Molecular marker for identifying chicken feed utilization trait based on lmod2 gene and its identification method and application

By using SNP molecular markers based on the LMOD2 gene, PCR amplification and enzyme digestion detection were used to identify feed utilization traits in chickens, solving the problem of improving feed efficiency in poultry breeding, enabling early selection of high-quality chicken breeds and reducing feed costs.

CN120041578BActive Publication Date: 2025-12-12ANHUI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510096728.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-22
Publication Date
2025-12-12
Estimated Expiration
2045-01-22

AI Technical Summary

Technical Problem

In existing technologies, the improvement of feed efficiency in poultry is limited, conventional phenotypic breeding is progressing slowly, and it is difficult to identify feed utilization traits in chickens at an early stage, resulting in high feed costs.

Method used

This study developed SNP molecular markers based on the LMOD2 gene, and used PCR amplification and enzyme digestion with designed specific amplification primers, combined with agarose gel electrophoresis detection, to identify feed utilization traits in chickens, providing a simple, rapid, and low-cost breeding method.

Benefits of technology

It enables early selection of high-quality chicken breeds, improves feed utilization, reduces feed costs, and is suitable for the needs of molecular marker-assisted breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120041578B_ABST
    Figure CN120041578B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of molecular marker based on LMOD2 gene identification chicken feed utilization character and its identification method and application, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein, the base of the nucleotide sequence in the 311th position is A or G.The present application establishes a kind of poultry feed utilization early selection breeding method by identifying the type of the molecular marker present in chicken genome, according to genotype, the feed utilization character of chicken is selected, the method is simple, fast, low cost, does not need special instrument, is suitable for the needs of molecular marker assisted breeding experiment.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers, and particularly relates to a molecular marker for identifying a chicken feed utilization trait based on an LMOD2 gene and an identification method and application thereof. BACKGROUND

[0002] Feed costs account for about 60-70% of the total cost in the process of poultry production, and the feed efficiency of poultry during growth and development is only 65-70%, so improving the feed efficiency of poultry is an important way to save costs. Due to limited land resources, and grains such as corn and soybean meal are not only one of the sources of human food, but also the main components of livestock and poultry feed, so as the scale of the livestock and poultry industry continues to grow, the cost of feed continues to rise. Therefore, for livestock and poultry breeding, the feed efficiency trait is a major economic trait that needs to be maximized. Although feed conversion rate has been greatly improved, at most 65-70% of the feed is used for maintenance and production, and the rest is excreted as waste. Therefore, improving feed efficiency is crucial for reducing production costs and saving expensive feed components for various other purposes. Currently, two key indicators for evaluating feed efficiency traits are feed conversion rate (FCR) and residual feed intake (RFI).

[0003] LMOD2 (Leiomodin 2) is a gene that encodes an important protein in smooth muscle cells, which plays a key role in muscle contraction and cytoskeleton organization. Since LMOD2 is related to intermediate filament organization in smooth muscle and non-muscle cells, it affects feed efficiency by affecting muscle tissue development and function. The health and function of muscle tissue have important effects on animal movement, energy consumption, and metabolism. If the LMOD2 gene is mutated or expressed abnormally, it may affect the normal function of muscle, and in turn affect the animal's utilization of feed and energy metabolism. Muscle growth and development require a large amount of energy and nutrients. If the LMOD2 gene is mutated or expressed abnormally, it may affect the normal division, differentiation, and proliferation of muscle cells, leading to poor muscle development or slow growth. This will increase the animal's demand for feed during growth and development, but the feed conversion efficiency will be reduced, because more feed is used for basic life activities, rather than for muscle growth and development. The contractile function of muscle is crucial for physiological processes such as animal movement, digestion, and metabolism.

[0004] Therefore, the LMOD2 gene can be an important candidate gene affecting chicken feed efficiency. At present, the research on the LMOD2 gene is mainly concentrated in mice, fish and humans, and the research on poultry is less. The research content is mainly concentrated in muscle development. In-depth study on the influence of LMOD2 gene variation and expression on the feed conversion rate of broilers and its molecular mechanism has important practical significance for improving the feed efficiency of broilers and reducing the breeding cost of broilers.

[0005] "Huibei chicken" is an excellent local chicken breed in Suzhou City, Anhui Province, and is also an important raw material for the production of geographical indication product Shuli set chicken. "Huibei chicken" has strong adaptability, can survive and reproduce in various environmental conditions, and based on the above content, a molecular marker for identifying chicken feed utilization traits based on LMOD2 gene and an identification method and application thereof are provided. SUMMARY

[0006] The purpose of the present application is to provide a molecular marker for identifying chicken feed utilization traits based on LMOD2 gene and an identification method and application thereof. Compared with the prior art, the SNP (single nucleotide polymorphism) molecular marker related to the candidate gene (LMOD2 gene) of the feed utilization traits of the chicken is developed to solve the problem that the conventional phenotype breeding is slow in progress, and to realize early identification of the feed utilization traits.

[0007] The present application realizes the above-mentioned purpose through the following technical solutions:

[0008] The present application provides a molecular marker for identifying chicken feed utilization traits based on LMOD2 gene, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein the base at position 311 of the nucleotide sequence is A or G.

[0009] The present application also provides a molecular marker for identifying chicken feed utilization traits based on LMOD2 gene in the identification of chicken feed utilization traits.

[0010] As a further optimization scheme of the present application, if the type of the chicken molecular marker to be tested is GG, the chicken feed utilization trait is best; if the type of the chicken molecular marker to be tested is AG, the chicken feed utilization trait is medium; and if the type of the chicken molecular marker to be tested is AA, the chicken feed utilization trait is poor.

[0011] The present application also provides a method for identifying chicken feed utilization traits by using a molecular marker, comprising the following steps:

[0012] (1) Extracting total DNA of chicken wing vein blood;

[0013] (2) taking the sequence of the locus where the molecular marker is located and the upstream and downstream base groups thereof as a target sequence to design specific amplification primers, taking the total DNA as a template, and utilizing the specific amplification primers to perform PCR amplification to obtain an amplification product;

[0014] (3) performing genotyping detection and sequencing on the amplification product to obtain the molecular marker type of the chicken to be tested;

[0015] (4) judging the chicken feed utilization rate trait according to the molecular marker type;

[0016] if the molecular marker type of the chicken to be tested is GG, the chicken feed utilization rate trait is the best;

[0017] if the molecular marker type of the chicken to be tested is AG, the chicken feed utilization rate trait is medium;

[0018] if the molecular marker type of the chicken to be tested is AA, the chicken feed utilization rate trait is poor.

[0019] As a further optimization scheme of the present application, the sequence of the specific amplification primer is:

[0020] SEQ ID NO. 2: Forward primer: TTTCAGGCTTGTTACAGGAC;

[0021] SEQ ID NO. 3: Reverse primer: AGAAAAGGAGGAAGAAACCA.

[0022] As a further optimization scheme of the present application, the genotyping detection method is to obtain an enzyme digestion product by enzyme digestion of the amplification product, to detect the enzyme digestion product by agarose gel electrophoresis, to perform genotyping according to the image, and if the enzyme digestion product:

[0023] contains one band, it is GG type;

[0024] contains two bands, it is AA type;

[0025] contains three bands, it is AG type.

[0026] As a further optimization scheme of the present application, the enzyme digestion product is detected by agarose gel electrophoresis with a concentration of 1.5%-2.0%.

[0027] The present application has the following beneficial effects:

[0028] The application provides the nucleotide sequence of the molecular marker, as shown in SEQ ID NO. 1, wherein the base at the 311th position of the nucleotide sequence is A or G, and the application establishes a poultry feed utilization early selection breeding method by identifying the type of the molecular marker existing in the chicken genome, and selecting the feed utilization trait of the chicken according to the genotype, which is simple, rapid, low-cost, does not need special instruments, and is suitable for the needs of molecular marker assisted breeding experiments. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 It is an agarose gel electrophoresis diagram of PCR amplification products of part of samples;

[0030] Figure 2 It is an agarose gel electrophoresis diagram of enzyme digestion products of part of sample PCR amplification products obtained by enzyme digestion;

[0031] Figure 3 It is a genotype verification sequencing result of the A311G site (the 311th site in SEQ ID NO. 1) in the chicken LMOD2 gene. DETAILED DESCRIPTION

[0032] The application will be further described in detail below in combination with the drawings, and it is necessary to point out here that the following detailed description is only used to further illustrate the application, and cannot be understood as limiting the protection scope of the application, and the skilled in the art can make some non-essential improvements and adjustments to the application according to the above application content.

[0033] 1. Materials

[0034] The method used in the embodiment is a conventional method known by the skilled in the art, and the reagents and materials used are commercially available products, unless otherwise specified.

[0035] 2. Method

[0036] 2.1 Primer design

[0037] The DNA sequence corresponding to the LMOD2 gene as shown in SEQ ID NO. 1 is found from the chicken genome database, and the specific amplification primer is designed by taking the DNA partial sequence of the LMOD2 gene (including the sequence composed of the site of the polymorphic molecular marker and the upstream and downstream bases thereof) as a template, and the specific amplification primer sequence is as follows:

[0038] SEQ ID NO. 2: Forward primer: TTTCAGGCTTGTTACAGGAC;

[0039] SEQ ID NO. 3: Reverse primer: AGAAAAGGAGGAAGAAACCA.

[0040] The length of the amplifiable region of the primer is 516 bp, and the sequence is shown in SEQ ID NO. 4, which contains a molecular marker of A311G site (A / G mutation at position 311 in SEQ ID NO. 1).

[0041] 2.2 Extraction of total DNA from blood

[0042] Select 450 Huaibei bantams, take blood from the wing vein, extract total DNA from blood, use the blood DNA extraction kit produced by Tiangeng Biological Technology Co., Ltd. to extract total DNA from chicken wing vein blood samples, and the extraction steps are performed according to the kit instructions.

[0043] 2.3 PCR amplification

[0044] Use Mix produced by Shanghai Yisheng Biological Company to perform PCR amplification reaction on the target fragment of LMOD2 gene by synthesized sequencing-specific primers, and the PCR amplification system is shown in Table 1:

[0045] Table 1 PCR amplification system

[0046]

[0047] The PCR reaction conditions are: 94℃ pre-denaturation for 5min; first step 94℃ denaturation for 30s; second step 53℃ annealing for 30s (annealing temperature is set according to the primer); third step 72℃ extension for 30s, wherein the second step to the third step is cycled for 34 times, a total of 35 cycles; 72℃ extension for 10min.

[0048] 2.4 Detection and sequencing of PCR amplification product

[0049] Use 2% mass ratio agarose gel electrophoresis to detect PCR amplification product, as shown in Figure 1 After imaging in the gel imaging instrument, a band with a length of approximately 516bp is obtained, which is consistent with the predicted length, indicating that the target fragment is obtained. Send the PCR product to Beijing Qikong Biological Technology Co., Ltd. (Nanjing), and the sequence is shown in SEQ ID NO. 4, which is consistent with the predicted result.

[0050] 2.5 Genotyping

[0051] 2.5.1 Configure the enzyme digestion system as shown in Table 2, and the enzyme digestion conditions are 37℃ constant temperature for 12-16 hours, use Pst I restriction endonuclease produced by Hefei Ruijie Biological Technology Co., Ltd. to digest the PCR amplification product;

[0052] Table 2 Enzyme digestion system

[0053]

[0054] 2.5.2 Using 1.5% mass ratio low voltage agarose gel electrophoresis detection, the results (partial results) are shown in Figure 2.5.2; wherein, if the enzyme digestion product: containing 1 band, GG type; containing 2 bands, AA type; containing 3 bands, AG type. Figure 2

[0055] 2.6 Sequencing verification

[0056] The gene enzyme digestion typing agarose gel electrophoresis map is counted to obtain AA, AG, GG three types, and one individual of each type is selected for sequencing alignment, and the sequencing alignment map is shown in Figure 2.6.1; in the sequencing result, A is mutated into G, and the mutation position is marked by an arrow, which is consistent with the enzyme digestion typing result. Figure 3

[0057] 2.7 Effect verification

[0058] In order to determine the association of A / G polymorphism of chicken LMOD2 gene A311G site with important phenotypic traits of chicken, 450 Huibei chickens in step 2.2 were used as test materials, and the average daily feed intake (ADFI), average daily gain (ADG), metabolic body weight gain (MBW 0.75 ), feed conversion ratio (FCR), and residual feed intake (RFI) of 90-120 day-old chickens were counted, and the 2.5 genotyping method was used for genotyping of 450 Huibei chickens, and the results are shown in Table 3:

[0059] Table 3 Genotype detection results of individuals with different phenotypes

[0060]

[0061] Experimental conclusion: The chi-square test results show that the genotype of the test chicken population is in Hardy-Weinberg equilibrium (P>0.05).

[0062] 2.8 Statistical analysis

[0063] The association between the three genotypes and the feed utilization traits of chickens was analyzed by least square analysis method in SAS9.4 software, and the association analysis results between different genotypes and each trait are shown in Table 4:

[0064] Table 4 Association analysis of chicken LMOD2 genotype and chicken feed utilization traits

[0065]

[0066] Note: The same row and different lowercase letters indicate significant differences (P<0.05). ​​

[0067] Experimental conclusion: As can be seen from Table 4, for the A311G site of the LMOD2 gene, the metabolic body weight (MBW) of the GG type individual is significantly higher than that of the AA type individual, the residual feed intake (RFI) of the GG type individual is significantly lower than that of the AG type individual, and there is no significant difference in average daily gain (ADG), average daily feed intake (ADFI) and feed conversion ratio (FCR) among the three genotypes, so it can be concluded that the feed utilization trait of the GG genotype individual is the best, the feed utilization trait of the AG genotype individual is medium, and the feed utilization trait of the AA genotype individual is poor. 0.75 ) of the GG type individual is significantly higher than that of the AA type individual, the residual feed intake (RFI) of the GG type individual is significantly lower than that of the AG type individual, and there is no significant difference in average daily gain (ADG), average daily feed intake (ADFI) and feed conversion ratio (FCR) among the three genotypes, so it can be concluded that the feed utilization trait of the GG genotype individual is the best, the feed utilization trait of the AG genotype individual is medium, and the feed utilization trait of the AA genotype individual is poor.

[0068] The above examples only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as limiting the scope of the patent of the present application. It should be noted that for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, which are all within the protection scope of the present application.

Claims

1. A method for identifying a chicken feed utilization trait based on LMOD2 the use of a molecular marker of the gene, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein the base at position 311 of the nucleotide sequence is A or G. If the type of the molecular marker of the chicken to be tested is GG type, the chicken has the best feed utilization trait; if the type of the molecular marker of the chicken to be tested is AG type, the chicken has a medium feed utilization trait; if the type of the molecular marker of the chicken to be tested is AA type, the chicken has a poor feed utilization trait. The chicken is Huaibei chicken, and the feed utilization trait is metabolomic weight gain and residual feed intake.

2. A method of identifying a chicken feed utilization trait based on LMOD2 molecular markers of genes, characterized in that, The method comprises the following steps: (1) extracting total DNA of Huaibei chicken wing vein blood; (2) taking the sequence composed of the site of the molecular marker and the upstream and downstream bases thereof as a target sequence, designing specific amplification primers, taking the total DNA as a template, and performing PCR amplification by using the specific amplification primers to obtain an amplification product; The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein the base at position 311 of the nucleotide sequence is A or G. (3) performing genotyping detection and sequencing on the amplification product to obtain the type of the molecular marker of the chicken to be tested; (4) judging the feed utilization trait of the chicken according to the type of the molecular marker; If the type of the molecular marker of the chicken to be tested is GG type, the chicken has the best feed utilization trait; If the type of the molecular marker of the chicken to be tested is AG type, the chicken has a medium feed utilization trait; If the type of the molecular marker of the chicken to be tested is AA type, the chicken has a poor feed utilization trait. The feed utilization trait is metabolomic weight gain and residual feed intake.

3. A method according to claim 2, wherein the chicken feed utilization trait is identified by a molecular marker of the gene. LMOD2 A method for identifying a chicken feed utilization trait by a molecular marker of the gene, characterized by, The sequence of the specific amplification primer is as follows: SEQ ID NO. 2: Forward primer: TTTCAGGCTTGTTACAGGAC; SEQ ID NO. 3: Reverse primer: AGAAAAGGAGGAAGAAACCA.

4. A method according to claim 3, wherein the chicken feed utilization trait is identified by a molecular marker of the gene. LMOD2 A method for identifying a chicken feed utilization trait by a molecular marker of the gene, characterized by, The genotyping detection method is by PstⅠ The restriction enzyme digestion product is obtained by restriction enzyme digestion of the amplification product, the restriction enzyme digestion product is detected by agarose gel electrophoresis, and genotyping is performed according to the image. If the restriction enzyme digestion product: If one band is contained, the type is GG type; If two bands are contained, the type is AA type; If three bands are contained, the type is AG type.

5. A method according to claim 4, wherein the chicken feed utilization trait is identified by a molecular marker of the gene. LMOD2 A method for identifying a chicken feed utilization trait by a molecular marker of the gene, characterized by, The enzyme cutting product is detected by using 1.5%-2.0% concentration agarose gel electrophoresis.