Bourne, 1998, Protein Engineering 11:739-747) can be used to align two or more protein structures, and the implementation of these algorithms can additionally be used to query a structure database with a structure of interest in order to find possible structural homologs (e.g., Holm and Park, 2000, Bioinformatics 16:566-567).

[0055] In describing variants of the present invention, for ease of reference, an adapted nomenclature for substitutions as described below is employed. Accepted IUPAC single-letter or three-letter amino acid abbreviations are used.

[0056] For amino acid substitutions, the following nomenclature is used: the original amino acid, the position, and the substituted amino acid. Accordingly, the substitution of alanine at position 153 by threonine is designated "Ala153Thr" or "A153T". Detailed Description

[0057] In one aspect, the present invention relates to an isolated variant Ire1 polypeptide comprising (a) an amino acid substitution at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0058] In another aspect, the present invention relates to an isolated polynucleotide comprising a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and having at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0059] In another aspect, the present invention relates to a method for improving the productivity or yield of a heterologous polypeptide of interest secreted in a filamentous fungal host cell, the method comprising the steps of:

[0060] (a) providing a filamentous fungal host cell that contains and expresses an ire1 gene encoding an Ire1 polypeptide; and

[0061] (b) Mutate the ire1 gene to provide a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2, wherein the productivity or yield of the secreted heterologous polypeptide of interest is improved.

[0062] In embodiments directed to each of the above aspects, the variant Ire1 polypeptide comprises or consists of an amino acid substitution at position 153 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2. The amino acid at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 is substituted with arginine (Arg), asparagine (Asn), aspartic acid (Asp), cysteine (Cys), glycine (Gly), glutamic acid (Glu), glutamine (Gln), histidine (His), isoleucine (Ile), leucine (Leu), lysine (Lys), methionine (Met), phenylalanine (Phe), proline (Pro), serine (Ser), threonine (Thr), tryptophan (Trp), tyrosine (Tyr), or valine (Val). In a preferred embodiment directed to each of the above aspects, the amino acid at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 is substituted with Thr. In another preferred embodiment directed to each of the above aspects, the amino acid at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 is Ala, which is substituted with Thr.

[0063] In another embodiment for each of the above aspects, the variant Ire1 polypeptide comprises or consists of an amino acid substitution at the position corresponding to position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2, and has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2. The amino acid at the position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 is replaced by Ala, Arg, Asn, Asp, Cys, Gly, Glu, Gln, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In a preferred embodiment for each of the above aspects, the amino acid at the position corresponding to position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 is replaced by Thr. In another preferred embodiment for each of the above aspects, the amino acid at the position corresponding to position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 is Ala, which is replaced by Thr.

[0064] In another embodiment for each of the above aspects, the variant Ire1 polypeptide further comprises Thr at position 150 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 or Thr at the position corresponding to position 150 in Trichoderma reesei Ire1 of SEQ ID NO:2.

[0065] In another embodiment for each of the above aspects, the nucleotide sequence of the mutant ire1 gene has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the Trichoderma reesei ire1 nucleotide sequence (shown in SEQ ID NO:1) or its cDNA sequence (shown in SEQ ID NO:3).

[0066] Examples herein demonstrate that Trichoderma reesei SaMF128 - 2A11 - 1 (ire1 Ala153Thr mutant) produces laccase from Polyporus pinsitus as a secreted heterologous polypeptide, wherein the productivity or yield of P. pinsitus laccase in Trichoderma reesei SaMF128 - 2A11 - 1 is significantly and unexpectedly increased by a single mutation in the ire1 gene resulting in the amino acid substitution Ala153Thr as compared to Trichoderma reesei FRT4New - 8G4A (native ire1).

[0067] Polypeptide of interest

[0068] The polypeptide of interest can be any secreted polypeptide that is heterologous (foreign) to the filamentous fungal host cell. The polypeptide can be encoded by a single gene or two or more genes. The term "polynucleotide encoding a polypeptide" should be understood to encompass one or more (several) genes involved in the production of the polypeptide. The term "heterologous polypeptide" is defined herein as a polypeptide that is not native to the filamentous fungal host cell; a native polypeptide that has been structurally modified to alter the native polypeptide (e.g., the protein sequence of the native polypeptide); or a native polypeptide whose expression has been quantitatively changed by manipulation of the polynucleotide or the host strain by recombinant DNA techniques (e.g., a stronger promoter, multiple copies of the DNA encoding the polypeptide). Thus, the scope of the term "heterologous polypeptide" in the present invention also encompasses the recombinant production of native polypeptides to the extent that such expression involves the use of genetic elements that are not native to the filamentous fungal host cell or the use of native elements that have been manipulated to act in a non - native manner in the host cell.

[0069] The polypeptide can be any polypeptide having the desired biological activity. The term "polypeptide" is not intended herein to refer to an encoded product of a specific length and thus encompasses peptides, oligopeptides, and proteins. The term "polypeptide" also encompasses two or more polypeptides that combine to form an encoded product. Polypeptides also include fusion polypeptides that contain a combination of partial or complete polypeptide sequences obtained from at least two different polypeptides, one or more (several) of which can be heterologous to the filamentous fungal host cell. Polypeptides further include naturally occurring allelic variations and engineered variations of the above - mentioned polypeptides and hybrid polypeptides.

[0070] In one embodiment, the polypeptide is an antibody, antigen, antimicrobial peptide, enzyme, growth factor, hormone, immunodilator, neurotransmitter, receptor, reporter protein, structural protein, or transcription factor.

[0071] In another embodiment, the polypeptide is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase.

[0072] In another embodiment, the polypeptide is acetylmannan esterase, acetylxylan esterase, aminopeptidase, α-amylase, arabinase, arabinofuranosidase, β-amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, coumaric acid esterase, cyclodextrin glycosyltransferase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, ferulic acid esterase, lytic polysaccharide monooxygenase, α-galactosidase, β-galactosidase, glucocerebrosidase, glucose oxidase, α-glucosidase, β-glucosidase, glucuronidase, glucuronate esterase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lysozyme, mannanase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, phenol oxidase, polyphenol oxidase, proteolytic enzyme, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase or β-xylosidase.

[0073] In another embodiment, the polypeptide is endoglucanase. In another embodiment, the polypeptide is cellobiohydrolase. In another embodiment, the polypeptide is β-glucosidase. In another embodiment, the polypeptide is a lytic polysaccharide monooxygenase (AA9 or GH61 polypeptide). In another embodiment, the polypeptide is xylanase. In another embodiment, the polypeptide is β-xylosidase. In another embodiment, the polypeptide is acetylxylan esterase. In another embodiment, the polypeptide is ferulic acid esterase. In another embodiment, the polypeptide is arabinofuranosidase. In another embodiment, the polypeptide is glucuronidase. In another embodiment, the polypeptide is acetylmannan esterase. In another embodiment, the polypeptide is arabinase. In another embodiment, the polypeptide is coumaric acid esterase. In another embodiment, the polypeptide is galactosidase. In another embodiment, the polypeptide is glucuronate esterase. In another embodiment, the polypeptide is mannanase. In another embodiment, the polypeptide is mannosidase. In another embodiment, the polypeptide is laccase. In another embodiment, the polypeptide is catalase.

[0074] Nucleic acid construct

[0075] The invention also relates to a nucleic acid construct comprising a polynucleotide of the invention (e.g., a polynucleotide encoding a secreted polypeptide of interest, or a polynucleotide comprising a mutated ire1 gene encoding a variant Ire1 polypeptide), wherein the polynucleotide is preferably operably linked to one or more control sequences which direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0076] A polynucleotide can be manipulated in many ways to provide for expression of a polypeptide. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide prior to insertion into the vector. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[0077] The control sequence may be a promoter, i.e., a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding the polypeptide of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the polypeptide. The promoter may be any polynucleotide that shows transcriptional activity in the host cell, including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides that are homologous or heterologous to the host cell.

[0078] Examples of suitable promoters for directing transcription of the nucleic acid constructs of the present invention in filamentous fungal host cells are promoters obtained from the genes: Aspergillus nidulans acetamidase, Aspergillus niger neutral α-amylase, Aspergillus niger acid stable α-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96 / 00787), Fusarium venenatum amyloglucosidase (WO 00 / 56900), Fusarium venenatum Daria (WO 00 / 56900), Fusarium venenatum Quinn (WO 00 / 56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei β-xylosidase, and Trichoderma reesei translation elongation factor, as well as the NA2-tpi promoter (a modified promoter from the Aspergillus neutral α-amylase gene in which the untranslated leader sequence has been replaced with an untranslated leader sequence from the Aspergillus triose phosphate isomerase gene; non-limiting examples include modified promoters from the Aspergillus niger neutral α-amylase gene in which the untranslated leader sequence has been replaced with an untranslated leader sequence from the Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and their mutant, truncated, and hybrid promoters. Other promoters are described in U.S. Patent No. 6,011,147.

[0079] The control sequence may also be a transcriptional terminator recognized by the host cell to terminate transcription. The terminator is operably linked to the 3'-end of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell can be used in the present invention.

[0080] Preferred terminators for filamentous fungal host cells are obtained from the genes of Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger α-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei β-xylosidase, and Trichoderma reesei translation elongation factor.

[0081] The control sequence may also be a leader sequence, i.e., an untranslated region of an mRNA that is important for translation in the host cell. The leader sequence is operably linked to the 5'-end of the polynucleotide encoding the polypeptide. Any leader sequence that is functional in the host cell can be used.

[0082] Preferred leader sequences for filamentous fungal host cells are obtained from the genes of Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0083] The control sequence may also be a polyadenylation sequence, a sequence that is operably linked to the 3'-end of the polynucleotide and that, when transcribed, is recognized by the host cell as a signal to add polyadenylate residues to the transcribed mRNA. Any polyadenylation sequence that is functional in the host cell can be used.

[0084] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes of Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger α-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

[0085] The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of the polypeptide and that directs the polypeptide into the secretory pathway of the cell. The 5'-end of the coding sequence of the polynucleotide may itself contain a signal peptide coding sequence that is naturally linked in the translation reading frame to the coding sequence segment encoding the polypeptide. Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding sequence that is heterologous to the coding sequence. In cases where the coding sequence does not naturally contain a signal peptide coding sequence, a heterologous signal peptide coding sequence may be required. Alternatively, the heterologous signal peptide coding sequence may simply replace the native signal peptide coding sequence in order to enhance the secretion of the polypeptide. However, any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of the host cell can be used.

[0086] An effective signal peptide coding sequence for a filamentous fungal host cell is a signal peptide coding sequence obtained from the gene of an enzyme such as Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.

[0087] The control sequence may also be a propeptide coding sequence encoding a propeptide located at the N-terminus of the polypeptide. The resulting polypeptide is referred to as a proenzyme or pro-polypeptide (or in some cases as a zymogen). The pro-polypeptide is usually inactive and can be converted into an active polypeptide by catalytic cleavage or autocatalytic cleavage of the propeptide from the pro-polypeptide. The propeptide coding sequence can be obtained from the genes such as Myceliophthora thermophila laccase (WO95 / 33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae α-factor.

[0088] In the case where both a signal peptide sequence and a propeptide sequence are present, the propeptide sequence is located immediately adjacent to the N-terminus of the polypeptide and the signal peptide sequence is located immediately adjacent to the N-terminus of the propeptide sequence.

[0089] It may also be desirable to add regulatory sequences that regulate the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory sequences are those that cause gene expression to be switched on or off in response to chemical or physical stimuli, including the presence of a regulatory compound. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA α-amylase promoter and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter can be used. Other examples of regulatory sequences are those that allow gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene amplified in the presence of methotrexate and the metallothionein gene amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide will be operably linked to the regulatory sequence.

[0090] Expression vector

[0091] The present invention also relates to recombinant expression vectors comprising the polynucleotides of the present invention (e.g., polynucleotides encoding secreted polypeptides of interest, or a second polynucleotide comprising a mutant ire1 gene encoding a variant Ire1 polypeptide), promoters, and transcriptional and translational termination signals. The various nucleotides and control sequences may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for the insertion or substitution of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. In producing the expression vector, the coding sequence is positioned in the vector such that the coding sequence is operably linked to the appropriate control sequences for expression.

[0092] The recombinant expression vector can be any vector (e.g., plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can cause the expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0093] The vector can be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, whose replication is independent of chromosomal replication, such as a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector can contain any means for ensuring self-replication. Alternatively, the vector can be a vector that integrates into the genome when introduced into the host cell and replicates with one or more chromosomes into which it has been integrated. In addition, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell can be used, or a transposon can be used.

[0094] The vector preferably contains one or more selectable markers that allow for convenient selection of transformed cells, transfected cells, transduced cells, etc. A selectable marker is a gene whose product provides biocide resistance, virus resistance, heavy metal resistance, prototrophy for auxotrophs, etc.

[0095] Selectable markers for use in filamentous fungal host cells include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosyl-aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), fcyA (cytosine deaminase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenylyltransferase), and trpC (anthranilate synthase) together with their equivalents. Preferred for use in Aspergillus cells are the Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and the Streptomyces hygroscopicus bar gene. Preferred for use in Trichoderma cells are the adeA, adeB, amdS, fcyA, hph, and pyrG genes.

[0096] The selectable marker can be a dual selectable marker system as described in WO 2010 / 039889. In one embodiment, the dual selectable marker is the hph-tk dual selectable marker system.

[0097] The vector preferably contains one or more elements that permit the vector to integrate into the genome of the host cell or to replicate autonomously in the cell independent of the genome.

[0098] For integration into the genome of the host cell, the vector can rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector can contain additional polynucleotides for directing integration into one or more precise positions in one or more chromosomes of the host cell genome by homologous recombination. To increase the likelihood of integration at a precise position, the integration element should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity with the corresponding target sequence to enhance the probability of homologous recombination. The integration element can be any sequence homologous to the target sequence within the host cell genome. In addition, the integration element can be a non-coding or coding polynucleotide. On the other hand, the vector can integrate into the genome of the host cell by non-homologous recombination.

[0099] For autonomous replication, the vector can further contain an origin of replication that enables the vector to replicate autonomously in the host cell under discussion. The origin of replication can be any plasmid replicon that functions in the cell to mediate autonomous replication. The term "origin of replication" or "plasmid replicon" refers to a polynucleotide that enables a plasmid or vector to replicate in vivo.

[0100] Examples of origins of replication useful in filamentous fungal cells are AMA1 and ANS1 (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic Acids Res. 15:9163-9175; WO00 / 24883). Isolation of the AMA1 gene and construction of plasmids or vectors containing this gene can be accomplished according to the methods disclosed in WO 00 / 24883.

[0101] More than one copy of the polynucleotide of the present invention can be inserted into a host cell to increase the production of the polypeptide. An increased copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene together with the polynucleotide, wherein cells containing the amplified copy of the selectable marker gene and thereby additional copies of the polynucleotide can be selected by culturing the cells in the presence of an appropriate selective reagent.

[0102] Procedures for ligating the above-described elements to construct the recombinant expression vectors of the present invention are well known to those of ordinary skill in the art (see, for example, Sambrook et al., 1989, ibid.).

[0103] Filamentous fungal host cell

[0104] In another aspect, the present invention relates to a recombinant filamentous fungal host cell comprising and expressing a first polynucleotide encoding a heterologous polypeptide of interest and a second polynucleotide comprising a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at the position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity to the amino acid sequence of SEQ ID NO:2.

[0105] In some embodiments, the recombinant host cell contains at least two copies of the polynucleotide of the present invention, such as three, four, or five.

[0106] The host cell can be any filamentous fungal cell. "Filamentous fungi" includes all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth occurs by hyphal elongation, and carbon catabolism is obligately aerobic.

[0107] The filamentous fungal host cell can be a cell of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma.

[0108] For example, the filamentous fungal host cell may be Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bacilliforme, Fusarium cerealis, Fusarium culmorum, Fusarium cultratum, Fusarium graminearum, Fusarium graminearum f. sp. cerealis, Fusarium heterosporum, Fusarium leuceanae, Fusarium oxysporum, Fusarium proliferatum, Fusarium roseum, Fusarium sambucinum, Fusarium solani, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Talaromyces emersonii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei or Trichoderma viride cell.

[0109] In a preferred embodiment, the filamentous fungal host cell is a Trichoderma cell.

[0110] In a more preferred embodiment, the Trichoderma cell is a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.

[0111] In a most preferred embodiment, the Trichoderma cell is a Trichoderma harzianum cell. In a most preferred embodiment, the Trichoderma cell is a Trichoderma koningii cell. In a most preferred embodiment, the Trichoderma cell is a Trichoderma longibrachiatum cell. In a most preferred embodiment, the Trichoderma cell is a Trichoderma reesei cell. In a most preferred embodiment, the Trichoderma cell is a Trichoderma viride cell.

[0112] The fungal cells can be transformed in a manner known per se by methods involving protoplast formation, protoplast transformation, and cell wall regeneration. Suitable procedures for transforming Aspergillus and Trichoderma host cells are described in the following references: EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81:1470-1474 and Christensen et al., 1988, Bio / Technology 6:1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78:147-156 and WO 96 / 00787.

[0113] Production method

[0114] The present invention also relates to a method for producing a secreted heterologous polypeptide of interest, the method comprising the steps of:

[0115] (a) culturing the filamentous fungal host cell of the present invention under conditions suitable for producing and secreting the heterologous polypeptide; and, optionally

[0116] (b) recovering the secreted heterologous polypeptide of interest.

[0117] The host cells are cultured in a nutrient medium suitable for producing polypeptides using methods known in the art. For example, the cells can be cultured by shake flask culture, or by small-scale or large-scale fermentation (including continuous, batch, fed-batch or solid state fermentation) in a laboratory or industrial fermentor, the culture being carried out in a suitable medium and under conditions permitting expression and / or isolation of the polypeptide. Using procedures known in the art, the culture takes place in a suitable nutrient medium containing a carbon and nitrogen source and inorganic salts. Suitable media are available from commercial suppliers or can be prepared according to published compositions (e.g., in the catalog of the American Type Culture Collection).

[0118] Polypeptides can be detected using methods known in the art that are specific for polypeptides. These detection methods include, but are not limited to: the use of specific antibodies, the formation of enzyme products, or the disappearance of enzyme substrates. For example, enzyme assays can be used to determine the activity of polypeptides.

[0119] Polypeptides can be recovered using methods known in the art. For example, polypeptides can be recovered from a fermentation broth by conventional methods including, but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. In one embodiment, the whole fermentation broth containing the polypeptide is recovered.

[0120] The polypeptide can be purified by a variety of procedures known in the art, including but not limited to chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic chromatography, focusing chromatography, and size exclusion chromatography), electrophoretic procedures (e.g., preparative isoelectric focusing electrophoresis), differential precipitation (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, edited by Janson and Ryden, VCH Publishers, New York, 1989), in order to obtain a substantially pure polypeptide.

[0121] The present invention is further described by the following examples, which should not be construed as limiting the scope of the invention.

[0122] Examples

[0123] Strains

[0124] Trichoderma reesei BTR213 is described in WO 2013 / 086633.

[0125] Trichoderma reesei strain FRT4New-8G4A is a Trichoderma reesei BTR213 strain in which ku70 is disrupted and the parasporal synthase (parS) gene is deleted, and which has FRT sites (FRT-F and FRT-F3) inserted at each of these four loci for site-specific targeted integration of expression cassettes using the Saccharomyces cerevisiae flippase (FLP) and the flippase recognition sequences FRT-F and FRT-F3, as described in WO 2012 / 160093 and US 2018 / 0037897. The Aspergillus niger cytosine deaminase (fcyA) gene is inserted between the FRT-F and FRT-F3 sites at each of the four loci for use as a counter-selection against 5-fluorocytosine (5FC).

[0126] Media and Solutions

[0127] The CIM medium consists of: 20 g of cellulose, 10 g of corn steep liquor solids, 1.45 g of (NH 4 )2 SO 4 、 2.08 g of KH 2 PO 4 、 0.28 g of CaCl 2 、 0.42 g of MgSO 4 ·7H 2 O, 0.42 ml of Trichoderma trace metal solution, 1 to 2 drops of antifoaming agent, and deionized water to make up to 1 liter, pH adjusted to 6.0. The Trichoderma trace metal solution consists of: 216 g of FeCl 3 ·6H 2 O, 58 g of ZnSO 4 ·7H 2 O, 27 g of MnSO 4 ·H 2 O, 10 g of CuSO 4 ·5H 2 O, 2.4 g of H 3 BO 3 、 336 g of citric acid, and deionized water to make up to 1 liter.

[0128] The COVE plate consists of: 342.30 g of sucrose, 25 g of Noble agar, 20 ml of COVE salt solution, 10 mM acetamide, 15 mM cesium chloride, and deionized water to make up to 1 liter.

[0129] The COVE2 plate consists of: 30 g of sucrose, 20 ml of COVE salt solution, 10 ml of 1M acetamide, 25 g of Noble agar, and deionized water to make up to 1 liter.

[0130] The COVE salt solution consists of: 26 g of KCl, 26 g of MgSO 4 ·7H 2 O, 76 g of KH 2 PO 4 、 50 ml of COVE trace metal solution, and deionized water to make up to 1 liter.

[0131] The COVE trace metal solution consists of: 0.04 g of Na 2 B 4 O 7 ·10H 2 O, 0.4 g of CuSO 4 ·5H 2 O, 1.2 g of FeSO 4 ·7H 2 O, 0.7 g of MnSO 4 ·H 2 O, 0.8 g of Na 2MoO 2 ·2H 2 O, 10 g of ZnSO 4 ·7H 2 O, and deionized water to make up to 1 liter.

[0132] The fermentation batch medium consists of: 24 g of dextrose, 40 g of soybean meal, 8 g of (NH 4 ) 2 SO 4 , 3 g of K 2 HPO 4 , 8 g of K 2 SO 4 , 3 g of CaCO 3 , 8 g of MgSO 4 ·7H 2 O, 1 g of citric acid, 8.8 ml of 85% phosphoric acid, 1 ml of antifoaming agent, 14.7 ml of trace metal solution, and deionized water to make up to 1 liter. The trace metal solution consists of: 26.1 g of FeSO 4 ·7H 2 O, 5.5 g of ZnSO 4 ·7H 2 , 6.6 g of MnSO 4 ·H 2 O, 2.6 g of CuSO 4 ·5H 2 O, 2 g of citric acid, and deionized water to make up to 1 liter.

[0133] The LB + Amp medium consists of: 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, 50 mg of ampicillin (filtered sterilized and added after autoclaving), and deionized water to make up to 1 liter.

[0134] The PDA plate consists of: 39 g of potato dextrose agar (Difco), and deionized water to make up to 1 liter. The solution is sterilized by autoclaving.

[0135] The PEG buffer consists of: 50% polyethylene glycol (PEG) 4000 in deionized water, 10 mM Tris - HCl (pH 7.5) and 10 mM CaCl 2 .

[0136] The shake - flask medium consists of: 20 g of glycerol, 10 g of soybean meal, 1.5 g of (NH 4 ) 2 SO 4 , 2 g of KH 2PO 4 and 0.2 g of CaCl 2 , 0.4 g of MgSO 4 ·7H 2 O, 0.2 ml of trace metal solution, and deionized water to make up 1 liter. The trace metal solution consists of: 26.1 g of FeSO 4 ·7H 2 O, 5.5 g of ZnSO 4 ·7H 2 O, 6.6 g of MnSO 4 ·H 2 O, 2.6 g of CuSO 4 ·5H 2 O, 2 g of citric acid, and deionized water to make up 1 liter.

[0137] SOC medium consists of: 20 g of tryptone, 5 g of yeast extract, 0.5 g of NaCl, 10 ml of 250 mM KCl, and deionized water to make up 1 liter.

[0138] STC consists of: 1 M sorbitol in deionized water, 10 mM Tris (pH 7.5) and 10 mM CaCl 2 .

[0139] TAE buffer consists of: 4.84 g of Tris base, 1.14 ml of glacial acetic acid, 2 ml of 0.5 M EDTA (pH 8.0), and deionized water to make up 1 liter.

[0140] TBE buffer consists of: 10.8 g of Tris base, 5 g of boric acid, 4 ml of 0.5 M EDTA (pH 8), and deionized water to make up 1 liter.

[0141] Trichoderma minimal medium (TrMM) plates consist of: 30 g of sucrose, 20 ml of COVE salt solution, 0.6 g of CaCl 2 .2H 2 O, 6 g of (NH 4 ) 2 SO 4 , 25 g of Noble agar, and deionized water to make up 1 liter.

[0142] 2XYT + Amp plates consist of: 16 g of tryptone, 10 g of yeast extract, 5 g of NaCl, 15 g of bacteriological agar (Bacto agar), 1 ml of ampicillin (100 mg / ml), and deionized water to make up 1 liter.

[0143] YP medium is composed of 1% yeast extract and 2% peptone in deionized water.

[0144] Example 1: Extracting genomic DNA from Trichoderma reesei

[0145] These Trichoderma reesei were grown in 50 ml of YP medium supplemented with 2% glucose (w / v) in a 250 ml baffled shake flask at 28 °C with stirring at 200 rpm for 2 days. Using a funnel (EMD Chemicals Inc.) to collect the mycelium from the culture, squeezing and drying it, and then transferring it to a pre-chilled mortar and pestle. Each mycelium preparation was ground into a fine powder and kept frozen with liquid nitrogen. A total of 1 - 2 grams of the powder was transferred to a 50 ml tube, and genomic DNA was extracted from the ground mycelium powder using the Plant Maxi Kit (QIAGEN Inc.). 5 ml of AP1 buffer (QIAGEN Inc.) pre-warmed to 65 °C was added to the 50 ml tube, followed by 10 μl of RNase A 100 mg / ml stock solution (QIAGEN Inc.), and incubated at 65 °C for 2 - 3 hours. A total of 1.8 ml of AP2 buffer (QIAGEN Inc.) was added and centrifuged at 3000 - 5000 x g for 5 minutes. The supernatant was decanted into a QIAshredder large nucleic acid purification column (QIAGEN Inc.) placed in a 50 ml collection tube, and centrifuged at 3000 - 5000 x g for 5 minutes in a swing-out rotor at room temperature (15 °C - 25 °C). The flow-through liquid in the collection tube was transferred to a new 50 ml tube without disturbing the precipitate. 1.5 ml volume of AP3 / E buffer (QIAGEN Inc.) was added to the clarified lysate and immediately mixed by vortexing. The sample (up to 15 ml) including any precipitate that may have formed was pipetted into a large nucleic acid purification column (QIAGEN Inc.) placed in a 50 ml collection tube, and centrifuged at 3000 - 5000 x g for 5 minutes in a swing-out rotor at room temperature (15 °C - 20 °C). The flow-through liquid was discarded. 12 ml of AW buffer (QIAGEN Inc.) was added to the large nucleic acid purification column and centrifuged at 3000 - 5000 x g for 10 minutes to dry the membrane. The flow-through liquid and the collection tube were discarded. The large nucleic acid purification column was transferred to a new 50 ml tube. 0.5 ml of AE buffer (QIAGEN Inc.) pre-warmed to 65 °C was directly pipetted into the In the large nucleic acid purification column membrane, incubate for 5 minutes at room temperature (15°C - 25°C), and then centrifuge at 3000 - 5000 x g for 5 minutes to elute genomic DNA. The concentration and purity of genomic DNA are determined by measuring absorbance at 260 nm and 280 nm.

[0146] Example 2: Production and Transformation of Trichoderma reesei Protoplasts

[0147] The preparation and transformation of Trichoderma reesei protoplasts were carried out using a protocol similar to that of Penttila et al., 1987, Gene 61: 155 - 164. Briefly, Trichoderma reesei was cultured in 25 ml of YP medium supplemented with 2% (w / v) glucose and 10 mM uridine at 27°C with gentle stirring at 90 rpm for 17 hours. The mycelia were collected by filtering through a vacuum-driven disposable filtration system (Millipore), and washed twice with deionized water and twice with 1.2 M sorbitol. The washed mycelia were suspended in 100 ml of 1.2 M sorbitol containing 5 mg / ml of YATALASE TM enzyme (Takara Bio USA, Inc.) and 0.36 units of chitinase (Sigma Chemical Co., Ltd.) / ml for 60 - 75 minutes at 34°C with gentle shaking at 90 rpm to generate protoplasts. The protoplasts were collected by centrifuging at 834 x g for 7 minutes and washed twice with cold 1.2 M sorbitol. The protoplasts were counted using a hemocytometer and resuspended to a final concentration of 1 x 10 8 protoplasts / ml of STC.

[0148] Approximately 1 - 10 μg of DNA was added to 100 μl of the protoplast solution and gently mixed. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. Then STC (3 ml) was added, and the reaction was mixed and then plated on COVE plates for amdS selection. The plates were incubated at 30°C for 6 - 11 days.

[0149] Example 3: Construction of Plasmid pJfyS207

[0150] Plasmid pJfyS207 contains the Aspergillus nidulans acetamidase (amdS) gene as a selectable marker, and the human herpes simplex virus 1 thymidine kinase gene (HSV-1tk) gene flanked by 234 bp Fusarium verticillioides pyrG repeats to facilitate marker excision.

[0151] The following primers were used to generate a PCR fragment containing the Aspergillus nidulans acetamidase (amdS) gene:

[0152] Forward primer 1213884:

[0153] AAAGACAAGGCCTAGTTGGAGTATTTGGAAACGCAACCCT GAAGG(SEQ ID NO:4)

[0154] Reverse primer 1213885:

[0155] AGTAGTCGGCCAAGGGCGAATTCTCTACGCCAGGACCGAG CAA(SEQ ID NO:5)

[0156] The PCR consisted of: 10 ng of pMJ09 (WO 2005 / 056772), 10 mM dNTP, 50 pmol of forward primer 1213884, 50 pmol of reverse primer 1213885, 1X HF buffer (Thermo Fisher Scientific, Inc.), and 2.5 units of Hot Start DNA polymerase (Thermo Fisher Scientific), with a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 30 cycles, each at 95 °C for 20 seconds, 57 °C for 20 seconds, and 72 °C for 2 minutes; 1 cycle at 72 °C for 2 minutes; and held at 10 °C. The resulting 2766 bp PCR fragment was purified by electrophoresis on a 0.9% agarose gel in TBE buffer, excised from the gel, and extracted using a Gel and PCR Clean-up Kit (Macherey Nagel).

[0157] The following primers were used to generate a PCR fragment containing the 234 bp Fusarium fujikuroi pyrG gene:

[0158] Forward primer 1213882:

[0159] GGCCTTTTGCTCACATGGTTTAAACGGCGCGCCCGACAAAA CAAGGCTACTGCAGGCA(SEQ IDNO:6)

[0160] Reverse primer 1213883:

[0161] AATACTCCAACTAGGCCTTGTCTTT(SEQ ID NO:7)

[0162] PCR consisted of 10 ng of pJfyS1579-41-11 (WO 2011 / 075677), 10 mM dNTP, 50 pmol of forward primer 1213882, 50 pmol of reverse primer 1213883, 1X HF buffer, and 2.5 units of hot start DNA polymerase, with a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle for 2 minutes at 98 °C; 30 cycles, each for 20 seconds at 95 °C, 20 seconds at 57 °C, and 40 seconds at 72 °C; 1 cycle for 2 minutes at 72 °C; and held at 10 °C. The resulting 250 bp PCR fragment was purified by electrophoresis on a 0.9% agarose gel in TBE buffer, excised from the gel, and extracted using a gel and PCR clean-up kit.

[0163] Using hot start DNA polymerase and the DNA fragment-specific forward and reverse primers shown below, splicing was performed by overlap extension (SOE) PCR to generate a single DNA fragment from the above individual PCR products.

[0164] Forward primer 1213882:

[0165] GGCCTTTTGCTCACATGGTTTAAACGGCGCGCCCGACAAAA CAAGGCTACTGCAGGCA (SEQ ID NO:8)

[0166] Reverse primer 1213885:

[0167] AGTAGTCGGCCAAGGGCGAATTCTCTACGCCAGGACCGAGCAA (SEQ ID NO:9)

[0168] SOE PCR consisted of 1 μl of each of the above gel-purified PCR products, 10 mM dNTP, 10 pmol of forward primer 1213882, 10 pmol of reverse primer 1213885, 1X HF buffer, and 2.5 units of Hot start DNA polymerase, with a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 95 °C for 20 seconds, 57 °C for 20 seconds, and 72 °C for 2 minutes; 1 cycle at 72 °C for 2 minutes; and held at 10 °C. The resulting 2991 bp PCR fragment was purified by electrophoresis on a 1% agarose gel in TBE buffer, excised from the gel, and extracted using a Gel and PCR Clean-up Kit.

[0169] Using the IN- HD Cloning Kit (Clontech Laboratories Inc.), the 2991 bp DNA fragment was inserted into Eco RI and Asc I digested pJfyS1579-41-11 (WO 2011 / 075677). The reaction consisted of Eco RI and Asc I digested pJfyS1579-41-11 in a 10 μl reaction volume, 75 ng of the 2991 bp SOE PCR fragment, and 1X IN- HD Enzyme Premix. After incubating the mixture at 50 °C for 15 minutes, 2 μl of the reaction was transformed into 50 μl of STELLAR TM chemically competent E. coli cells (Clontech Laboratories). The cells were heat shocked at 42 °C for 45 seconds, then 100 μl of SOC medium was added, and the total volume was plated on a 150 mm 2XYT + Amp plate and incubated overnight at 37 °C. The resulting E. coli transformants were individually inoculated into 3 ml of LB + Amp medium in 14 ml round-bottom polypropylene tubes and incubated overnight at 37 °C with shaking at 200 rpm. Plasmid DNA was isolated using 9600 (Qiagen). Insertion was confirmed by DNA sequencing using dye-terminator chemistry (Giesecke et al., 1992, J. Virol. Methods [Journal of Virological Methods] 38:47-60) with a Model 377XL automated DNA sequencer (Applied Biosystems Inc.). One transformant was identified as containing an insertion free of PCR errors, and the plasmid was designated pJfyS207( Figure 1 ).

[0170] Example 4: Construction of pSaMF128 for integration of the Ala153Thr mutation in the Trichoderma reesei ire1 gene

[0171] Construct plasmid pSaMF128 to integrate a single nucleotide mutation into the native ire1 gene of Trichoderma reesei FRT4New-8G4A strain (SEQ ID NO:1 for genomic DNA sequence, SEQ ID NO:2 for deduced amino acid sequence, and SEQ ID NO:3 for cDNA sequence), thereby causing the amino acid change Ala153Thr. Plasmid pSaMF128 contains the Trichoderma reesei ire1 promoter region (5' flank), the Trichoderma reesei ire1 mutant gene (Ala153Thr), and a 200 bp Trichoderma reesei ire1 terminator region (3' flank repeat), followed by the Aspergillus nidulans acetamidase (amdS) gene and the human herpes simplex virus 1 thymidine kinase gene (HSV-1tk). The amdS and HSV-1tk genes are located between the 3' flank repeat region of the ire1 gene (as above) and the 1500 bp 3' flank region of the ire1 gene. Plasmid pSaMF128 was constructed as described below.

[0172] Initially, plasmid pSaMF123 was constructed as a derivative of plasmid pJfyS207 (Example 3), in which the amdS gene and the HSV-1tk gene are located between 234 bp Fusarium venenatum pyrG repeats.

[0173] The following primers were used to generate a PCR product (DNA fragment 1) that contains the 5' flank region of the Trichoderma reesei ire1 gene and a part of the ire1 gene introducing the Ala153Thr mutation, and contains the 3' flank region of the Trichoderma reesei ire1 gene:

[0174] DNA fragment 1:

[0175] Forward primer:

[0176] CACATGGTTTAAACGGCGCGCCCGTCTGGTCCTCTCTTTTGT (SEQ ID NO:10)

[0177] Reverse primer:

[0178] TGTGGTGTTCGGACGGTCTGAGCCGGAGCTAAAGTTGCGA (SEQ ID NO:11)

[0179] DNA fragment 1 was PCR amplified in a reaction consisting of: approximately 75 ng of Trichoderma reesei BTR21 genomic DNA, 10 μl of 10 mM dNTP, 50 pmol of the forward primer, 50 pmol of the reverse primer, 1X HF buffer, and 2 units of Hot start DNA polymerase, with a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 2.5 minutes; 1 cycle at 72 °C for 10 minutes; and held at 10 °C. The resulting 3,570 bp PCR fragment was purified by electrophoresis on a 0.8% agarose gel in TBE buffer, excised from the gel, and extracted using a gel and PCR clean-up kit.

[0180] PCR products (Fragment 2) were generated using the following primers, which contain a portion of the Trichoderma reesei ire1 gene introducing the Ala153Thr mutation and a 200 bp 3'-flanking region of the ire1 gene:

[0181] DNA fragment 2;

[0182] Forward primer:

[0183] CAGACCGTCCGAACACCACACACCTCACGACATCACTGGC (SEQ ID NO:12)

[0184] Reverse primer:

[0185] CCCTTCAGGGTTGCGTTTCCACAACAGAAGCTGAAACAATT (SEQ ID NO:13)

[0186] DNA fragment 2 was PCR amplified in a reaction consisting of approximately 75 ng of Trichoderma reesei BTR213 genomic DNA, 10 mM dNTP, 50 pmol of forward primer, 50 pmol of reverse primer, 1X HF buffer, and 2 units of hot start DNA polymerase, with a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 2.5 minutes; 1 cycle at 72 °C for 10 minutes; and held at 10 °C. The resulting 3,570 bp PCR fragment was purified by electrophoresis on a 0.8% agarose gel in TBE buffer, excised from the gel, and extracted using a gel and PCR clean-up kit.

[0187] PCR products (Fragment 3) were generated using the following primers, which contain the 3'-flanking region of the Trichoderma reesei ire1 gene:

[0188] DNA Fragment 3:

[0189] Forward primer:

[0190] CTTCCTTGAACTCTCAGATCTCCCGGGAAGAAAGAAAAGG AAGAGAA(SEQ ID NO:14)

[0191] Reverse primer:

[0192] CCATATTTAAATCCTGCAGGCTCGACATATCGCCAGGGAG(SEQ ID NO:15)

[0193] DNA Fragment 3 was amplified by PCR in a reaction consisting of approximately 75 ng of Trichoderma reesei BTR213 genomic DNA, 10 mM dNTP, 50 pmol of forward primer, 50 pmol of reverse primer, 1X HF buffer, and 2 units of hot-start DNA polymerase, with a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 98 °C for 10 seconds, 60 °C for 30 seconds, and 72 °C for 1 minute; 1 cycle at 72 °C for 10 minutes; and hold at 10 °C for 30 seconds and at 72 °C for 3 minutes; 1 cycle at 72 °C for 10 minutes; and hold at 10 °C. The resulting 1,547-bp PCR fragment was purified by electrophoresis on a 0.8% agarose gel in TBE buffer, excised from the gel, and extracted using a gel and PCR clean-up kit.

[0194] PCR products (DNA Fragment 4) containing the amdS gene and the HSV-1 tk gene were generated from plasmid pJfyS207 using the following primers:

[0195] DNA Fragment 4:

[0196] Forward primer:

[0197] AATTGTTTCAGCTTCTGTTGTGGAAACGCAACCCTGAAGG(SEQ ID NO:16)

[0198] Reverse primer:

[0199] TCTTTCTTCCCGGGAGATCTGAGAGTTCAAGGAAGAAACA(SEQ ID NO:17)

[0200] DNA fragment 4 was amplified by PCR in a reaction consisting of approximately 75 ng of plasmid pJfyS207 DNA, 10 mM dNTP, 50 pmol of forward primer, 50 pmol of reverse primer, 1X HF buffer, and 2 units of hot start DNA polymerase, in a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 2.5 minutes; 1 cycle at 72 °C for 10 minutes; and hold at 10 °C. The resulting 3,201 bp PCR fragment was purified by electrophoresis on a 0.8% agarose gel in TBE buffer, excised from the gel, and extracted using a Gel and PCR Clean-up Kit.

[0201] The following primers were used to generate a PCR product (DNA fragment 5) from pJfyS207, which contains the Escherichia coli origin of replication and the ampicillin resistance marker:

[0202] DNA fragment 5:

[0203] Forward primer:

[0204] CTCCCTGGCGATATGTCGAGCCTGCAGGATTTAAATATGGC (SEQ ID NO:18)

[0205] Reverse primer:

[0206] CAAAAGAGAGGACCAGACGGGCGCGCCGTTTAAACCATGT GAGCA (SEQ ID NO:19)

[0207] DNA fragment 5 was amplified by PCR in a reaction consisting of approximately 75 ng of plasmid pJfyS207 DNA, 10 mM dNTP, 50 pmol of forward primer, 50 pmol of reverse primer, 1X HF buffer, and 2 units of hot start DNA polymerase, in a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 2.5 minutes; 1 cycle at 72 °C for 10 minutes; and hold at 10 °C. The resulting 3,201 bp PCR fragment was purified by electrophoresis on a 0.8% agarose gel in TBE buffer, excised from the gel, and extracted using Extraction was performed using a gel and a PCR clean-up kit.

[0208] Using according to the manufacturer's instructions, the HiFi DNA Assembly Cloning Kit (New England Biolabs) was used to ligate DNA fragments 1 - 5 together. The reaction was carried out at 50 °C for 60 minutes, frozen at -20 °C, and then incubated at room temperature for 48 hours. 1 μl of the reaction mixture was transformed into STELLAR TM chemically competent Escherichia coli cells. The transformants were plated on 2XYT + Amp plates and incubated overnight at 37 °C. Using the Spin Miniprep Kit (Qiagen), plasmid DNA was purified from several transformants. Appropriately ligated plasmid DNA was screened by restriction digestion with Xba I, Nru I, and Xho I, followed by agarose gel electrophoresis in 0.8% agarose gel in TBE buffer. A plasmid was identified and designated pSaMF123 ( Figure 2 ).

[0209] As described below, DNA fragments 1 and 2 were PCR amplified from plasmid pSaMF123 in reactions consisting of: approximately 115 ng of plasmid pSaMF123 DNA, 10 mM dNTP, 50 pmol of forward primer, 50 pmol of reverse primer, 1X HF buffer, and 2 units of hot start DNA polymerase, with a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 2 minutes; 1 cycle at 72 °C for 10 minutes; and held at 10 °C.

[0210] DNA fragment 1: A PCR product was generated using the following primers, which contained a partial 5' flanking region of the Trichoderma reesei ire1 gene and a part of the ire1 gene introducing the Ala153Thr mutation:

[0211] Forward primer:

[0212] AAGCGGTTTCCGTTGCCTTCGAATTCGACAGAGCTGCGA (SEQ ID NO:20)

[0213] Reverse primer:

[0214] TGTGGTGTTCGGACGGGCTGAGCCGGAGCTAAAGTTGCGA(SEQ ID NO:21)

[0215] DNA fragment 1 was amplified by PCR in a reaction consisting of approximately 115 ng of plasmid pSaMF123 DNA, 10 μl of 10 mM dNTP, 50 pmol of forward primer, 50 pmol of reverse primer, 1X HF buffer, and 2 units of hot start DNA polymerase, with a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle for 2 minutes at 98 °C; 35 cycles, each for 10 seconds at 98 °C, 30 seconds at 65 °C, and 2 minutes at 72 °C; 1 cycle for 10 minutes at 72 °C; and held at 10 °C. The resulting 792 bp PCR fragment was purified by electrophoresis on a 0.8% agarose gel in TBE buffer, excised from the gel, and extracted using a Gel and PCR Clean-up Kit.

[0216] DNA fragment 2; a PCR product was generated using the following primers, which contained a portion of the Trichoderma reesei ire1 gene with the Ala153Thr mutation extended to the Bst BI site:

[0217] Forward primer:

[0218] CAGCCCGTCCGAACACCACACACCTCACGACATCACTGGC(SEQ ID NO:22)

[0219] Reverse primer:

[0220] AGATTGTAGTTGCCCTTTCGAATGTTCACCTCCCGCATAT(SEQ ID NO:23)

[0221] DNA fragment 2 was amplified by PCR in a reaction consisting of approximately 115 ng of plasmid pSaMF123 DNA, 10 μl of 10 mM dNTP, 50 pmol of forward primer, 50 pmol of reverse primer, 1X HF buffer, and 2 units of Hot start DNA polymerase was used with a final volume of 50 μl. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 2 minutes; 1 cycle at 72 °C for 10 minutes; and hold at 10 °C. The resulting 2,811 bp PCR fragment was purified by electrophoresis on a 0.8% agarose gel in TBE buffer, excised from the gel, and extracted using a Gel and PCR Clean-up Kit.

[0222] Plasmid pSaMF123 was digested with Bst BI and purified by electrophoresis on a 0.8% agarose gel in TAE buffer, where the 11,809 bp fragment was excised from the gel and extracted using a Gel and PCR Clean-up Kit. According to the manufacturer's instructions, the 11,809 bp fragment was ligated to the 792 bp and 2,811 bp PCR fragments using the IN-FUSION TM HD Cloning Kit. The reaction was carried out at 50 °C for 15 minutes. 1 μl of the reaction mixture was transformed into STELLAR TM chemically competent Escherichia coli cells. The transformants were spread on 2XYT + Amp plates and incubated overnight at 37 °C. Plasmid DNA was purified from several transformants using a Spin Miniprep Kit. Plasmid DNA from several clones was sequenced by next-generation sequencing using the NEXTSEQ TM 500 System (Illumina Inc.). One plasmid was identified and designated pSaMF128 ( Figure 3 ).

[0223] Example 5: Transformation of Trichoderma reesei strain FRT4New-8G4A with pSaMF128 to integrate the Ala153Thr mutation in the endogenous ire1 gene.

[0224] According to Example 2, Trichoderma reesei FRT4New-8G4A protoplasts were generated and transformed with 4.75 μg of Pme I and Swa I-linearized pSaMF128 (Example 4). Nineteen transformants were obtained and each transformant was picked and transferred to a 25 mm COVE2 plate and incubated at 30 °C for 5 days.

[0225] The PHIRE TMThe fungal spore PCR method of the Plant Direct PCR Kit (Thermo Scientifi) is used to screen for transformants for site - specific integration of Pme I and Swa I - linearized pSaMF128 for 5'recombination or 3'recombination using the forward and reverse primers shown below.

[0226] 5'recombination:

[0227] Forward primer 1221836:

[0228] TGTCGAGGATGTGCTGGAGG (SEQ ID NO:24)

[0229] Reverse primer 1221835:

[0230] ACCTGCCGTAGAACCGAAGA (SEQ ID NO:25)

[0231] 3'recombination:

[0232] Forward primer 1220100:

[0233] CTTATCAGCGGCCAGTTCTTCCC (SEQ ID NO:26)

[0234] Reverse primer 1221837:

[0235] GACTCGCATAAGATGGCGAC (SEQ ID NO:27)

[0236] Spore PCR is completed by collecting spores with a sterile 1 μl inoculation loop and transferring them to 20 μl of dilution buffer (PHIRE TM Plant Direct PCR Kit) in a 0.6 ml tube. The spore suspension is used as a template in the PCR to screen for the integration of pSaMF128 at the ire1 locus. The reaction consists of: 1.5 μl of the spore suspension in a 20 μl reaction, 12.5 pmol of each primer, 10 μl of 2X PHIRE TM Plant PCR Buffer (PHIRE TM Plant Direct PCR Kit), and 0.4 μl of PHIRE TM Hot - Start II DNA Polymerase (PHIRE TM Plant Direct PCR Kit).

[0237] The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 5 minutes; 40 cycles, each at 98 °C for 10 seconds, 66 °C for 10 seconds, and 72 °C for 2 minutes; 1 cycle at 72 °C for 10 minutes; and hold at 4 °C. The completed PCR was analyzed by 1% agarose gel electrophoresis in TAE buffer.

[0238] Successful targeted integration at the 5'-end of the Trichoderma reesei ire1 locus produced a 5630 bp band, while successful integration at the 3'-end of the Trichoderma reesei ire1 locus produced a 4707 bp band. The results of spore PCR indicated that 17 out of 19 transformants had been successfully integrated at both the 5'- and 3'-ends of the Trichoderma reesei ire1 locus.

[0239] The ire1 replacement construct pSaMF128 contained the amdS gene flanked by direct repeats and the HSV-1 tk gene as a selectable marker. The direct repeats were inserted to facilitate the curation of the amdS and HSV-1 tk genes and to generate a clean ire1 locus with the Ala153Thr mutation. Trichoderma reesei strains SaMF128-1, SaMF128-2, and SaMF128-4 were grown on PDA plates at 28 °C for 7 days. Using 0.01% Spores were collected from the plates and these spores were spread onto TrMM plates containing 1.5 μM 5-fluoro-2'-deoxyuridine (FdU) and incubated at 30 °C for 5 days. Fifteen isolates were subcultured onto PDA plates and incubated at 30 °C for 5 days. Then, isolates lacking the amdS selectable marker gene were screened by growth on COVE2 plates. Three isolates showed no growth on the COVE2 plates, indicating that the amdS and HSV-1 tk selectable marker genes might have been lost.

[0240] After one round of single spore isolation on PDA plates, fungal spore PCR was performed on each isolate to amplify the ire1 locus as described above. PCR screening consisted of 1.5 μl of spore suspension in a 20 μl reaction, 12.5 pmol of primer 1222084, 12.5 pmol of primer 1222085, 10 μl of 2X PHIRE TM Plant PCR buffer, and 0.4 μl of PHIRE TM Hot Start II DNA polymerase. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 5 minutes; 40 cycles, each at 98 °C for 10 seconds, and 72 °C for 29 seconds; 1 cycle at 72 °C for 10 minutes; and hold at 10 °C. The resulting PCR fragments were treated with ExoSAP-ITTM (Applied Biosystems Inc.) and sequenced using a Model 377XL automated DNA sequencer with dye terminator chemistry (Giesecke et al., 1992, ibid.) to verify the integration of the Ala153Thr mutation in the Trichoderma reesei ire1 gene. Genomic DNA was prepared as described in Example 1 and sequenced on the NEXTSEQ TM 500 (Illumina Inc.) using 2X 150bp chemistry. Sequencing identified the transformant SaMF128-2A11-1 to contain the Ala153Thr mutation in the Trichoderma reesei ire1 gene and to be devoid of the amdS and HSV-1tk selectable marker genes.

[0241] Example 6: Construction of the Flp / FRT integration plasmid pAMFS210 for expression of Pycnoporus cinnabarinus laccase

[0242] An expression plasmid pAMFS210 was constructed to integrate the Pycnoporus cinnabarinus laccase gene (SEQ ID NO:28 for the cDNA sequence and SEQ ID NO:29 for the deduced amino acid sequence) at each of four loci in Trichoderma reesei using the Saccharomyces cerevisiae flippase (FLP) and the flippase recognition sequences FRT-F and FRT-F3. Two synthetic oligonucleotide primers were designed as shown below to PCR amplify the Pycnoporus cinnabarinus laccase gene from plasmid pAMFS200 (WO 2016 / 090059) and introduce flanking regions for insertion into the expression vector pJfyS165 (US2018 / 0037897). Bold letters represent the coding sequence and the remaining sequences are homologous to the insertion sites of plasmid pJfyS165.

[0243] Forward primer 1210173:

[0244] ACCGCGGACTGCGCACCATGTCGAGGTTTCACTC (SEQ ID NO:30)

[0245] Reverse primer 1210174:

[0246] GCCACGGAGCTTAATTACTACTGGTCGCTCGGGT (SEQ ID NO:31)

[0247] The PCR consisted of: 200 ng of plasmid pAMFS200 DNA, 10 μl of 10 mM dNTP, 50 pmol of primer 1210173, 50 pmol of primer 1210174, 1X HF buffer, and 2 units of Hot start DNA polymerase was used with a final volume of 50 μl. The reaction was carried out in a thermal cycler programmed as follows: 1 cycle for 30 seconds at 98 °C; 30 cycles, each for 10 seconds at 98 °C, 10 seconds at 62 °C, and 1.5 minutes at 72 °C; and 1 cycle for 10 minutes at 72 °C. The PCR product was purified by electrophoresis on a 1% agarose gel in TAE buffer, where the 1.5 kb fragment was excised from the gel and agarose was extracted using a MIN- Gel Extraction Kit (Qiagen GmbH).

[0248] A 1.5 kb gene fragment of the laccase coding sequence from Piptoporus betulinus and the digested vector were ligated together in the reaction to obtain the expression plasmid pAMFS210 consisting of: the laccase coding sequence from Piptoporus betulinus under the transcriptional control of the Trichoderma reesei cbh1 promoter, the FRT recognition site for efficient targeting, and the Saccharomyces cerevisiae flippase coding sequence under the control of the Trichoderma reesei cbh2 promoter. The ligation reaction (10 μl) consisted of: 1X IN-FUSION TM HD Enzyme Mix, 200 ng of pJfyS165 digested with Nco I and Pac I, and 68 ng of the purified Piptoporus betulinus laccase gene PCR product. The reaction was incubated at 50 °C for 15 minutes. A 2 μl volume of the reaction was transformed into ONE TOP10 competent cells (Invitrogen). The transformants were inoculated into 3 ml of LB + Amp medium in a 14 ml round-bottom polypropylene tube and incubated overnight at 37 °C with shaking at 200 rpm. Plasmid DNA was isolated using 9600. Insertion was confirmed by DNA sequencing using a Model 377XL automated DNA sequencer with dye terminator chemistry (Giesecke et al., 1992, supra). A transformant containing an insertion without PCR errors was identified and the plasmid was designated pAMFS210( Figure 4 ).

[0249] Example 7: Construction of pAlLo104

[0250] Plasmids pJfyS165 and pDM313 (U.S. 2018 / 0037897) were digested with the restriction enzyme Bst XI respectively and purified by electrophoresis on a 0.7% agarose gel in TAE buffer, where an 8.2 kb DNA band from plasmid pJfyS165 and a 1.2 kb DNA band from plasmid pDM313 were excised from the gel and extracted using a Gel and PCR Clean-up Kit. QUBITTM 2.0 fluorometer and dsDNA Broad Range Assay Kit (Thermo Fisher Scientific) were used to quantify the purified DNA fragments.

[0251] Using Thermo Scientific TM Rapid Ligation Kit was used to assemble plasmid pAlLo104 with a vector:insert molar ratio of 1:3. One microliter of the ligation reaction was used to transform 50 μl of STELLAR TM chemically competent Escherichia coli cells. These cells were heat shocked at 42 °C for 45 seconds and then 100 μl of SOC medium was added. The transformation was then incubated at 37 °C with constant shaking at 200 rpm for 60 minutes. Then 100 μl aliquots of the transformation were plated on 150 mm 2XYT + Amp plates and incubated overnight at 37 °C. Twenty-four resulting E. coli transformants were individually inoculated into 3 ml of LB + Amp medium in 14 ml round bottom polypropylene tubes and incubated overnight at 37 °C with shaking at 300 rpm. Using 9600 to isolate plasmid DNA. Restriction enzyme digestion with Bst XI was used to analyze the putative recombinant clones. One of the clones with the correct restriction pattern was selected and designated as plasmid pAlLo104. To further confirm the sequence of pAlLo104, NEXTSEQ TM 500 system (Illumina Inc.) was used to sequence the entire plasmid by next-generation sequencing.

[0252] Example 8: Construction of pAlLo105

[0253] The simian virus 40 (SV40) T antigen nuclear localization sequence (SV40-NLS) was added to the Saccharomyces cerevisiae flippase, and the 840 bp Pae I / Psr I restriction fragment from pAlLo104 was removed by restriction enzyme digestion and gel purification. The in-silico model of the 840 bp fragment was split into two parts immediately before the Saccharomyces cerevisiae flippase stop codon (TGA), and then the following sequences containing SV40-NLS were added to the right and left of the cleaved fragment.

[0254] CCCAAGAAGAAGCGCAAGGTC (SEQ ID NO:32)

[0255] PKKKRKV (SEQ ID NO:33)

[0256] Then, these computer simulation models were used to generate PCR primers to amplify the 840 bp fragment with the newly added SV40-NLS and clone it back into the Pae I / Psr I digested pAlLo104 backbone.

[0257] Primer on the left:

[0258] Forward primer:

[0259] GAACGCCCCCTACTCCATCTTCGCCATCAAGAACGGCCCCA A(SEQ ID NO:34)

[0260] Reverse primer:

[0261] GACCTTGCGCTTCTTCTTGGGGATGCGGCGGTTGATGTA GG(SEQ ID NO:35)

[0262] The bold sequences represent the newly added SV40-NLS nucleotide sequences.

[0263] Primer on the right:

[0264] Forward primer:

[0265] CCCAAGAAGAAGCGCAAGGTCTGAGTCGAGATTATCCAA GG(SEQ ID NO:36)

[0266] Reverse primer:

[0267] GTTTAAACTCTAGGATGCATGCAAGTGAGGCTATTGCCTAT(SEQ ID NO:37)

[0268] The bold sequences represent the newly added SV40-NLS nucleotide sequences.

[0269] The left and right PCRs consisted of: 15 ng of plasmid pJfyS165 DNA, 200 μM dNTP, 0.5 μM primer, 1X reaction buffer (Thermo Fisher Scientific), and 2 units of High Fidelity DNA polymerase (Thermo Fisher Scientific), with a final volume of 50 μl. The reaction was carried out in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 30 cycles, each at 98 °C for 5 seconds, 60 °C for 10 seconds, and 72 °C for 30 seconds; and 1 cycle at 72 °C for 5 minutes. The reaction was purified by using 0.7% agarose gel electrophoresis in TAE buffer, where the 424 bp band (left fragment) and 470 bp band (right fragment) were excised from the gel and extracted using a Gel and PCR Clean-up Kit. The purified DNA was quantified using a QUBIT TM 2.0 fluorometer and a dsDNA Broad Range Assay Kit.

[0270] The Psr I / Pae I restriction digestion of pAlLo104 to generate the cloning backbone was done in sequential digestions to account for restriction buffer incompatibilities.

[0271] The Psr I restriction digestion consisted of: 5 μg of plasmid pAlLo104, 1X SibY restriction buffer (SibEnzyme Ltd.), 1X BSA, 5 units of Psr I restriction enzyme, and water to 200 μl. The reaction was incubated overnight at 30 °C, then incubated at 65 °C for 20 minutes to inactivate the enzyme thermally, and then gel purified as described above.

[0272] The Pae I restriction digestion consisted of: 40 μl of the Pae I restriction digestion, 1X FastGreen buffer (Thermo Fisher Scientific), 4 units of Pae I, and water to 100 μl. The reaction was incubated at 37 °C for 60 minutes and then gel purified as described above.

[0273] The fragment containing SV40-NLS was cloned using the HiFi DNA Assembly Kit. The reaction consisted of: plasmid pAlLo105 backbone, and left and right fragments at a ratio of 1:2 (0.07 pmol:0.14 pmol) (total mass of 0.21 pmol), and 1X HiFi Master Mix, with a total volume of 20 μl. The reaction was incubated at 50 °C for 30 minutes and then placed on ice for 2 minutes. Two microliters of the HiFi reaction was used to transform NEB 5-ALPHA TMCompetent cells (New England Biolabs). These cells were heat-shocked at 42 °C for 30 seconds and then 950 μl of SOC medium was added. The transformation was then incubated at 37 °C with constant shaking at 200 rpm for 60 minutes. Then 100 μl aliquots of the transformation were plated on 150 mm² XYT + Amp plates and incubated overnight at 37 °C. Eight colonies were randomly selected and plasmid DNA was prepared using 9600. The putative recombinant clones were analyzed by restriction digestion with Bcg I. One clone with the correct restriction pattern was randomly selected and designated plasmid pAlLo105. To further confirm the correct assembly of pAlLo105, the plasmid was Sanger sequenced using the same primer pairs used for PCR amplification of this region (SEQ ID NO:35 and SEQ ID NO:38). Sequence analysis was performed using version 4.0 (SnapGene). The Sanger reads were aligned to the in silico model of pAlLo105, showing that the SV40-NLS had been successfully added to the end of the flippase gene.

[0274] Example 9: Construction of pAlLo106

[0275] Plasmid pAlLo5 (Example 8) was digested with Xba I and Kfl I to remove the fragment containing the cbh1 promoter, cbh1 terminator, and the 3' end of the amdS gene of approximately 1.8 kb. The restriction digestion reaction consisted of: 5 μg of plasmid pAlLo105 DNA, 1X Fast Green buffer (Thermo Fisher Scientific), 5 units of Xba I and 5 units of Kfl I, and water to 100 μl. The reaction was incubated at 37 °C for 60 minutes and then gel purified as described in Example 8. An alternative fragment containing the cbh2 promoter and terminator and the 3' end of the amdS gene of approximately 1.8 kb was PCR amplified from plasmid pJfyS143 (US2018 / 0037897) using the following primers.

[0276] CTATTCCGAGTTCCTATTCTCTAGAAAGTATAGGAACTTCG AATTCTAGGCTAGGTATGC(SEQ IDNO:38)

[0277] ATCGCCCAGCAGTTAGTAGGGTCCC(SEQ ID NO:39)

[0278] The PCR consisted of: 20 ng of plasmid pJfyS143 DNA, 200 μM dNTP, 0.5 μM primers, 1X reaction buffer, and 2 units of high-fidelity DNA polymerase, with a final volume of 50 μl. The reaction was carried out in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 98 °C for 5 seconds, 68 °C for 10 seconds, and 72 °C for 3 minutes; and 1 cycle at 72 °C for 5 minutes. The reaction was purified by agarose gel electrophoresis in 0.7% TAE buffer, where the 2819 bp band was excised from the gel and extracted using a gel and PCR clean-up kit. The HiFi DNA Assembly Kit was used for the assembly of the new vector. The reaction consisted of plasmid pAlLo105 backbone, and replacement fragments at a ratio of 1:3 (0.023 pmol:0.07 pmol) (total mass of 0.21 pmole), and 1X HiFi master mix, with a total volume of 20 μl. The reaction was incubated at 50 °C for 30 minutes and then placed on ice for 2 minutes.

[0279] Two microliters of the HiFi reaction was used to transform SOLOPACK TM ultra-competent cells ((Agilent Technologies)). These cells were heat-shocked at 42 °C for 30 seconds and then 250 μl of SOC medium was added. The transformation was then incubated at 37 °C with constant shaking at 200 rpm for 60 minutes. Then 100 μl aliquots of the transformation were plated on 150 mm 2XYT + Amp plates and incubated overnight at 37 °C. Sixteen colonies were randomly picked and used Preparation of plasmid DNA. Restriction digestion was performed with Xba I and Kfl I to analyze the putative recombinant clones. Clones 9 and 15 were observed to have the correct restriction pattern and were selected for sequencing by Illumina technology as described in Example 7. Sequence analysis was performed using CLC Genomics Workbench version 11.0.0 (Qiagen). The reads were mapped to a computer-simulated model of the expected pAlLo106 sequence using the Map Reads to Reference module with high stringency settings. A total of 180,627 reads out of 191,566 reads were successfully mapped, resulting in 100% model coverage with a read depth of 4485 ± 354. Analysis of clone 9 using the Basic Variant Detector Module showed that it had a single nucleotide polymorphism at position 318. This clone was discarded. Analysis of clone 15 showed that a total of 187,208 reads out of 192,552 reads were successfully mapped, resulting in 100% model coverage with a read depth of 4,791 ± 418. The Basic Variant Detector showed that clone 15 had the expected sequence of plasmid pAlLo106. Clone 15 was renamed plasmid pAlLo106.

[0280] Example 10: Construction of plasmid pAlLo108

[0281] Plasmid pAlLo108 is a derivative of plasmid pAlLo106 in which the Saccharomyces cerevisiae flippase gene is driven by the Aspergillus nidulans gpdA promoter instead of the Trichoderma reesei gpdA promoter.

[0282] Plasmid pAlLo106 was digested with Bst XI to remove a 1.2 kb fragment containing the Trichoderma reesei gpdA promoter and a 264 bp fragment of the Saccharomyces cerevisiae flippase gene. The 1.2 kb fragment was replaced with a fragment containing the original 264 bp Saccharomyces cerevisiae flippase gene fragment and a 1.2 kb fragment containing the Aspergillus nidulans gpdA promoter.

[0283] The following primers were used to PCR amplify a DNA fragment containing the Aspergillus nidulans gpdA promoter from Aspergillus nidulans genomic DNA.

[0284] ATAGGAACTTCAGATATCCATCACACTGGGAGTACCATTTA ATTCTATTTGTGTTTGATCGAGAC (SEQ ID NO:40)

[0285] CGAACTGGGGCATGGTGATGTCTGCTCAAGCGG(SEQ ID NO:41)

[0286] The PCR consisted of 180 ng of Aspergillus nidulans genomic DNA, 200 μM dNTP, 0.5 μM primers, 1X reaction buffer, and 2 units of high-fidelity DNA polymerase, with a final volume of 50 μl. The reaction was carried out in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 98 °C for 5 seconds, 60 °C for 10 seconds, and 72 °C for 3 minutes; and 1 cycle at 72 °C for 5 minutes. The reaction was purified by electrophoresis on a 0.7% agarose gel in TAE buffer, where the 1267 bp DNA band was excised from the gel and extracted using a gel and PCR clean-up kit.

[0287] The DNA fragment of the Saccharomyces cerevisiae flippase gene was amplified by PCR from plasmid pAlLo105 using the following primers.

[0288] GCAGACATCACCATGCCCCAGTTCGATATCCTCT(SEQ ID NO:42)

[0289] CTTCTTGAGGGAGGCCTCCAGGATGGTGGCCTTCTGG(SEQ ID NO:43)

[0290] The PCR consisted of 10 ng of plasmid pAlLo105 DNA, 200 μM dNTP, 0.5 μM primers, 1X reaction buffer, and 2 units of high-fidelity DNA polymerase, with a final volume of 50 μl. The reaction was carried out in a thermal cycler programmed as follows: 1 cycle at 98 °C for 2 minutes; 35 cycles, each at 98 °C for 5 seconds, 60 °C for 10 seconds, and 72 °C for 3 minutes; and 1 cycle at 72 °C for 5 minutes. The reaction was purified by electrophoresis on a 0.7% agarose gel in TAE buffer, where the 297 bp DNA band was excised from the gel and extracted using a gel and PCR clean-up kit.

[0291] Using The HiFi DNA Assembly Kit was used to assemble pAlLo108. The reaction consisted of: 100 ng of Bst XI-digested pAlLo106, 6.9 ng of a 264-bp Saccharomyces cerevisiae flippase gene fragment, 29.8 ng of a 1.2-kb Aspergillus nidulans gpdA promoter fragment, and 1X HiFi Master Mix, with a total volume of 20 μl. The reaction was incubated at 50 °C for 30 minutes and then placed on ice for 2 minutes.

[0292] Two microliters of the reaction was transformed into SOLOPACK TM Ultracompetent cells. These cells were heat-shocked at 42 °C for 30 seconds and then 250 μl of SOC medium was added. The transformation was then incubated at 37 °C with constant shaking at 200 rpm for 60 minutes. Then, 100-μl aliquots of the transformation were plated on 150-mm 2XYT+Amp plates and incubated overnight at 37 °C. Twelve colonies / plasmids were randomly picked and plasmid DNA was prepared with 9600. The putative recombinant clones were analyzed by restriction digestion with Sca I.

[0293] As described in Example 7, two clones with the correct restriction pattern were selected for each plasmid and sequenced by Illumina technology. Sequence analysis was performed using CLC Genomics Workbench version 11.0.0 (Qiagen GmbH). Using the read mapping to reference value module with high stringency settings, the reads were mapped to a computer-simulated model of the expected pAlLo108 sequence. A total of 103,574 reads were successfully mapped, resulting in 100% coverage of the pAlLo106 model with an average read depth of 2640 ± 321. Analysis of the basic variant detector module showed that clone 108-15 had the expected sequence of plasmid pAlLo108.

[0294] Example 11: Construction of the Flp / FRT integration "empty" plasmid pNJOC381

[0295] Plasmid pNJOC381 is an "empty" plasmid that contains a non-functional amdS gene and lacks the Phanerochaete chrysosporium laccase expression cassette. This plasmid was constructed to enable integration at each of four loci in Trichoderma reesei using the Saccharomyces cerevisiae flippase (FLP) and the flippase recognition sequences FRT-F and FRT-F3.

[0296] Plasmid pNJOC381 was constructed from pAlLo108 (Example 10) by replacing the amdS gene with a truncated amdS cassette lacking the promoter and start codon ATG of the amdS gene. This plasmid was assembled from two PCR products. The pAlLo108 plasmid backbone and the truncated amdS cassette were PCR amplified from pAlLo108 using primer sets NJ91 and NJ92 and primer sets NJ93 and NJ94 as shown below, respectively.

[0297] Primer NJ91:

[0298] caagggcgaattctgcattg(SEQ ID NO:44)

[0299] Primer NJ92:

[0300] gaagttcctatactttctagagaataggaactcggaataggaacttcaagatgaattcgc(SEQ IDNO:45)

[0301] Primer NJ93:

[0302] ctagaaagtataggaacttcAAGCTTtggaaacgcaaccctgaag(SEQ ID NO:46)

[0303] Primer NJ94:

[0304] caatgcagaattcgcccttgcctcaatcctgggaagaactg(SEQ ID NO:47)

[0305] The PCR consisted of: 5 ng of plasmid pAlLo108 DNA (used as a template), 1X HF buffer, 200 μM of each dNTP, 500 nM of the forward primer, 500 nM of the reverse primer, and 1 unit of Hot Start II DNA polymerase. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 3 minutes; 35 cycles, each at 98 °C for 10 seconds, 55 °C for 30 seconds, and 72 °C for 2 minutes; and 1 cycle at 72 °C for 5 minutes. After thermal cycling, the PCR products were separated by 1% agarose gel electrophoresis in TBE buffer, where the 5770 bp and 2117 bp bands corresponding to the pAlLo108 backbone and the truncated amdS cassette were excised from the gel respectively, and purified using a Gel and PCR Clean-up Kit.

[0306] The two PCR products were used with a total volume of 20 μl of HiFi DNA Assembly Cloning Kit (consisting of 1X HiFi Assembly Master Mix and 0.05 pmol of each PCR product) were ligated together. The reaction was incubated at 50 °C for 15 minutes and then placed on ice. 1 μl of the reaction was used to transform 60 μl of STELLAR TM chemically competent Escherichia coli cells. The transformation reaction was spread onto two 2XYT + Amp plates and incubated overnight at 37 °C. Putative transformant colonies were isolated from the selection plates and plasmid DNA was prepared from each using a spin mini-prep kit and screened for the appropriate insert of the fragment digested with Pvu II enzyme. DNA sequencing confirmed that the plasmids producing the desired band sizes (3439 bp, 2364 bp, and 2044 bp) were correct and designated as pNJOC381.

[0307] Example 12: Generation of Strains Overexpressing Trametes picea Laccase

[0308] Strains overexpressing the Trametes picea laccase gene in Trichoderma reesei FRT4New-8G4A (natural ire1 gene) and Trichoderma reesei SaMF128-2A11-1 (ire1 Ala153Thr mutant) as hosts were constructed according to the following procedure.

[0309] Protoplasts of Trichoderma reesei FRT4New-8G4A and Trichoderma reesei SaMF128-2A11-1 were generated and co-transformed with 5 μg of plasmid pAMF210 (Example 5) and 3 μg of plasmid pNJOC381 (Example 11) for each transformation reaction according to Example 2 to generate strains with 1, 2, 3, and / or 4-copies of the Trametes picea laccase gene. The transformation was spread on COVE plates and incubated at 30 °C until transformants appeared. Using Whatman TM 150 mm sterile filter paper (GE Healthcare UK Limited), the spores of the transformants from each COVE plate were replica-plated onto TrMM plates containing 75 μg / ml 5-fluorocytosine (5-FC) (Sigma Chemical Co.) and incubated at 30 °C for 6 days. Thirty-five 5-FC resistant isolates from Trichoderma reesei FRT4New-8G4A and twenty-eight 5-FC resistant transformants from Trichoderma reesei SaMF128-2A11-1 were subcultured onto new TrMM plates containing 75 μg / ml 5-FC.

[0310] Using PHIRE TMThe fungal multiplex spore PCR method of the plant direct PCR kit is used to screen 5-FC resistant transformants to determine the copy number of the laccase gene of Piptoporus betulinus. PCR is carried out using the universal forward primer targeting the start point of the amdS gene and a set of reverse primers (one for each locus) as shown below.

[0311] Forward primer NJ100:

[0312] gttcttcccaggattgagg (SEQ ID NO:48)

[0313] Reverse primer NJ101:

[0314] ggtactgggatacacgaagagc (SEQ ID NO:49)

[0315] Reverse primer NJ102:

[0316] atcagtacagccatgttgcac (SEQ ID NO:50)

[0317] Reverse primer NJ103:

[0318] gagaagactttggacgcagtg (SEQ ID NO:51)

[0319] Reverse primer NJ104:

[0320] atgatacctactgataccgacaacc (SEQ ID NO:52)

[0321] The size of the PCR products of different loci is controlled by placing locus-specific reverse primers at different distances from the amdS gene. Compared with the locus containing the empty construct pNJOC381 lacking the amdS promoter and start codon, the locus containing the pAMFS210 expression construct will produce a longer PCR product size (Table 1). Therefore, the PCR strategy allows simultaneous verification of the integration of the Piptoporus betulinus laccase gene at the cbh1, cbh2, eg1, and / or xyn2 loci and serves as a simple method for copy number determination.

[0322] Table 1: Expected PCR product sizes of fungal multiplex spore PCR

[0323]

[0324] By collecting spores with a sterile 1 μl inoculation loop and transferring them to 20 μl of dilution buffer (PHIRE) in a 0.6 ml tube TMMultiplex spore PCR was carried out in a Plant Direct PCR Kit). The reaction consisted of: 0.5 μl of spore suspension in a 20 μl reaction, 2 pmol of the universal forward primer NJ100, 0.5 pmol each of the reverse primers NJ101, NJ102, NJ103, and NJ104, 5 μl of 2X PHIRE TM Plant PCR buffer, and 0.2 μl of PHIRE TM Hot Start II DNA polymerase. The reaction was incubated in a thermal cycler programmed as follows: 1 cycle at 98 °C for 5 minutes; 40 cycles, each at 98 °C for 5 seconds, 55 °C for 5 seconds, and 72 °C for 40 seconds; 1 cycle at 72 °C for 2 minutes; and held at 4 °C. The completed PCR was analyzed by 1.5% agarose gel electrophoresis in TAE buffer.

[0325] The results of multiplex spore PCR identified transformants with only 1-copy and 2-copies of the Pycnoporus cinnabarinus laccase gene in Trichoderma reesei FRT4New-8G4A (native ire1 gene) as the host, and transformants with 2-, 3-, and 4-copies of the Pycnoporus cinnabarinus laccase gene in Trichoderma reesei SaMF128-2A11-1 (Ala153Thr ire1 mutant) as the host. The strains were single spores isolated on COVE plates, and multiplex spore PCR was performed again as described above to verify the copy number of the Pycnoporus cinnabarinus laccase gene.

[0326] Example 13: Laccase activity assay

[0327] The culture supernatant was appropriately diluted in 0.1 M sodium acetate, 0.01% TRITON TM X-100 (4-(1,1,3,3-tetramethylbutyl)phenyl-polyethylene glycol) pH 5.0 buffer (sample buffer), and then the diluted sample was serially diluted from 0-fold to 1 / 3-fold to 1 / 9-fold. The laccase standard was appropriately diluted with the sample buffer and added to the sample. A total of 20 μl of each dilution and standard sample was transferred to the wells of a 96-well flat-bottom microtiter plate. 200 μl of ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)) substrate solution (0.1 M sodium acetate pH 5.0 + 0.275 mg / ml ABTS + 0.01% TRITON TM X-100) was added to each well, and then incubated at ambient temperature for 30 minutes. During the incubation, for the 96-well plate, use The microplate reader (Molecular Devices, LLC.) measures the reaction rate at an optical density of 405 nm. The sample concentration is determined by extrapolation from the generated standard curve.

[0328] Example 14: Comparison of the laccase productivity of Trametes versicolor in Trichoderma reesei FRT4New-8G4A (native ire1) and Trichoderma reesei SaMF128-2A11-1 (ire1 Ala153Thr mutant)

[0329] In Whatman TM In a 24-well polypropylene round-bottom microplate, in 2 ml of CIM medium containing 2% lactose and 0.25 mM CuSO 4 ·5H 2 O, the single-spore isolated strain expressing Trametes versicolor laccase (Example 12) was cultured at 30 °C with shaking at 250 rpm for 3 days. After 3 days of growth, the liquid medium was assayed for Trametes versicolor laccase activity as described in Example 13. In the strain with 2 copies of the Trametes versicolor laccase gene, the expression level of Trametes versicolor laccase was relatively improved 1.6-fold in Trichoderma reesei SaMF128-2A11-1 (ire1 Ala153Thr mutant) compared to Trichoderma reesei FRT4New-8G4A (native ire1).

[0330] Example 15: Laboratory-scale 2-liter fermentation confirmation of improved Trametes versicolor laccase expression

[0331] Strains with two copies of the Trametes versicolor laccase gene from Trichoderma reesei FRT4New-8G4A (native ire1) and Trichoderma reesei SaMF128-2A11-1 (ire1 Ala153Thr mutant) were evaluated in 2-liter fermentation broth. Each strain was grown on a PDA plate at 30 °C for 4 - 7 days. Three 500-ml shake flasks each containing 100 ml of shake flask medium were inoculated with two plugs from the PDA plate. The shake flasks were incubated at 28 °C on an orbital shaker at 250 rpm for 48 hours. These cultures were used as seeds for fermentation.

[0332] A 3-liter glass-jacketed fermenter (Applikon Biotechnology) containing 1.6 liters of fed-batch fermentation medium was inoculated with a total of 160 ml of various subcultures. The fermenter was maintained at a temperature of 28 °C, and the pH was controlled at a set value of 3.5 + / - 0.1 using an Applikon 1030 control system. Air was added to the vessel at a rate of 2.5 L / min, and the culture broth was stirred with a Rushton impeller rotating at 1100 rpm. A fermentation feed medium consisting of dextrose and phosphate was fed at a rate of 0 to 10 g / L / hour for 165 hours. Samples were taken on days 3, 4, 5, 6, and 7 of the fermentation run and centrifuged at 3000 x g to remove biomass. The supernatant was stored at 5 °C to 10 °C.

[0333] As described in Example 13, the expression level of Trametes versicolor laccase was determined in the supernatant samples. A 2.82X increase in Trametes versicolor laccase activity was observed in the strain with the A153T ire1 mutation containing 2 copies of the Trametes versicolor laccase gene compared to the wild-type ire1 strain containing 2 copies of the Trametes versicolor laccase gene (Table 2). Increasing the laccase gene copy to 3 or 4 did not result in higher laccase expression in the A153T ire1 mutant strain.

[0334] Table 2: Comparison of relative laccase activity of wild-type ire1 and A153T ire1 variant hosts over 7 days

[0335]

[0336] The invention described and claimed herein is not limited to the scope of the specific aspects disclosed herein, as these aspects are intended to be illustrative of several aspects of the invention. Any equivalent aspects are intended to be within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In case of conflict, the present disclosure, including definitions, will control.

[0337] The invention is further defined by the following numbered paragraphs:

[0338] Paragraph 1. An isolated variant Ire1 polypeptide comprising (a) an amino acid substitution at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) an amino acid substitution at the position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and having at least 70% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0339] Paragraph 2. The variant Ire1 polypeptide according to claim 1, wherein the substitution at position 153 or at a position corresponding to position 153 is Thr.

[0340] Paragraph 3. The variant Ire1 polypeptide according to claim 1, wherein Ala at position 153 or at a position corresponding to position 153 is substituted with Thr.

[0341] Paragraph 4. The variant Ire1 polypeptide according to any one of claims 1 to 3, which further comprises Thr at position 150 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 or Thr at a position corresponding to position 150 in Trichoderma reesei Ire1 of SEQ ID NO:2.

[0342] Paragraph 5. The variant Ire1 polypeptide according to any one of claims 1 to 4, wherein the variant Ire1 polypeptide has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0343] Paragraph 6. An isolated polynucleotide comprising a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and has at least 70% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0344] Paragraph 7. The polynucleotide according to claim 6, wherein the substitution at position 153 or at a position corresponding to position 153 is Thr.

[0345] Paragraph 8. The polynucleotide according to claim 6, wherein Ala at position 153 or at a position corresponding to position 153 is substituted with Thr.

[0346] Paragraph 9. The polynucleotide according to any one of claims 6 to 8, wherein the variant Ire1 polypeptide further comprises Thr at position 150 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 or Thr at a position corresponding to position 150 in Trichoderma reesei Ire1 of SEQ ID NO:2.

[0347] Paragraph 10. The polynucleotide according to any one of claims 6 to 9, wherein the variant Ire1 polypeptide has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0348] Paragraph 11. A nucleic acid construct comprising the polynucleotide according to any one of claims 6 to 10.

[0349] Paragraph 12. An expression vector comprising the nucleic acid construct of claim 11.

[0350] Paragraph 13. A variant Ire1 polypeptide encoded by the polynucleotide according to any one of claims 6 to 10.

[0351] Paragraph 14. A recombinant filamentous fungal host cell comprising and expressing a first polynucleotide encoding a secreted heterologous polypeptide of interest and a second polynucleotide comprising a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and has at least 70% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0352] Paragraph 15. The recombinant filamentous fungal host cell according to claim 14, wherein the substitution at position 153 or the position corresponding to position 153 is Thr.

[0353] Paragraph 16. The recombinant filamentous fungal host cell according to claim 14, wherein Ala at position 153 or the position corresponding to position 153 is replaced by Thr.

[0354] Paragraph 17. The recombinant filamentous fungal host cell according to any one of claims 14 to 16, wherein the variant Ire1 polypeptide further comprises Thr at position 150 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 or Thr at a position corresponding to position 150 in Trichoderma reesei Ire1 of SEQ ID NO:2.

[0355] Paragraph 18. The recombinant filamentous fungal host cell according to any one of claims 14 to 17, wherein the variant Ire1 polypeptide has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO: 2.

[0356] Paragraph 19. The recombinant filamentous fungal host cell according to any one of claims 14 to 18, which belongs to a genus selected from the group consisting of: Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Monilia, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, and Trichoderma.

[0357] Paragraph 20. The recombinant filamentous fungal host cell according to any one of claims 14 to 18, which is a Trichoderma cell.

[0358] Paragraph 21. The recombinant filamentous fungal host cell according to claim 20, wherein the Trichoderma cell is a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.

[0359] Paragraph 22. The recombinant filamentous fungal host cell according to claim 20, wherein the Trichoderma cell is a Trichoderma reesei cell.

[0360] Paragraph 23. The recombinant filamentous fungal host cell according to any one of claims 14 to 22, wherein the heterologous polypeptide of interest is an enzyme selected from the group consisting of: hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase.

[0361] Paragraph 24. A recombinant filamentous fungal host cell according to any one of claims 14 to 22, wherein the heterologous polypeptide of interest is an acetyl mannan esterase, acetyl xylan esterase, aminopeptidase, α-amylase, arabinanase, arabinofuranosidase, β-amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, coumaric acid esterase, cyclodextrin glycosyltransferase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, ferulic acid esterase, lytic polysaccharide monooxygenase, α-galactosidase, β-galactosidase, glucocerebrosidase, glucose oxidase, α-glucosidase, β-glucosidase, glucuronidase, glucuronate esterase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, mannanase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, phenol oxidase, polyphenol oxidase, proteolytic enzyme, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase or β-xylosidase.

[0362] Paragraph 25. A method for producing a secreted heterologous polypeptide of interest, the method comprising the steps of: (a) culturing a recombinant filamentous fungal host cell according to any one of claims 14 to 24 under conditions suitable for producing and secreting the heterologous polypeptide; and optionally (b) recovering the secreted heterologous polypeptide of interest.

[0363] Paragraph 26. A method for improving the productivity or yield of a secreted heterologous polypeptide of interest in a filamentous fungal host cell, the method comprising the steps of: (a) providing a filamentous fungal host cell that comprises and expresses an ire1 gene encoding an Ire1 polypeptide; and (b) mutating the ire1 gene to provide a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and has at least 70% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:2.

[0364] Paragraph 27. The method according to claim 26, wherein the substitution at position 153 or the corresponding position is Thr.

[0365] Paragraph 28. The method according to claim 26, wherein Ala at position 153 or the corresponding position is replaced by Thr.

[0366] Paragraph 29. The method according to any one of claims 26 to 28, wherein the variant Ire1 polypeptide further comprises Thr at position 150 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 or Thr at a position corresponding to position 150 in Trichoderma reesei Ire1 of SEQ ID NO:2.

[0367] Paragraph 30. The method according to any one of claims 26 to 29, wherein the variant Ire1 polypeptide has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity to the amino acid sequence of SEQ ID NO:2.

[0368] Paragraph 31. The method according to any one of claims 26 to 30, wherein the filamentous fungal host cell belongs to a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Monilia, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, and Trichoderma.

[0369] Paragraph 32. The method according to any one of claims 26 to 30, wherein the filamentous fungal host cell is a Trichoderma cell.

[0370] Paragraph 33. The method according to claim 32, wherein the Trichoderma cell is a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.

[0371] Paragraph 34. The method according to claim 32, wherein the Trichoderma cell is a Trichoderma reesei cell.

[0372] Paragraph 35. The method according to any one of claims 26 to 34, wherein the heterologous polypeptide of interest is an enzyme selected from the group consisting of hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase.

[0373] Paragraph 36. The method according to any one of claims 26 to 34, wherein the heterologous polypeptide of interest is acetylmannan esterase, acetylxylan esterase, aminopeptidase, α-amylase, arabinase, arabinofuranosidase, β-amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, coumarate esterase, cyclodextrin glycosyltransferase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, ferulic acid esterase, lytic polysaccharide monooxygenase, α-galactosidase, β-galactosidase, glucocerebrosidase, glucose oxidase, α-glucosidase, β-glucosidase, glucuronidase, glucuronate esterase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, mannanase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, phenol oxidase, polyphenol oxidase, proteolytic enzyme, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase or β-xylosidase.

Claims

1. An isolated variant Ire1 polypeptide, which comprises (a) an amino acid substitution at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) an amino acid substitution at the position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2, and has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:

2.

2. The variant Ire1 polypeptide according to claim 1, wherein the substitution at position 153 or the position corresponding to position 153 is Thr.

3. The variant Ire1 polypeptide according to claim 1, wherein Ala at position 153 or the position corresponding to position 153 is substituted with Thr.

4. The variant Ire1 polypeptide according to any one of claims 1 to 3, which further comprises Thr at position 150 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 or Thr at the position corresponding to position 150 in Trichoderma reesei Ire1 of SEQ ID NO:

2.

5. An isolated polynucleotide, which comprises a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at the position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2, and has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the amino acid sequence of SEQ ID NO:

2.

6. The polynucleotide according to claim 5, wherein the substitution at position 153 or the position corresponding to position 153 is Thr.

7. The polynucleotide according to claim 5, wherein Ala at position 153 or the position corresponding to position 153 is substituted with Thr.

8. The polynucleotide according to any one of claims 5 to 7, wherein the variant Ire1 polypeptide further comprises Thr at position 150 in the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 or Thr at the position corresponding to position 150 in Trichoderma reesei Ire1 of SEQ ID NO:

2.

9. A nucleic acid construct comprising the polynucleotide according to any one of claims 5 to 8.

10. A recombinant filamentous fungal host cell comprising and expressing a first polynucleotide encoding a secreted heterologous polypeptide of interest and a second polynucleotide comprising a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at the position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity to the amino acid sequence of SEQ ID NO:

2.

11. The recombinant filamentous fungal host cell according to claim 10, wherein the substitution at position 153 or the position corresponding to position 153 is Thr.

12. The recombinant filamentous fungal host cell according to claim 10, wherein Ala at position 153 or the position corresponding to position 153 is replaced by Thr.

13. The recombinant filamentous fungal host cell according to any one of claims 10 to 12, wherein the variant Ire1 polypeptide further comprises Thr at position 150 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 or Thr at the position corresponding to position 150 in Trichoderma reesei Ire1 of SEQ ID NO:

2.

14. The recombinant filamentous fungal host cell according to any one of claims 10 to 13, which belongs to a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Moniliophthora, Mucor, Myriococcum, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, and Trichoderma.

15. A method for producing a secreted heterologous polypeptide of interest, the method comprising the steps of: (a) culturing the recombinant filamentous fungal host cell according to any one of claims 10 to 14 under conditions suitable for producing and secreting the heterologous polypeptide; and optionally (b) recovering the secreted heterologous polypeptide of interest.

16. A method for improving the productivity or yield of a secreted heterologous polypeptide of interest in a filamentous fungal host cell, the method comprising the steps of: (a) providing a filamentous fungal host cell that comprises and expresses an ire1 gene encoding an Ire1 polypeptide; and (b) mutating the ire1 gene to provide a mutant ire1 gene encoding a variant Ire1 polypeptide, wherein (a) the variant Ire1 polypeptide comprises an amino acid substitution at position 153 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2; or (b) the variant Ire1 polypeptide comprises an amino acid substitution at a position corresponding to position 153 in Trichoderma reesei Ire1 of SEQ ID NO:2 and has at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity to the amino acid sequence of SEQ ID NO:

2.

17. The method of claim 16, wherein the substitution at position 153 or the position corresponding to position 153 is Thr.

18. The method of claim 16, wherein Ala at position 153 or the position corresponding to position 153 is replaced by Thr.

19. The method of any one of claims 16 to 18, wherein the variant Ire1 polypeptide further comprises Thr at position 150 of the Trichoderma reesei Ire1 polypeptide of SEQ ID NO:2 or Thr at a position corresponding to position 150 in Trichoderma reesei Ire1 of SEQ ID NO:

2.

20. The method of any one of claims 16 to 19, wherein the filamentous fungal host cell belongs to a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Moniliophthora, Mucor, Myriococcum, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, and Trichoderma.

Images