Gene ZmER2 for regulating corn pollen activity and application

By cloning and mutating the maize receptor kinase gene ZmER2, a recombinant vector was constructed and mutations were introduced into maize, solving the problem of pollen activity regulation, improving breeding efficiency and seed purity, and reducing breeding costs.

CN120041472BActive Publication Date: 2026-02-06SHANDONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311592383.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-27
Publication Date
2026-02-06
Estimated Expiration
2043-11-27

AI Technical Summary

Technical Problem

Existing technologies lack effective means to regulate maize pollen activity, especially in the process of using male sterility for seed production, which leads to problems such as wasted labor and decreased seed purity.

Method used

By cloning the maize receptor kinase-encoding gene ZmER2 and its mutants Zmer2-D17 and Zmer2-I1, a recombinant expression vector pk7FWG2-35S-ER2-EGFP was constructed. Non-natural mutations were then introduced into maize using CRISPR technology to regulate pollen activity and achieve a phenotype of non-pollen shedding from the tassel.

Benefits of technology

This method effectively regulates pollen activity without affecting plant height and ear row number, thereby improving the efficiency and seed purity of maize breeding and reducing breeding costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120041472B_ABST
    Figure CN120041472B_ABST
Patent Text Reader

Abstract

The application discloses a corn receptor kinase-encoding gene ZmER2, wherein the CDS sequence of the gene is shown as SEQ ID No.1.The application also discloses corn mutants containing the gene ZmER2, which are named mutant Zmer2-D17 and mutant Zmer2-I1 respectively, wherein the CDS nucleotide sequence of the mutant Zmer2-D17 is shown as SEQ ID No.3, and the amino acid sequence of the gene is shown as SEQ ID No.4; the CDS nucleotide sequence of the mutant Zmer2-I1 is shown as SEQ ID No.5, and the amino acid sequence of the gene is shown as SEQ ID No.6.The application also discloses that after the gene ZmER2 is mutated, a male spike non-powdering phenotype appears without affecting plant height, ear position height and ear row number and other yield characters, the phenotype is valuable material for studying pollen development, cytoplasmic inheritance and nucleo-cytoplasmic interaction, and indicates that the ZmER2 gene has a good application prospect in hybrid seed production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of plant bioengineering breeding and molecular biology technology. Specifically, it relates to a maize receptor kinase-encoding gene ZmER2 and its application in pollen fertility. Background Technology

[0002] Maize (Zea mays), as an important food and feed crop, is considered one of the world's "three major staple foods" along with rice and wheat. It is widely cultivated in northern my country, the Huang-Huai-Hai Plain, and southwestern regions, with the largest cultivation area among the three crops. Maize yield plays a crucial role in my country's food security, and increasing maize production will provide an important guarantee for my country's food security and economic development. Due to a declining labor force and increasing crop breeding costs, hybridization using maize's male-sterile and female-fertile characteristics is now widely used for hybrid vigor utilization and population improvement in crops. This can save labor, further reduce crop cultivation costs, and provide a good guarantee for the development of maize hybrid seed production.

[0003] The transition from vegetative to reproductive growth is one of the most important developmental processes in plant life. In maize, this process produces two distinct inflorescences. The most significant morphological difference is that the female inflorescence has an unequal number of long branches at its base, absent in the male inflorescence. Both inflorescences first form a pair of short branches called spikelets, characterized by external and internal glumes surrounding an unequal number of florets. Each spikelet is divided into an upper and lower floret, each consisting of a lemma and palea, two lemma cells, three stamens, and a central pistil composed of three fused carpels surrounding a single ovule. When the pistil development ceases during floret development, a male inflorescence is produced. Similarly, when stamen development ceases, a female inflorescence is produced, ultimately resulting in monoecious plants with distinct male and female inflorescences. During this inflorescence transition, the shoot apical meristem (SAM) transforms into the male inflorescence meristem (IM), eventually forming the male inflorescence. Anther development in maize begins at the stamen primordium. The outer layer (L1) forms the epidermis, and the inner layer (L2) differentiates into primary wall cells (PPCs) and primordial cells (Ars). PPCs divide around the periphery to form endothelial cells (EN) and secondary wall cells (SPCs) adjacent to the ARs. SPCs then divide periaperially to form the mesonephros (ML) and tapetum (T). The most prominent anther cell layer is the tapetum, a layer of metabolically active cells that encloses the developing pollen. Pollen development consists of three main stages: (1) microsporogenesis (differentiation and meiosis of sporogenous cells); (2) post-meiotic development of microsporocytes; and (3) microsporogenesis. Sporogenous cells (pollen mother cells or meiotic cells) are enclosed in callosine walls derived from the tapetum and undergo meiosis to form tetrads of tetraploid microsporocytes. This callosal layer is essential for the development and formation of the pollen wall support. It then breaks down, releasing microspores into the anther chamber, initiating male gametophyte development. This involves two cycles of mitosis, producing the final trinuclear pollen grain. The final mitosis occurs within the pollen tube. The anther filaments rapidly elongate, and then the flower and anther open, allowing for the efficient release of pollen.

[0004] In the production of hybrid maize seeds, using male-sterile seed production not only saves a significant amount of labor but also avoids the yield reduction caused by incomplete emasculation of the female parent, which leads to decreased seed purity. A search revealed no literature reports on the receptor kinase gene ZmER2 and its application in regulating pollen activity. Summary of the Invention

[0005] In view of the current research status, the purpose of this invention is to provide a maize receptor kinase-encoding gene ZmER2 and its application in regulating pollen activity.

[0006] The maize receptor kinase gene ZmER2 of the present invention is characterized in that: the CDS nucleotide sequence of the gene ZmER2 is shown in SEQ ID No.1, and its protein coding sequence is shown in SEQ ID No.2, which is unrelated to the gene cloning method.

[0007] Given that those skilled in the art can easily modify or mutate the nucleotide sequence of the gene described in this invention through methods such as targeted optimization or point mutation, those nucleotide sequences that, after artificial modification, have a homology of ≥85% with the gene CDS sequence provided by this invention and still have the function of the gene are all sequence derivatives of the gene described in this invention, equivalent to the sequence described in this invention, and fall within the protection scope of this patent.

[0008] The present invention also provides a recombinant expression vector containing the above-mentioned gene ZmER2.

[0009] Wherein: the recombinant expression vector uses pk7FWG2-EGFP as the receptor vector, and the recombinant expression vector contains the complete open reading frame (ORF) sequence shown in SEQ ID No. 1.

[0010] A preferred embodiment is that the expression vector containing the above-mentioned maize receptor kinase encoding gene ZmER2 is pk7FWG2-35S-ER2-EGFP.

[0011] The application of the maize receptor kinase-encoding gene ZmER2 described in this invention in pollen fertility research.

[0012] This invention discloses maize mutants containing the above-mentioned gene ZmER2, named mutant Zmer2-D17 and mutant Zmer2-I1, respectively. The mutant Zmer2-D17 has a CDS nucleotide sequence as shown in SEQ ID No. 3 and an amino acid sequence as shown in SEQ ID No. 4. The mutant Zmer2-I1 has a CDS nucleotide sequence as shown in SEQ ID No. 5 and an amino acid sequence as shown in SEQ ID No. 6.

[0013] The mutants Zmer2-D17 and Zmer2-I1 have a deletion of 17 bases and an insertion of one T base in the LRR domain, which leads to premature termination of translation.

[0014] This invention relates to the application of the ZmER2 gene mutant in maize for regulating pollen activity and in breeding. The application is achieved by mutating the ZmER2 gene in the crop.

[0015] This invention provides a maize mutation site containing two non-naturally occurring mutation sites within the ZmER2 gene, wherein the mutations are substitutions, insertions, deletions, or transversions introduced using an editing system.

[0016] The present invention provides a method for producing / cultivating non-GMO edited maize plants, comprising: hybridizing the maize plant of the present invention with a wild-type maize plant to introduce at least one non-natural mutation into the wild-type maize plant; and selecting offspring maize plants containing the at least one non-natural mutation and being non-GMO to produce non-GMO edited maize plants.

[0017] This invention provides a maize plant exhibiting a phenotype of shriveled and inactive pollen, and discloses the application of the aforementioned receptor-like kinase gene ZmER2 in regulating breeding. The function of the maize ZmER2 gene provided by this invention has not been previously reported. This gene encodes a receptor-like kinase (LRR-RLK) rich in leucine repeat sequences, possessing both an extracellular LRR domain and an intracellular kinase domain. By testing ZmER2 loss-of-function mutants, the applicant found that while the mutants did not affect yield traits such as plant height, ear height, or number of ear rows, they exhibited a phenotype of non-pollen shedding from the tassel. This phenotype plays an important role in hybrid seed production. The main value and beneficial effects of this invention are:

[0018] 1) The maize receptor kinase-encoding gene ZmER2 was cloned using molecular biology techniques. The CDS sequence of this gene is shown in SEQ ID No.1. At the same time, mutants of this gene with different mutation types, Zmer2-D17 and Zmer2-I1, were obtained, providing new candidate gene resources for crop breeding and genetic improvement.

[0019] 2) An expression vector pk7FWG2-35s-ZmER2-EGFP containing the maize receptor kinase-encoding gene ZmER2 was constructed. Transforming this vector into tobacco confirmed that ZmER2 is located in the cell membrane. Phenotypic analysis of ZmER2 showed that the mutant does not affect yield phenotypes such as plant type and number of ear rows, but it does affect pollen shedding from the male inflorescence. Analysis of pollen activity and morphology revealed that the ZmER2 mutant pollen was inactive and exhibited a shriveled phenotype. This gene has great application potential in crop fertility.

[0020] Of course, any product implementing this invention does not necessarily need to achieve all of the technical effects described above at the same time. Attached Figure Description

[0021] Figure 1 Schematic diagram of the structure of the plant expression vector pk7FWG2-35s-ZmER2-EGFP.

[0022] Figure 2 PCR identification results of positive colonies obtained by transforming plasmid pk7FWG2-35s-ER2-EGFP into Agrobacterium.

[0023] Where M represents the molecular weight marker DL2000; lanes 1-8 represent the PCR identification results of positive strains obtained by introducing the pk7FWG2-35s-ZmER2-EGFP plasmid into Agrobacterium. The upstream primers used were those on the vector, and the downstream primers were those on the gene.

[0024] Figure 3 This refers to the ZmER2 expression pattern analysis in this invention, which shows the subcellular localization of ZmER2 in tobacco.

[0025] Figure 4 : Structure diagram of the maize ZmER2 protein in this invention.

[0026] Figure 5 In this invention, the mutant Zmer2 mutation sites and its allelic mutation sites are described, where Zmer2-D17 and Zmer2-I1 represent two mutation types, respectively.

[0027] Figure 6 The images show the phenotype of the Zmer2-D17 mutant of this invention; the comparison of the phenotypes of the plant (A), female ear (B), and ear leaf (C) is shown. The left side of each image represents the wild type, and the right side represents the mutant Zmer2-D17.

[0028] Figure 7 : This is a comparison of the morphology of male spikelets in this invention. A is the wild type; B is Zmer2-D17.

[0029] Figure 8 :This is a comparison of pollen morphology in this invention. A and B represent scanning electron microscopy images of the phenotypic differences between the wild type and the mutant Zmer2-D17, respectively.

[0030] Figure 9 In this invention, the pollen activity differences are as follows: A represents the wild type; B represents Zmer2-D17. Detailed Implementation

[0031] The present invention will be further described below through specific embodiments. However, the examples described below are only preferred embodiments of the present invention and are not intended to limit the present invention in any way. Any simple modifications, equivalent changes and alterations made to the embodiments based on the technical essence of the present invention shall fall within the scope of the technical solution of the present invention.

[0032] Unless otherwise specified, the methods described in the following examples are all conventional experimental methods. Unless otherwise specified, the reagents, vectors, and strains involved are all obtained from well-known commercial channels.

[0033] Example 1: Genotyping of mutants

[0034] The genome sequence of the ZmER2 gene was obtained by searching the MaizeGDB database (https: / / www.maizegdb.org / ) using the sequence number Zm00001d018261. After the maize germinated, leaf DNA was extracted using the following method:

[0035] 1) Take a tender, fresh corn leaf about 1 cm long, put it into a 2 mL centrifuge tube, add 2 steel balls to the centrifuge tube, set the sampler to 50 Hz, 1 min, and sample twice.

[0036] 2) Perform the operation inside a fume hood, adding 500 μL of DNA extraction solution to each tube;

[0037] 3) Next, add 400 μL of phenol-chloroform to each tube (after standing and separating the layers, take the lower layer of chloroform for use), shake to mix well, and place on a shaker at 120 rpm to mix thoroughly.

[0038] 4) Centrifuge at 12000 rpm at room temperature for 10 min, and add 300 μL of the clear supernatant to a new 1.5 mL centrifuge tube;

[0039] 5) Add 30 μL of 3M sodium acetate (pH 5.2) solution and mix by inverting.

[0040] 6) Add 330 μL of isopropanol, slowly invert several times to mix thoroughly, and let stand at room temperature for 5 minutes.

[0041] 7) Centrifuge at 12,000 rpm for 5 minutes at room temperature, then discard the supernatant;

[0042] 8) Add 500 μL of 70% ethanol, invert several times, centrifuge at 12000 rpm for 5 min, and discard the supernatant.

[0043] 9) Repeat step (8).

[0044] 10) Place the centrifuge tubes in a ventilated area and let the liquid evaporate completely.

[0045] 11) Add 50 μL of sterile water containing RNase or 1×TE. Place in a 60°C oven for 30 min, then temporarily store at 4°C or store at -20°C.

[0046] Primers were designed at both ends of the knockout site for amplification. PCR amplification primers were designed using DNAMAN software.

[0047] The upstream primer is 5'-ACTGGAGAAATCCCGTTCAA-3';

[0048] The downstream primer is 5'-TGTTGTTTGCAAGGTTCCTG-3'

[0049] The first generation of plants obtained by knockout were confirmed by first-generation sequencing to determine the nucleotide insertion and deletion. Further analysis can be conducted via the website (http: / /

[0050] ( / / indcaps.kieber.cloudapps.unc.edu / ) Design dCAPs primers to identify genotypes. Select two different allelic mutations for planting, and subsequent generations can be identified by designing dCAPs primers.

[0051] Example 2: Cloning of the maize receptor kinase-encoding gene ZmER2

[0052] 1) The cDNA sequence of the ZmER2 gene was obtained by searching the MaizeGDB database (https: / / www.maizegdb.org / ) based on the sequence number Zm00001d018261. This cDNA sequence was then used for primer design and screening for gene cloning.

[0053] 2) Based on the above sequences, design PCR amplification primers using DNAMAN software.

[0054] upstream primer

[0055] 5'GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGGCCCGCTCCTCCGG 3';

[0056] Downstream primer

[0057] 5'GGGGACCACTTTGTACAAGAAAGCTGGGTATTCCGTGCTCCCGCGAGATC 3'.

[0058] 3) Take leaves from B73 corn seedlings and shoot tip meristems (SAM) from B73 plants approximately 2 weeks after planting, and place them in RNase-free 1.5 mL centrifuge tubes. Add two small steel balls to each tube. Quickly freeze the centrifuge tubes in liquid nitrogen. Set the sampler to 35 Hz and 30 s for multiple samples, refreezing in liquid nitrogen after each sample until the samples are pulverized. Extract RNA using a polysaccharide and polyphenol plant total RNA extraction kit (TIANGEN DP441). The 1st Strand cDNA Synthesis Kit (+gDNAwiper) (Vazyme, R312-01 / 02) was used for reverse transcription to obtain a cDNA template for cloning the ZmER2 gene. The reaction system is as follows:

[0059] The reaction system is shown below:

[0060] 1) Genomic DNA removal: Add the following components to an RNase-free PCR tube, gently pipette to mix, and incubate at 42°C for 2 min.

[0061]

[0062] 2) Add 4 μL of 5x HiScript III qRT SuperMix to the tube, and set up the PCR instrument according to the following program to perform the reverse transcription reaction.

[0063]

[0064] 3) The obtained cDNA can be stored at -20℃ for later use, or stored at -80℃.

[0065] The recombinant expression vector is a recombinant plasmid pk7FWG2-35S-ER2-EGFP containing the receptor kinase gene ZmER2. Its construction method is as follows: gene amplification primers were designed according to the Gateway instructions; the inserted fragment was amplified; and PCR was performed using B73 shoot apical meristem cDNA as a template, following the amplification system and procedure specified in the P505 Novizan reagent instructions.

[0066] PCR reaction system:

[0067]

[0068] PCR reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 3 min, 36 cycles; 72℃ extension for 10 min.

[0069] The obtained PCR products were purified using a D2500-02 Omega agarose gel extraction kit, and the concentration of the purified PCR products was measured. After purification, the PCR products were subjected to a BP reaction according to ThermoFisher (11789100), and the required amount of PCR product was calculated using the following formula:

[0070] Product ng = (X fmoles)(N)(660fg / fmoles)(1ng / 10 6 fg)

[0071] The cells were transformed into competent cells, and colony PCR was performed the next day. Single colonies were labeled and placed on plates. Half of each single colony was picked with a sterile toothpick and subjected to colony PCR according to the following system and procedure. The same procedure was performed on areas of the plate where no colonies had grown, serving as a negative control. Next, colonies with the correct band size were selected using 1% agarose gel electrophoresis. The other half of the colonies were picked and cultured, and the bacterial culture was sent for sequencing. After successful sequencing, the plasmid was extracted and subjected to an LR reaction using a Thermo Fisher Scientific (11791020). Colony PCR and sequencing were then performed to confirm the results. The vector containing the SEQ ID No. 1 nucleotide sequence forward-ligated into pk7FWG2-EGFP was identified, which is the constructed recombinant plasmid pk7FWG2-35S-ER2-EGFP.

[0072] Example 3: Transformation of *Agrobacterium tumefaciens* pk7FWG2-35S-ER2-EGFP in maize using GV3101

[0073] Transformation of Agrobacterium competent cells: Remove Agrobacterium competent cells GV3101 from the -80℃ freezer, thaw on ice, add 2 μL of plasmid to 25 μL of competent cells, mix gently, incubate in ice water for 10 min, flash freeze in liquid nitrogen for 5 min, incubate at 37℃ for 5 min, incubate in ice water for 5 min, under aseptic conditions, add 1 ml of antibiotic-free LB medium, incubate at 28℃ for 90 min, centrifuge at 8000 rpm for 1 min, discard the supernatant, and plate 100 μL onto antibiotic-containing medium. Incubate upside down at 28℃ for 2-3 days. After 2 days, pick bacteria and perform colony PCR verification. Inoculate a single Agrobacterium colony into 5 mL of antibiotic-containing LB medium, incubate at 28℃ and 200 rpm for approximately 36 h, and verify band size using colony PCR.

[0074] Example 4: CRISPR method to knock out ZmER2 gene

[0075] The gene transcript was confirmed on the maizeGDB website. Target sites were designed using CRISPR-P2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ), with the snoRNA promoter selected as U6, a guide length of 20, the maize genome selected, and gene number Zm00001d018261 entered. Submission was then performed. Guide sequences starting with G were selected, and from all given guide sequences, those with high on-scores and low off-scores were chosen. The sequence location was also selected within the coding sequence (CDS) region, ideally within the 1 / 3 to 2 / 3 of the protein's important functional domains. This invention identified multiple gene editing types, and two of them, Zmer2-D17 and Zmer2-I1, were selected for phenotypic analysis.

[0076] The CDS nucleotide sequence of the mutant Zmer2-D17 is shown in SEQ ID No. 3, and the amino acid sequence of the gene is shown in SEQ ID No. 4. The CDS nucleotide sequence of the mutant Zmer2-I1 is shown in SEQ ID No. 5, and the amino acid sequence of the gene is shown in SEQ ID No. 6.

[0077] Example 5: Scanning electron microscopy observation of maize pollen morphology

[0078] 1) Sample preparation: Take a sample of about 1mm3 and cut it with a sharp blade. Do not pull or stretch it to prevent mechanical damage.

[0079] 2) Fixation: Quickly add 2.5% glutaraldehyde (prepared with 1X PBS) and fix in a 4°C refrigerator for 3 hours (the time can be adjusted according to the sample size), then remove the supernatant. After that, wash three times with 1X PBS for 15 minutes each time, and remove the supernatant. If the plant sample floats, this can be resolved by aspiration.

[0080] 3) Dehydration: Dehydrate the sample with an ethanol-water solution at concentration gradients of 30%, 50%, 70%, 80%, and 90%, each step lasting about 15 minutes. Discard the supernatant, and then dehydrate in 100% ethanol for 15 minutes, repeating twice.

[0081] 4) Critical point dryer drying: Transfer the sample to a sample basket and place it in a critical point dryer for drying.

[0082] 5) Then, the sample was sputtered with gold using an ion sputtering instrument and observed.

[0083] This invention found that, under scanning electron microscopy, the pollen morphology of the mutant Zmer2 is shrunken compared to the wild type.

[0084] Example 6: Determination of pollen viability using iodine-potassium iodide

[0085] First, prepare an iodine-potassium iodide solution: Dissolve 1.3g of potassium iodide in water, then add 0.3g of iodine crystals, and bring the volume to 100mL. Place a small amount of pollen on a clean glass slide, add 2 drops of the iodine-potassium iodide solution, and observe under a microscope. Since most normal mature pollen grains of plants are spherical and accumulate a large amount of starch, I2-KI solution can stain them deep blue. Poorly developed pollen grains are often deformed, often lacking starch or accumulating very little starch, and I2-KI solution stains them yellowish-brown. This invention utilizes iodine-potassium iodide staining. Wild-type pollen is in a normal state and can be stained deep blue by iodine-potassium iodide, while mutant pollen is yellow, indicating that the pollen is not active.

Claims

1. The use of a maize receptor-like kinase-encoding gene ZmER2 in pollen fertility, characterized in that: The CDS nucleotide sequence of the gene ZmER2 is shown as SEQ ID No. 1, and the amino acid sequence is shown as SEQ ID No. 2; the ZmER2 gene is knocked out by the CRISPR method, and the pollen is not active. ​