Natural gene deleted attenuated virus strain of infectious spleen and kidney necrosis virus and application of natural gene deleted attenuated virus strain

Abstract

The invention belongs to the technical field of viral vaccines, and particularly relates to a natural gene deleted attenuated virus strain of an infectious spleen and kidney necrosis virus and application of the natural gene deleted attenuated virus strain. According to the research team, a gene naturally deleted ISKNV attenuated strain NH-1398B is separated from the purchased siniperca chuatsi in a siniperca chuatsi in a siniperca chuatsi living experimental animal purchasing process. The genome of the strain is partially deleted from ORF102R and ORF104R, and is completely deleted from ORF103R. According to the invention, whole genome sequencing and toxicity determination are carried out on the NH-1398B strain, and the immune protection effect of the NH-1398B strain as an ISKNV vaccine is evaluated. Results show that the ISKNV NH-1398B strain has the characteristics of safety, high efficiency and low toxicity, and can be completely used for immunoprophylaxis of novel infectious spleen and kidney necrosis virus diseases.

Description

Technical Field

[0001] The present invention belongs to the technical field of virus vaccines, and in particular relates to a natural gene-deleted attenuated infectious spleen and kidney necrosis virus strain and its application. Background Art

[0002] Infectious Spleen and Kidney Necrosis Virus (ISKNV) is a double-stranded DNA virus belonging to the genus Megalocytivirus in the family Iridoviridae. It infects over 50 species of marine and freshwater fish, including mandarin fish (Siniperca chuatsi), large yellow croaker (Larimichthys crocea), and turbot (Scophthalmus maximus), causing significant economic losses to my country's fish farming industry. Vaccination is an effective means of preventing viral diseases in fish. Currently, there are many different vaccines available, but immersion vaccines have become a research hotspot for fish virus vaccine development due to their minimal damage to fish, labor-saving properties, and high efficiency.

[0003] Among related technologies, gene-deleted attenuated vaccines, because they retain viral activity, have greater potential for immunization via immersion. Previous studies have demonstrated that ISKNV gene-deleted attenuated vaccines offer excellent immune protection. For example, recombinant ISKNV gene-deleted vaccine strains, such as Δorf103r / tk, Δorf022l, and Δorf074, obtained through homologous homologous group technology, all have protection rates exceeding 95% against mandarin fish. However, due to the insertion of exogenous gene fragments into these recombinant ISKNV gene-deleted vaccine strains, further safety assessment is required. Therefore, naturally occurring attenuated ISKNV strains offer greater potential for application. Summary of the Invention

[0004] The purpose of the first aspect of the present invention is to provide an infectious spleen and kidney necrosis virus strain.

[0005] The purpose of the second aspect of the present invention is to provide the use of the infectious spleen and kidney necrosis virus strain of the first aspect of the present invention in the preparation of a drug or preparation for preventing and treating infectious spleen and kidney necrosis virus in fish.

[0006] The third aspect of the present invention is to provide a live vaccine against infectious spleen and kidney necrosis virus.

[0007] The fourth aspect of the present invention aims to provide a method for preparing the live vaccine of the third aspect of the present invention.

[0008] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0009] The first aspect of the present invention provides an infectious spleen and kidney necrosis virus strain.

[0010] In some embodiments of the present invention, the infectious spleen and kidney necrosis virus strain genome has a deletion of 1,398 bp from bp 91,059 to bp 92,456; the genome is NC_003494.1.

[0011] In some embodiments of the invention, the virus comprises the sequence shown in SEQ ID NO:7.

[0012] In some embodiments of the present invention, the infectious spleen and kidney necrosis virus strain is named infectious spleen and kidney virus ISKNV NH-1398B Infectious spleen and kidney necrosis virus, which was sent to the China Center for Type Culture Collection, No. 299, Bayi Road, Wuchang District, Wuhan City on January 16, 2025, and the preservation number is CCTCC NO: V202508.

[0013] The second aspect of the present invention provides the use of the infectious spleen and kidney necrosis virus strain of the first aspect of the present invention in the preparation of a drug or preparation for preventing and treating infectious spleen and kidney necrosis virus in fish.

[0014] In some embodiments of the invention, the fish comprises mandarin fish.

[0015] In some embodiments of the present invention, the medicament or formulation comprises a vaccine.

[0016] In some embodiments of the present invention, the drug or formulation includes a pharmaceutically acceptable excipient.

[0017] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, adhesives, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesives, integrities, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoaming agents, thickeners, inclusion agents, humectants, absorbents, diluents, flocculants and deflocculating agents, filter aids, release retardants, and carriers.

[0018] The above-mentioned pharmaceutically acceptable excipients are generally recognized for this purpose and as inactive ingredients of medicaments. A compilation of pharmaceutically acceptable excipients can be found in reference books such as the Handbook of Pharmaceutical Excipients (2nd edition, edited by A. Wade and PJ Weller; published by the American Pharmaceutical Association, Washington and The Pharmaceutical Gess, London, 1994); and the Pharmacopoeia of the People's Republic of China - List of Pharmaceutical Excipients.

[0019] The third aspect of the present invention provides a live vaccine against infectious spleen and kidney necrosis virus, wherein the live vaccine comprises the infectious spleen and kidney necrosis virus strain described in the first aspect of the present invention.

[0020] The fourth aspect of the present invention provides a method for preparing the live vaccine according to the third aspect of the present invention, comprising the following steps:

[0021] The infectious spleen and kidney necrosis virus strain described in the first aspect of the present invention is inoculated into host cells, cultured, and the virus liquid is collected.

[0022] In some embodiments of the present invention, the host cell comprises a mandarin fish cell.

[0023] In some embodiments of the present invention, the virus culture is collected, TCID50 is determined, and then directly diluted with DMEM culture medium to prepare a vaccine.

[0024] The beneficial effects of the present invention are:

[0025] While procuring live mandarin fish for experimental use, our research team isolated an attenuated ISKNV strain, NH-1398B, containing naturally occurring gene deletions. This strain's genome contains partial deletions in ORF102R and ORF104R, as well as a complete deletion in ORF103R. The present invention conducted whole-genome sequencing and virulence testing on the NH-1398B strain and evaluated its protective immune response as an ISKNV vaccine. The results demonstrated that the NH-1398B strain is safe, highly effective, and low in toxicity, making it fully suitable for the immunoprophylaxis of novel infectious splenorenal necrosis virus diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:

[0027] Figure 1 This is the first amplification result of ISKNV NH-1398B PCR identification.

[0028] Figure 2 This is the second amplification result of ISKNV NH-1398B PCR identification diagram.

[0029] Figure 3 Schematic diagram of the ISKNV NH-1398B gene deletion fragment.

[0030] Figure 4 Results of pathogenicity assessment of ISKNV NH-1398B.

[0031] Figure 5 These are the results of the potency evaluation of the ISKNV NH-1398B live vaccine. DETAILED DESCRIPTION

[0032] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0033] Example 1 Purification and Identification of Infectious Spleen and Kidney Necrosis Virus Gene Deletion Variant Virus

[0034] 1. Virus Isolation

[0035] (1) Obtaining diseased tissue: Weigh the diseased tissue and add phosphate buffered saline (PBS) at a weight to volume ratio of 1 g:5 mL to homogenize and grind. Centrifuge at 4000 rpm for 10 min and filter the supernatant with a 0.22 μm filter membrane.

[0036] (2) Inoculation of diseased material: 100 μl of the above supernatant was inoculated into MFF-1 cells that had grown into a monolayer. The cells were cultured in a medium dish and a normal cell control was set up. After adsorption for 2 hours in an incubator at 27°C and 5% CO2, the culture medium was aspirated and the cells were washed once with sterile PBS. Then, new DMEM culture medium was added and the cells were cultured in an incubator at 27°C and 5% CO2 for 7 days. After approximately 80% of the cells showed pathological changes, the cells were frozen and thawed at -80°C three times.

[0037] (3) Virus purification: The collected samples were diluted with DMEM medium in a 10-fold gradient to 10-10, and 10 -3 ~10 -10Eight dilutions of the diseased material were inoculated into a monolayer of MFF-1 cells in a 96-well cell culture plate. Eight wells were inoculated at each dilution, and eight uninoculated wells were set up as controls. The plates were incubated at 27°C in a 5% CO2 incubator for 7 days. The cells in the control wells were normal and free of disease. The culture medium from the well with the highest diseased dilution was collected for the first round of virus purification.

[0038] The first purified virus was inoculated into MFF-1 cells that had grown into a monolayer for proliferation. When the cytopathic effect reached about 80%, the virus was frozen and thawed three times. The supernatant was diluted 10-fold to 10-fold with DMEM medium. -10 , 10 -3 ~10 -10 Eight dilutions of the diseased material were inoculated into a monolayer of MFF-1 cells in a 96-well cell culture plate. Eight wells were inoculated at each dilution, and eight uninoculated wells were set up as controls. The cells were cultured in a 27°C, 5% CO2 incubator for 7 days. The cells in the control wells were normal and showed no disease. The culture medium from the well with the highest diseased dilution was collected for the second round of virus purification.

[0039] According to the above steps, the virus was purified once more, and the obtained disease material was the third purified virus, named infectious spleen and kidney necrosis virus NH-1398B strain, and the TCID 50 Then, store at -80℃.

[0040] (4) Virus content determination: The virus solution was diluted 10-fold with DMEM containing 10% fetal bovine serum. -1 to 10 -10 Ten dilutions were inoculated into 96-well MFF-1 monolayers, with 8 wells of each dilution inoculated, using 100 μL per well. Eight untreated control wells were also set up and incubated in a 27°C, 5% CO2 incubator for 72-120 hours. The number of wells showing cytopathic effect (CPE) was recorded. TCID was calculated using the Reed-Muench method. 50 .

[0041] 2. Virus identification

[0042] (1) PCR identification

[0043] Primer design: Based on the published ISKNV genome sequence (NC_003494.1), nested PCR primers were designed as follows:

[0044] Amplification primer: The amplified fragment size is 2534bp.

[0045] F: 5'-AGACCATTGCGTTCACTCCA-3' (primer 1F, SEQ ID NO: 1).

[0046] R: 5'-TGCCTATGGCGATACGTCTT-3' (primer 1R, SEQ ID NO: 2).

[0047] Second amplification primer: The amplified fragment size is 250bp.

[0048] F: 5'-CATGGACACTGTCAGACAACTG-3' (primer 2F, SEQ ID NO: 3).

[0049] R: 5'-CAACAGGAGAAGGACCGATGA-3' (primer 2R, SEQ ID NO: 4).

[0050] (2) PCR amplification

[0051] The viral DNA was extracted and used as a template, and the above two pairs of primers were used for PCR amplification and electrophoresis detection.

[0052] The results of the first PCR amplification of ISKNV NH-1398B were as follows Figure 1 As shown, the second amplification identification results are as follows Figure 2 As shown in Figure 2, it can be seen that the two amplifications can distinguish ISKNV NH-1398B from the wild-type ISKNV virus.

[0053] (2) Sequence analysis

[0054] Sequencing primers were designed with reference to the ISKNV genome sequence published in GenBank, and the sequence of the isolated virus was determined and analyzed.

[0055] The sequencing primers F: 5'-ATGGCAGCAAACCAGACCATTG-3' (SEQ ID NO: 5) and R: 5'-CTAGGCAAAATAGACACGTTGCAACAG-3' (SEQ ID NO: 6) for the amplified fragment had a size of 1283 bp.

[0056] The sequence identification results are as follows Figure 3 Compared with the reported infectious spleen and kidney necrosis virus genome (NC_003494.1), the natural gene deletion mutant has lost 1398 bp (91059 bp to 92456 bp). The sequence of the amplified ISKNV NH-1398B is:

[0057] ATGGCAGCAAACCAGACCATTGCGTTCACTCCACGCCACCAACACTCCAATGGCAT

[0058] GCTCCAGCACGTCATCTTTTCAGACGGCACCTGGAAGTGTACCATCACCGGCATGGTGT

[0059] TTGTGACCACTGGGACTGTACATGTGATGTACCGTGTGGTTACTGTGCCGCCCATCAGTG

[0060] GAGTGCGATGTGCGCGATTTTGTGTCACTGCACGCTGGGGCGCGCTCAAGGCTGTCTTG

[0061] CTACCACGCACGTGCATGGGACCTGCCCACATGCTTCGTGTGACTGCTGCGGGTGTTAG

[0062] TGTGATACGGGCCGTTGGGGCCACTGAGGCGCACATGGCACTGGATGGTGATCTCATGG

[0063] AATGGGTGTGCGAACCGCCATACGTGCACAATCGGTGTACCATCGCTGTGGTGTATGGC

[0064] ACTGCGGACCAGCTGCACCTCGATTGCATGATGCCCTTGTATCTGAATATGGTTACTGAC

[0065] CCCAATAGGCCTGACGACGATGGCGTTACACCTCTGATGCACGCCATACGCAACAAGTG

[0066] TGCTTACGTCACCGAGAGGCTGCTGTACGCACACTGCGTGGATGTGACCGTGGCCGACA

[0067] ATCAAGGGCGTACCGCATTGCACTGGGCTGTGCTATGGGACCAAACTCTGGCTGGCGAG

[0068] CTGATGTCGCGCGGCGCCAGCGTCAACGTTGGTGGCACCTGCACCCCGATGGACATGAT

[0069] ATTTACGGGACCCGACAGCGGACACCGTGCTGCAATGGCGCCGACGCACTCAGCAGAC

[0070] TGCGCGCTTGCAGCGCCCTTGTAACTATATGCTATGACGAGTACATGTCTGTGTCGTACA

[0071] GTAACCGACATCTGTGTGCCGCACACCTGCGACGTGACATTCTATCCAAGCCATGCCTCT

[0072] TCAGGCAACGGGTGTGGTGCGAGTGTGTACGTGCTGACCATAGGCGTCTAATACAGCCA

[0073] CAGGGCAATGCGATAATGTATGTGGATATTGATGTCACAATAAACGGAGTGCCTCACAAG

[0074] TGGCCGTGTCAAGAGGGTGTCTATTTCTTTATGGCAGCGTCTTCACGGGTGTTGCAAGTG

[0075] ATGCCGGCTGAGTGCGACGTGCTGACATTGGATAACATACAGCAAGTGTTGACAATGTC

[0076] ACATGCAAGACGTATCGCCATAGGCACACCACGGGTCATCATGGTGGGATACAGTCACG

[0077] GCCACGTGTACGCCCGCGCTCGGGGTAGTACACACATTCGGCGACAGAAGGTCCTTAACCAGATGCTGCTAATACTGTTGCAACGTGTCTATTTTGCCTAG (SEQ ID NO: 7).

[0078] Therefore, it was named infectious spleen and kidney necrosis virus ISKNV NH-1398B (ISKNV NH-1398B Infectious spleen and kidney necrosis virus). The virus was sent to the China Center for Type Culture Collection, No. 299, Bayi Road, Wuchang District, Wuhan City on January 16, 2025, and preserved with CCTCC NO: V202508.

[0079] Example 2 Virulence Evaluation of NH-1398B Strain

[0080] 1. Animal regression test

[0081] Siniperca chuatsi inoculation test: 25 healthy Siniperca chuatsi weighing 30-50 g were challenged with the isolated infectious spleen and kidney necrosis virus NH-1398B strain, with 100 μL (virus copy number 7.89×10 8 A control group of 25 fish were not challenged with the virus, and a positive control group of 25 fish were injected with WT ISKNV. The fish were observed for 21 days after the challenge, and the incidence and mortality of the fish were recorded.

[0082] 2. Experimental results

[0083] The results are as follows Figure 4 As shown, all the ISKNV wild-type virus group died on the 11th day, while the NH-1398B strain still maintained a survival rate of 76% on the 21st day, and its virulence was significantly reduced compared with the wild-type.

[0084] Example 3 Preparation of Injectable Live Vaccine (NH-1398B Strain) against Infectious Spleen and Kidney Necrosis Virus

[0085] 1. Preparation of virus seed for production: Take well-grown MFF-1 cells and inoculate them with the infectious spleen and kidney necrosis virus deletion mutant NH-1398B at an MOI of 0.01. Continue incubating at 27°C in a 5% CO2 incubator until approximately 80% of the cells develop lesions. Freeze and thaw at -80°C three times, filter through a 0.22μm filter membrane, and aliquot in fixed quantities. Label the harvest date, seed generation number, etc., and store frozen at -80°C.

[0086] 2. Semi-finished product inspection

[0087] Sterility test: Test according to the appendix of the current "Chinese Veterinary Pharmacopoeia", and there should be no sterile growth.

[0088] Genetic testing: Take 200 μL of viral liquid to extract DNA, use it as a template, and perform the first PCR test with primers 1F and 1R. The nucleic acid electrophoresis result should only show a band of 1136 bp and no band of 2534 bp. Then perform the second PCR test with primers 2F and 2R. The nucleic acid electrophoresis result should not show a band of approximately 250 bp.

[0089] 3. Dilution and packaging: dilute the virus solution with DMEM medium to ≥10 8 The suspension was divided into aliquots with batch and receipt date marked and stored at -80℃ until use.

[0090] Example 4 Evaluation of the potency of the injectable ISKNV NH-1398B live vaccine

[0091] 1. Vaccine quality inspection

[0092] The frozen virus solution of Example 3 was thawed and subjected to quality inspection.

[0093] Properties: The solution is clear without precipitation, and its color is red, similar to DMEM.

[0094] Sterility test: Tested according to the appendix of the current "Chinese Veterinary Pharmacopoeia", no bacteria growth was found.

[0095] Mycoplasma test: The test was carried out according to the appendix of the current "Chinese Veterinary Pharmacopoeia", and no mycoplasma growth was found.

[0096] Viral gene identification: Using the gene identification PCR test method, take 200μl of virus liquid to extract DNA, which is used as a template. Use primers 1F and 1R for the first PCR test. The nucleic acid electrophoresis result should only have a band of 1136bp and no band of 2534bp. Then use primers 2F and 2R for the second PCR test. The nucleic acid electrophoresis result should not have a band of about 250bp.

[0097] 2. Effectiveness test

[0098] The viral copy number was 7.89×10 8 The vaccine was administered intraperitoneally to 25 mandarin fish weighing approximately 30-50 g at a dose of 100 μL per fish. A control group of 20 fish was also established. Twenty-one days after immunization, the surviving mandarin fish, along with the control group, were challenged with infectious spleen and kidney necrosis virus (NH-2005 strain) at a dose of 100 μL per fish. The viral load was 6.68×10 7 copies / mL, and observed for 28 days after wild-type virus challenge.

[0099] The results are as follows Figure 5 As shown, all the control Siniperca chuatsi became ill and died on the 10th day, while the immunized Siniperca chuatsi were all protected.

Claims

1. An infectious spleen and kidney necrosis virus strain, characterized in that: The genome of the infectious spleen and kidney necrosis virus strain is missing 1398 bp from 91059 bp to 92456 bp; The genome is NC_003494.

1.

2. The infectious spleen and kidney necrosis virus strain according to claim 1, characterized in that: The virus comprises the sequence shown in SEQ ID NO:

7.

3. The infectious spleen and kidney necrosis virus strain according to claim 1, characterized in that: The infectious spleen and kidney necrosis virus strain is named ISKNV NH-1398B. It was sent to the China Center for Type Culture Collection, No. 299, Bayi Road, Wuchang District, Wuhan City on January 16, 2025, and the collection number is CCTCC NO: V202508.

4. Use of the infectious spleen and kidney necrosis virus strain according to any one of claims 1 to 3 in the preparation of a drug or preparation for preventing and treating infectious spleen and kidney necrosis virus in fish.

5. The use according to claim 4, characterized in that: The fish includes mandarin fish.

6. The use according to claim 4, characterized in that: The medicine or preparation includes pharmaceutically acceptable excipients.

7. The use according to claim 4, characterized in that: The medicine or preparation includes a vaccine.

8. A live vaccine against infectious spleen and kidney necrosis virus, characterized in that: The live vaccine comprises the infectious spleen and kidney necrosis virus strain as described in any one of claims 1 to 3.

9. The method for preparing the live vaccine according to claim 8, characterized in that: The infectious spleen and kidney necrosis virus strain according to any one of claims 1 to 3 is inoculated into host cells, cultured, and the virus liquid is collected.

10. The preparation method according to claim 9, characterized in that: The host cell includes a mandarin fish cell.

Images