Microsatellite markers related to the early body color of Apostichopus japonicus and their applications

Abstract

The present invention discloses microsatellite markers related to the early body color of Apostichopus japonicus and their applications, belonging to the technical field of molecular markers. Two microsatellite sequences screened based on the genome of Apostichopus japonicus in the present invention are respectively numbered AJ732 and AJ812, and their sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 in sequence. Microsatellite marker primers are respectively designed for the two microsatellite sequences. The microsatellite marker primers have strong specificity and stable amplification, can be used to judge the body color traits of Apostichopus japonicus larvae, can improve the breeding efficiency and accuracy of Apostichopus japonicus populations, and provide a powerful tool for the early directional breeding and industrial promotion of white Apostichopus japonicus.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and particularly relates to a microsatellite marker related to the early body color of Apostichopus japonicus and its application. Background Art

[0002] Apostichopus japonicus ( Apostichopus japonicus ), also known as sea cucumber, is the aquaculture object with the highest single output value in China's marine agriculture industry. Its body color is mainly divided into cyan, white and purple, and white sea cucumbers are extremely rare. In actual aquaculture, the prices of white sea cucumber seedlings and finished products are both 20 times that of cyan sea cucumbers. And after hybridization with cyan sea cucumbers, their interspecific hybrids have a fast growth rate, strong stress resistance and high nutritional quality, showing extremely significant heterosis, and having high market promotion potential and economic value.

[0003] As one of the important traits for the cultivation of excellent varieties, body color affects its taste and market price, and has become an important content in the selection of varieties and strains during the breeding process. However, it is currently difficult to obtain a genetically stable white sea cucumber population on a large scale, and the molecular mechanism related to the body color of sea cucumbers is not yet clear. At the same time, all sea cucumber larvae are white, which greatly limits its directional selective breeding and industrial promotion.

[0004] The existing molecular marker technologies mainly focus on the detection of genetic diversity of sea cucumbers, high-temperature tolerance traits and sex identification, etc., and there are few molecular markers related to the body color of sea cucumbers. Microsatellite sequences, also known as simple sequence repeats (SSRs), are widely used in genetic crossbreeding and chromosome genetic map drawing because of their large quantity, high polymorphism, and being unaffected by factors such as season, developmental stage and environment. Developing a microsatellite marker related to body color traits and with stable inheritance is crucial for the current early directional breeding and industrial promotion of white sea cucumbers. Summary of the Invention

[0005] The purpose of the present invention is to provide a microsatellite marker related to the early body color of Apostichopus japonicus and its application. The microsatellite marker provided by the present invention has stable amplification and good polymorphism, can be used for the screening research of different body colors of early sea cucumbers, and provides a molecular marker for the genetic breeding of sea cucumbers by detecting the alleles of this molecular marker.

[0006] To achieve the above purpose, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is a microsatellite molecular marker related to the early body color of Apostichopus japonicus ( Apostichopus japonicus ), and the microsatellite molecular marker has at least one nucleotide sequence shown in SEQ ID NO.1 to SEQ ID NO.2.

[0008] The second technical solution of the present invention is a primer composition for microsatellite molecular markers related to the early body color of Apostichopus japonicus ( Apostichopus japonicus ), and the primer composition consists of:

[0009] (1) primer pairs shown in SEQ ID NO.3 and 4; and

[0010] (2) at least one pair of primer pairs shown in SEQ ID NO.5 and 6.

[0011] The third technical solution of the present invention is a kit, including the primer composition.

[0012] The fourth technical solution of the present invention is a genetic analysis method for Apostichopus japonicus, including:

[0013] Synthesizing the primer composition;

[0014] Using the primer composition to perform PCR amplification on the DNA sample of Apostichopus japonicus to obtain an amplification product;

[0015] Performing genetic analysis on the amplification product.

[0016] The fifth technical solution of the present invention is the application of the primer composition, and the application includes at least one of the following:

[0017] (1) Application in the analysis of genetic diversity of Apostichopus japonicus;

[0018] (2) Application in the identification of germplasm resources of Apostichopus japonicus;

[0019] (3) Application in the identification of genetic relationships of Apostichopus japonicus;

[0020] (4) Application in the genetic breeding of Apostichopus japonicus;

[0021] (5) Application in the detection of the body color of juvenile Apostichopus japonicus.

[0022] Based on the above technical solutions, the present invention has the following technical effects:

[0023] Based on two microsatellite sequences screened from the genome of Apostichopus japonicus in the present invention, which are numbered AJ732 and AJ812 respectively, and their sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 in sequence. The present invention designed microsatellite marker primers for the two microsatellite sequences respectively. The microsatellite marker primers have strong specificity and stable amplification, can be used to judge the body color traits of juvenile Apostichopus japonicus, can improve the breeding efficiency and accuracy of the Apostichopus japonicus population, and provide a powerful tool for the early directional breeding and industrial promotion of white Apostichopus japonicus. Description of the Drawings

[0024] Figure 1It is the STR detection peak map of the specific allele D that is unique to the Apostichopus japonicus group at the AJ732 locus and exists in the hybrid Apostichopus japonicus group.

[0025] Figure 2 It is the STR detection peak map of the specific alleles F, G, H, and I that are unique to the green Apostichopus japonicus group at the AJ732 locus and exist in the hybrid Apostichopus japonicus group. Among them, A is the STR detection peak map of allele H, B is the STR detection peak map of allele I, C is the STR detection peak map of allele G, and D is the STR detection peak map of allele F.

[0026] Figure 3 It is the STR detection peak map of the specific alleles D and G possessed by an individual hybrid Apostichopus japonicus at the AJ732 locus.

[0027] Figure 4 It is the STR detection peak map of the specific alleles B, D, and F that are unique to the white Apostichopus japonicus group at the AJ812 locus and exist in the hybrid Apostichopus japonicus group. Among them, A is the STR detection peak map of allele F, B is the STR detection peak map of allele D, and C is the STR detection peak map of allele B.

[0028] Figure 5 It is the STR detection peak map of the specific allele L that is unique to the green Apostichopus japonicus group at the AJ812 locus and exists in the hybrid Apostichopus japonicus group.

[0029] Figure 6 It is the STR detection peak map of the specific alleles D and L simultaneously possessed by an individual hybrid Apostichopus japonicus at the AJ812 locus. Detailed implementation manners

[0030] The terms "comprising", "including", "having", "containing", etc. used herein are all open-ended terms, meaning including but not limited to.

[0031] The technical solutions described in the present invention are all conventional solutions in the art unless otherwise specified, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0032] An embodiment of the present invention provides a microsatellite molecular marker related to the early body color of Apostichopus japonicus ( Apostichopus japonicus ), and the microsatellite molecular marker has at least one nucleotide sequence as shown in SEQ ID NO.1 to SEQ ID NO.2.

[0033] An embodiment of the present invention also provides a primer composition for a microsatellite molecular marker related to the early body color of Apostichopus japonicus ( Apostichopus japonicus ), and the primer composition consists of:

[0034] (1) primer pairs as shown in SEQ ID NO.3 and 4; and

[0035] Composed of at least one pair of primer pairs shown in SEQ ID NO.5 and 6.

[0036] In some specific embodiments, the 5' ends of the upstream primers in the primer pairs are all labeled with the fluorescent group HEX.

[0037] The embodiment of the present invention also provides a kit, including the primer composition described above.

[0038] The embodiment of the present invention also provides a method for genetic analysis of Apostichopus japonicus, including:

[0039] Synthesizing the primer composition described above;

[0040] Performing PCR amplification on the DNA sample of Apostichopus japonicus using the primer composition to obtain an amplification product;

[0041] Performing genetic analysis on the amplification product.

[0042] In some specific embodiments, the genetic analysis includes: analysis of the number of alleles, analysis of the effective number of alleles, analysis of the Shannon diversity index, analysis of gene flow, analysis of genetic identity, analysis of genetic distance, analysis of Nei's genetic distance, analysis of heterozygosity, analysis of expected heterozygosity, and analysis of polymorphism information content.

[0043] In some specific embodiments, the genetic analysis includes: obtaining the genotype information of each microsatellite molecular marker of Apostichopus japonicus by detecting on an ABI 3730XL sequencer for the amplification product;

[0044] Using Genemapper software to analyze the raw data file of microsatellite molecular markers, and using PopGene to calculate the number of alleles, effective number of alleles, Shannon diversity index, gene flow, genetic identity, genetic distance, and Nei's genetic distance;

[0045] Using Cervus to calculate the observed heterozygosity, expected heterozygosity, and polymorphism information content.

[0046] The embodiment of the present invention also provides the application of the primer composition, and the application includes at least one of the following:

[0047] (1) Application in genetic diversity analysis of Apostichopus japonicus;

[0048] (2) Application in identification of germplasm resources of Apostichopus japonicus;

[0049] (3) Application in identification of genetic relationship of Apostichopus japonicus;

[0050] (4) Application in genetic breeding of Apostichopus japonicus;

[0051] (5) Application in the detection of the body color of juvenile Apostichopus japonicus.

[0052] In some specific embodiments, among the microsatellite marker loci shown in SEQ ID NO.1, the specific allele D is unique to the Apostichopus japonicus var. stichopus population and exists in the hybrid Apostichopus japonicus population; the specific alleles G, H, and I are unique to the Apostichopus japonicus var. japonicus population and exist in the hybrid Apostichopus japonicus population.

[0053] In some specific embodiments, among the microsatellite marker loci shown in SEQ ID NO.2, the specific alleles B, D, and F are unique to the Apostichopus japonicus var. stichopus population and exist in the hybrid Apostichopus japonicus population; the specific alleles K and M are unique to the Apostichopus japonicus var. japonicus population and exist in the hybrid Apostichopus japonicus population.

[0054] In some specific embodiments, taking the PCR amplification system as 25 μL, it includes: 1 - 2 μL of template, a total of 0.5 μL of upstream primer, a total of 0.5 μL of downstream primer, 0.5 μL of dNTP, 2.5 μL of 10×PCR Buffer, 0.2 μL of TaqPlus DNA polymerase, and the balance of sterilized deionized water.

[0055] In some specific embodiments, the PCR amplification program includes: pre - denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 60 - 55°C for 30 s, extension at 72°C for 30 s, cycling 10 times, with the annealing temperature decreasing by 0.5°C each time; denaturation at 94°C for 30 s, annealing at 52 - 55°C for 30 s, extension at 72°C for 30 s, cycling 30 times; and then extension at 72°C for 5 - 10 min.

[0056] The present invention screens microsatellite markers in the genome of Apostichopus japonicus. The screening criteria for the microsatellite marker sequences are preferably that the repeat number of 2 - base repeats is greater than or equal to 9 times, and the repeat number of 3 - base repeats is greater than or equal to 9 times.

[0057] The present invention designs primer pairs for the sequences of the microsatellite markers. The screening criteria for the primers include: (1) the primer length is 15 - 30 bp; (2) the GC content is 40% - 70%; (3) the annealing temperature is 50 - 65°C; (4) the expected length of the PCR product is 100 - 350 bp.

[0058] The template of the present invention preferably includes the genomic DNA of the body wall tissue of Apostichopus japonicus. There is no special limitation on the extraction method of the genomic DNA, and it can be extracted by using the conventional methods in the art.

[0059] Preferably after the PCR amplification ends, the amplified products are detected on an ABI 3730XL sequencer to obtain the genotype information of each SSR locus; the Genemapper software is used to analyze the SSR raw data file, and PopGene (version: v1.32) is used to calculate the number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), Shannon diversity index (I), and allele frequency, and Cervus (version: v3.0.7) is used to calculate the polymorphism information content (PIC).

[0060] Two microsatellite sequences screened based on the Apostichopus japonicus genome in the present invention are respectively numbered AJ732 and AJ812, and their sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 in sequence. The present invention respectively designs microsatellite marker primers for the two microsatellite sequences. The microsatellite marker primers have strong specificity, stable amplification and high polymorphism. By analyzing the allele situation of the above molecular markers through PCR and sequencing technologies, the body wall color of Apostichopus japonicus can be accurately, quickly and effectively predicted, providing a strong molecular biology basis and implementation method for the genetic breeding of Apostichopus japonicus.

[0061] In the examples of the present invention, the white Apostichopus japonicus population, green Apostichopus japonicus population and hybrid Apostichopus japonicus population all come from Weihai Yangde Marine Biotechnology Co., Ltd.

[0062] Example 1

[0063] The microsatellite markers used in the examples of the present invention all come from the NCBI (https: / / www.ncbi.nlm.nih.gov / ) database.

[0064] 1. Sample collection and preservation of Apostichopus japonicus body wall tissue

[0065] Randomly select 10 green Apostichopus japonicus, cut the body wall tissue samples of each individual with scissors and forceps, and place them in pre-cooled cryotubes respectively. After quick-freezing with liquid nitrogen, they are stored in a -80°C refrigerator.

[0066] 2. Extraction of Apostichopus japonicus genomic DNA

[0067] The extraction of Apostichopus japonicus genomic DNA is carried out according to the method of the TIANGEN Marine Animal Tissue Genomic DNA Extraction Kit (TIANGEN, TIANGEN Biochemical Technology Co., Ltd.). The quality of the extracted genomic DNA is detected by 1.5% agarose gel. After measuring the concentration, the DNA is diluted to 50 ng / μL and stored at -20°C for later use.

[0068] 3. Verification of microsatellite locus primers

[0069] Using the stored Apostichopus japonicus genomic DNA as a template, and using the primers SEQ ID NO.3 - 6 (without fluorescein) designed in Table 1, the sequences of microsatellite loci AJ732 and AJ812 were amplified.

[0070] The nucleotide sequence of microsatellite locus AJ732 is preferably as shown in SEQ ID NO.1:

[0071] SEQ ID NO.1: tgcagcactctgtatcagcccttatgtgtgtcgttttgttttcgccagtacacatacagacacacacacacacacacacatacacttacgaatgataagatcgagaaattctacctgtgattcggttgtaatgtaaccatgagtttaggataacaggggaacagggatataacagagaaaagcgacaagtaactgaataactcgacgatcactattagaatgttgcttgaagggtgagt;

[0072] The nucleotide sequence of microsatellite locus AJ812 is preferably as shown in SEQ ID NO.2:

[0073] SEQ ID NO.2: agacctttgaccacacccacaattgtagggtttatttactcactatggagcaactgtgtgtcaagtaagacagcaatctattctctcattatatttagctattacaagctacaggagtaacacagacacacggaacatccacacacacacacacacacacacacacacgcatacacaccaacttgaatgcataggttacaatacctgcctttggcatgggcaaccaaaaatgttaatgaaaaatgtctcactttgggcggc.

[0074] The PCR amplification system was 25 μL, including: 1 μL of template DNA, 1 μL of forward primer in total, 1 μL of reverse primer in total, 12.5 μL of Green Taq Mix, and 9.5 μL of sterilized deionized water;

[0075] The PCR amplification procedure includes: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 60 - 55°C for 30 s, extension at 72°C for 30 s, with 10 cycles, and the annealing temperature decreasing by 0.5°C for each cycle; denaturation at 94°C for 30 s, annealing at 55 - 52°C for 30 s, extension at 72°C for 30 s, with 30 cycles; and further extension at 72°C for 5 min.

[0076] Table 1 Information on the microsatellite core sequences and labeled primer sequences described in the present invention

[0077]

[0078] Take 5 μL of the PCR product for electrophoresis detection on a 1.5% agarose gel, and label it with a 2000 bp DNA marker. After electrophoresis at 220 v for 10 min, detect the product through a gel imager. The results show that the primers SEQ ID NO.3 - 6 designed in Table 1 can stably and specifically amplify the sequences of microsatellite loci AJ732 and AJ812. Subsequently, analyze the microsatellite loci AJ732 and AJ812 in 3 populations.

[0079] Example 2

[0080] 1. Sample collection and preservation of the body wall tissue of Apostichopus japonicus

[0081] Randomly select individuals from three populations of Apostichopus japonicus, including 41 white Apostichopus japonicus, 36 green Apostichopus japonicus, and 53 hybrid Apostichopus japonicus. Subsequently, use scissors and forceps to cut the body wall tissue samples of each individual and place them separately in pre-cooled cryotubes. After quick-freezing in liquid nitrogen, store them in a -80°C refrigerator.

[0082] 2. Extraction of genomic DNA from Apostichopus japonicus

[0083] Extract the genomic DNA of Apostichopus japonicus according to the method of the Tiangen Marine Animal Tissue Genomic DNA Extraction Kit (TIANGEN, Tiangen Biochemical Technology Co., Ltd.). After extracting the genomic DNA, detect the DNA quality with a 1.5% agarose gel. After measuring the concentration, dilute the DNA to 50 ng / μL and store it at -20°C for later use.

[0084] 3. Microsatellite marker amplification detection and data analysis

[0085] Use HEX fluorescein to label the upstream primers of microsatellite loci AJ732 and AJ812 to amplify the genomic DNA of Apostichopus japonicus.

[0086] The PCR amplification system is 25 μL, including: 1 μL of template DNA, a total of 0.5 μL of forward primer, a total of 0.5 μL of reverse primer, 0.5 μL of dNTP (10 mM), 2.5 μL of 10×PCR Buffer (containing Mg2+ ), 0.2 μL Taq Plus DNA polymerase (5 U / μL), 19.8 μL sterile deionized water;

[0087] The PCR amplification procedure included: pre-denaturation at 95°C for 5 min; 10 cycles of denaturation at 94°C for 30 s, annealing at 60-55°C for 30 s, and extension at 72°C for 30 s, with the annealing temperature decreasing by 0.5°C each cycle; 30 cycles of denaturation at 94°C for 30 s, annealing at 53-55°C for 30 s, and extension at 72°C for 30 s; and an additional extension at 72°C for 5-10 min.

[0088] After PCR amplification, the amplified products were sequenced on an ABI 3730XL sequencer to obtain the genotype information of each SSR locus of 130 sea cucumbers.

[0089] Genemapper software was used to analyze the SSR raw data files, and PopGene (version: v1.32) was used to calculate the number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), Shannon diversity index (I), and allele frequency. Cervus (version: v3.0.7) was used to calculate the polymorphism information content (PIC).

[0090] Table 2 Genetic diversity parameters of two microsatellite loci in the sea cucumber population

[0091]

[0092] Note: Locus: locus, Na: number of alleles, Ne: effective number of alleles, Ho: observed heterozygosity, He: expected heterozygosity, PIC: polymorphic information content.

[0093] Based on Examples 1 and 2, 10 and 15 alleles were detected at the AJ732 and AJ812 microsatellite loci, respectively. The effective number of alleles (Ne) was 5.95 and 6.602, respectively. H o) were 0.279 and 0.738, respectively, and the expected observed heterozygosity ( H e) were 0.835 and 0.852. The polymorphism information content (PIC) was 0.813 and 0.831, respectively, indicating high polymorphism.

[0094] Table 3 Allele information of microsatellite locus AJ732 in the sea cucumber population

[0095]

[0096] Note: Allele; allele, Hybird: hybrid sea cucumber population, White: white sea cucumber population, Cran: green sea cucumber population, N: number of alleles, Freq: allele frequency.

[0097] Table 4 Allele information of microsatellite locus AJ812 in Apostichopus japonicus populations

[0098]

[0099] Note: Allele; allele, Hybird: hybrid sea cucumber population, White: white sea cucumber population, Cran: green sea cucumber population, N: number of alleles, Freq: allele frequency.

[0100] Allele frequency analysis was performed on two microsatellite loci, and the results showed that:

[0101] At locus AJ732, the white sea cucumber population had a total of 5 alleles (A, B, C, D, E), among which allele E had the highest frequency, followed by alleles C and D; the green sea cucumber population had a total of 8 alleles (A, B, C, E, F, G, H, I), among which allele A had the highest frequency, followed by alleles C and G; the hybrid sea cucumber population had a total of 9 alleles (A, B, D, E, F, G, H, I, J), among which allele B had the highest frequency, followed by alleles A and I, and allele D only appeared in the white and hybrid sea cucumber populations, and alleles F, G, H, I only appeared in the green and hybrid sea cucumber populations.

[0102] At locus AJ812, the white sea cucumber population had a total of 10 alleles (A, B, C, D, E, F, G, H, I, J), among which allele I had the highest frequency, followed by alleles G and A; the green sea cucumber population had a total of 9 alleles (A, C, E, G, H, I, K, L, M), among which allele H had the highest frequency, followed by alleles A and I; the hybrid sea cucumber population had a total of 11 alleles (A, B, C, D, F, G, H, I, L, N, O), among which allele H had the highest frequency, followed by alleles A and C. And alleles B, D, F only appeared in the white and hybrid sea cucumber populations, and allele L only appeared in the green and hybrid sea cucumber populations.

[0103] 4. Verification of genotypes and phenotypes at AJ732 and AJ812 loci in Apostichopus japonicus

[0104] Another 30 individuals were selected from each of the three Apostichopus japonicus populations, including 30 white Apostichopus japonicus, 30 green Apostichopus japonicus, and 30 hybrid Apostichopus japonicus. The genotypes at the AJ732 and AJ812 loci were detected. The results showed that at the AJ732 locus, allele D was only present in the white and hybrid Apostichopus japonicus populations, while alleles F, G, H, and I were only present in the green and hybrid Apostichopus japonicus populations. At the AJ812 locus, alleles B, D, and F were only present in the white and hybrid Apostichopus japonicus populations, and allele L was only present in the green and hybrid Apostichopus japonicus populations, which was consistent with the above results.

[0105] These results indicate that different Apostichopus japonicus populations exhibit unique genetic characteristics at the AJ732 and AJ812 loci. Moreover, the hybrid Apostichopus japonicus population inherits the genetic characteristics of both parental populations, showing higher genetic diversity and unique allele characteristics. These results provide important information for studying the genetic structure, interspecific relationships, hybridization, and evolutionary mechanisms of Apostichopus japonicus populations, and lay a foundation for further genetic breeding research using microsatellite markers.

[0106] Obviously, the above embodiments are merely examples for clearly explaining the present invention and are not intended to limit the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation manners here. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. An application of a primer combination in detecting the body color of a juvenile sea cucumber, characterized in that: The primer composition consists of a primer pair as shown in SEQ ID NOs. 3 and 4 and a primer pair as shown in SEQ ID NOs. 5 and 6; the body color is white or cyan.

Images