An Indel molecular marker for identifying the origin of Monopterus albus and its application
By developing Indel molecular markers and using specific nucleic acid sequences to identify the origin of eels, the problem of targeted screening of eel lines has been solved, the rapid and accurate breeding effect has been achieved, and the protection and utilization of eel resources has been promoted.
Patent Information
- Application Number
- CN202510533876.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-27
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2045-04-27
AI Technical Summary
The existing technology lacks effective methods to conduct targeted screening of eel strains in different regions, resulting in damage to the genetic resources of wild eels and the inability to achieve precise breeding.
An Indel molecular marker was developed, and the nucleic acid sequences shown in SEQ ID NO:3 and SEQ ID NO:4 were used to identify the eel production areas by PCR amplification and gel electrophoresis, and distinguish between the eel strains in Jiangxi and non-Jiangxi regions.
It has achieved rapid and accurate identification of eel production areas, promoted the domestication and breeding of wild germplasm resources, and improved the accuracy of breeding.
Smart Images

Figure CN120041586B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of aquaculture molecular breeding, and particularly relates to an Indel molecular marker for identifying the origin of Monopterus albus and its application, especially suitable for identifying the strains of Monopterus albus in Jiangxi region and non-Jiangxi region. Background Art
[0002] Monopterus albus, belonging to Synbranchiformes, Synbranchidae, and Monopterus, is widely distributed in paddy fields, swamps, and mud ponds in East Asia, South Asia, and Southeast Asia. It has many advantages such as good taste, high nutritional value, and prominent flavor, and is known as one of the "characteristic freshwater fish" with economic value in China due to its commercial importance and delicious meat. At present, the resource output is in short supply and the price is high, and its market potential is huge. Jiangxi region belongs to the middle reaches of the Yangtze River Basin, with numerous natural water systems and crisscrossing artificial canals, making this area one of the regions with the highest river network density in China, having rich Monopterus albus resources and a developed Monopterus albus aquaculture industry. However, the habitats of wild Monopterus albus are decreasing, and its genetic resources are severely damaged. Therefore, it is particularly necessary to accurately and directionally screen high-quality wild resources.
[0003] At present, there is no effective method to directionally screen the strains of Monopterus albus in different regions, so it is necessary to develop molecular markers for screening the strains of Monopterus albus in specific regions. Molecular markers are genetic markers based on nucleotide sequence variations in the genetic material among individuals, and can reflect specific DNA fragments with certain differences in the genomes among populations. Compared with other morphological markers, cytological markers, microsatellite markers, etc., Indel markers have the advantages of simple operation, high precision and efficiency, high repeatability, etc., and at different stages of biological development, the DNA of different tissues can be used for marker analysis. Summary of the Invention
[0004] The present invention provides an Indel molecular marker for identifying the origin of Monopterus albus. Using this molecular marker, the strains of Monopterus albus in Jiangxi region and non-Jiangxi region can be quickly identified, which helps to quickly achieve genetic identification, accelerate the domestication and breeding of wild germplasm resources, and achieve precision breeding.
[0005] On the one hand, the present invention provides an Indel molecular marker for identifying the origin of Monopterus albus.
[0006] On the other hand, the present invention provides an application of the Indel molecular marker for identifying the origin of Monopterus albus.
[0007] On still another hand, the present invention provides a method for identifying the origin of Monopterus albus.
[0008] The technical solution of the present invention is as follows:
[0009] An Indel molecular marker for identifying the origin of Monopterus albus is Indel molecular marker B, and Indel molecular marker B contains the nucleic acid sequences shown in SEQ ID NO:3 and SEQ ID NO:4.
[0010] Through the above Indel molecular marker, it is used to accurately identify the strains of Monopterus albus in Jiangxi region and / or non-Jiangxi region. The nucleic acid sequence shown in SEQ ID NO:3 is used to accurately identify the strains of Monopterus albus in Jiangxi region, and the nucleic acid sequence shown in SEQ ID NO:4 is used to accurately identify the strains of Monopterus albus in non-Jiangxi region.
[0011] The Jiangxi region includes, but is not limited to, Yichun, Nanchang, Jiujiang, etc. in Jiangxi.
[0012] The non-Jiangxi region includes, but is not limited to, Chongqing, Changsha in Hunan, Weinan in Shaanxi, Ankang in Shaanxi, Kunming in Yunnan, Xiantao in Hubei, Zhanjiang in Guangdong, Zhengzhou in Henan, Nanning in Guangxi, Dandong in Liaoning, Dongying in Shandong, Huai'an in Jiangsu, Baoding in Hebei, Sanya in Hainan, Chengdu in Sichuan, etc.
[0013] Application of a product of an Indel molecular marker for identifying the origin of the above Monopterus albus in identifying the origin of Monopterus albus, and the product includes, but is not limited to, any one or any combination of primers, probes, reagents, reagent kits, gene chips, devices or equipment, etc.
[0014] A primer of an Indel molecular marker for identifying the origin of Monopterus albus, and the primer pair is shown in SEQ ID NO:1 and SEQ ID NO:2, which is used to identify the origin of Monopterus albus.
[0015] At least one of the following products contains the primer of an Indel molecular marker for identifying the origin of Monopterus albus:
[0016] (1) A probe of an Indel molecular marker for identifying the origin of Monopterus albus;
[0017] (2) A reagent of an Indel molecular marker for identifying the origin of Monopterus albus;
[0018] (3) A reagent kit of an Indel molecular marker for identifying the origin of Monopterus albus;
[0019] (4) A gene chip of an Indel molecular marker for identifying the origin of Monopterus albus;
[0020] (5) A device or equipment of an Indel molecular marker for identifying the origin of Monopterus albus.
[0021] A method for identifying the origin of Monopterus albus, the steps include: using the genomic DNA of Monopterus albus as a template, amplifying with the primer pairs shown in SEQ ID NO: 1-2 to obtain an amplification product; comparing the amplification product with the Indel molecular marker of the origin of Monopterus albus to identify the origin of Monopterus albus.
[0022] Further, when the nucleic acid sequence of the amplification product is consistent with the Indel molecular marker of the origin of Monopterus albus shown in SEQ ID NO: 3, or the band of the amplification product is 117bp, it is the Monopterus albus strain in Jiangxi region; when the nucleic acid sequence of the amplification product is consistent with the Indel molecular marker of the origin of Monopterus albus shown in SEQ ID NO: 4, or the band of the amplification product is 138bp, it is the Monopterus albus strain in non-Jiangxi region.
[0023] The advantages of the solution of the present invention are as follows:
[0024] The present invention provides an Indel molecular marker for identifying the Monopterus albus strain in Jiangxi region. Using the molecular marker primer pairs required for detection provided by the present invention to perform PCR amplification on Monopterus albus strains in different regions, it can quickly identify whether it is the Monopterus albus strain in Jiangxi region according to the amplified fragment. Applying the Indel marker provided by the present invention to practice is beneficial to quickly realizing genetic identification, accelerating the domestication and breeding of wild germplasm resources, and realizing precision breeding. Description of the Drawings
[0025] Figure 1 It is the gel electrophoresis diagram of PCR amplification of DNA of 18 Monopterus albus strains using primer pair 2.
[0026] Among them, the numbers 1-18 respectively represent the following 18 Monopterus albus strains:
[0027] 1. Yichun, Jiangxi; 2. Nanchang, Jiangxi; 3. Jiujiang, Jiangxi; 4. Chongqing; 5. Changsha, Hunan; 6. Weinan, Shaanxi; 7. Ankang, Shaanxi; 8. Kunming, Yunnan; 9. Xiantao, Hubei; 10. Zhanjiang, Guangdong; 11. Zhengzhou, Henan; 12. Nanning, Guangxi; 13. Dandong, Liaoning; 14. Dongying, Shandong; 15. Huai'an, Jiangsu; 16. Baoding, Hebei; 17. Sanya, Hainan; 18. Chengdu, Sichuan. Detailed Embodiments
[0028] The following examples are only used to further illustrate the content of the present invention, but should not be construed as a limitation to the present invention. Without departing from the spirit and essence of the present invention, the modifications or substitutions made to the methods, steps or conditions of the present invention all belong to the scope of the present invention. The experimental methods without specific conditions and the reagents and materials without the formula described in the examples are all according to the conventional conditions in the art, and the reagents used can be obtained commercially.
[0029] The present invention provides Indel markers for identifying whether the rice field eel is of the Jiangxi regional strain. The method for obtaining the molecular markers is as follows: Based on the existing rice field eel genome sequence, by re-sequencing the rice field eels of different regional strains, genome-wide association analysis is used to identify the genomic regions where the Jiangxi regional strain of rice field eel differs from other regional strains, which are located at the physical positions of 48875995-48876017 on chromosome 2 (Chr2) and 7926193-7926213 on chromosome 9 (Chr9) of the rice field eel. The flanking sequences of 200 bp before and after the Indel variation in this genomic region are selected for primer development. After PCR amplification of the Indel markers with the primers, whether the tested rice field eel is of the Jiangxi regional strain is identified by the difference in the amplified fragments. The amplified fragments that respectively conform to the nucleotide sequence of the Indel marker SEQ ID NO:3 of the present invention are of the Jiangxi regional strain of rice field eel.
[0030] The present invention provides primer pairs for detecting the Indel molecular markers, and their forward and reverse primer sequences are respectively shown in SEQ ID NO:1-2.
[0031] Table 1 Nucleotide sequences of primer pairs
[0032]
[0033] Example 1: Identification of rice field eel strains in 18 regions
[0034] (1) Extraction of genomic DNA from rice field eel samples
[0035] Cut a small section of tail muscle of about 0.5 g from the tested rice field eel, extract genomic DNA using a tissue genomic DNA extraction kit (brand: Tiangen, product number: 69504), detect the purity and concentration of the obtained DNA sample using a NanoDrop2000 spectrophotometer, and the extracted DNA can be stored at -20°C for a long time.
[0036] (2) PCR amplification of Indel marker fragments
[0037] Using the above-obtained rice field eel genomic DNA as a template, PCR amplification is carried out with the primer pair shown in the nucleotide sequences of primer pair 2 SEQ ID NO:1-2 in Table 1.
[0038] Use a pre-mixed PCR kit with dye (brand: TaKaRa, product number: RR903A) to prepare the following 20 μl reaction system: Premix Taq 10 μl, 0.5 μl of 10 μM forward primer, 0.5 μl of 10 μM reverse primer, 1 μl of template DNA, and add ddH2O to make up the total volume to 20 μl.
[0039] The procedure for PCR amplification was as follows: pre-denaturation at 98°C for 10 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, with 35 cycles, and extension at 72°C for 5 min.
[0040] (3)Perform agarose gel electrophoresis on the amplified product
[0041] Prepare a 2% agarose gel, add the above PCR amplified product, and perform electrophoresis using 50 bp DNA marker as a label. Set the electrophoresis conditions as voltage 110V and electrophoresis time 60 min. Use a gel imager to take pictures of the bands to obtain gel pictures.
[0042] (4)Identify the amplified product
[0043] Identify according to the bands on the gel picture or the sequencing results of the PCR amplified product (sequencing was performed by Shanghai Sangon Biological Engineering Co., Ltd.).
[0044] When the band shown on the electrophoresis gel using primer pair 2 is at 117 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:3, the tested rice field eel is the rice field eel strain in Jiangxi region; if the band is shown at 138 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:4, the tested rice field eel is a rice field eel strain from a non-Jiangxi region.
[0045] ATTAGAAAGGGAGTTAGCAGAACTGTGTAGAGCTTGTGTCCTACTCAGTGTATTTTAGTAGTTATTCAGTAACTATCATCACACACAATGCCTCTATCCCATTACTGTCTTGTCTGT (SEQ ID NO:3)
[0046] ATTAGAAAGGGAGTTAGCAGAACTGTGTAGAGCTTGTGTCCTACTCAGTGTATTTTAGTAGTTATTCAGTGAAACCTAGTGACCACACAGTAACTATCATCACACACAATGCCTCTATCCCATTACTGTCTTGTCTGT (SEQ ID NO:4)
[0047] There is a deletion of the following sequence at the 67 - 87 bp of the sequence shown in SEQ ID NO:4: CAGTGAAACCTAGTGACCACA, and the corresponding one is SEQ ID NO:3.
[0048] The experimental results are respectively as Figure 1 shown.
[0049] Figure 1 The amplified product bands of Samples 1-3 are located at 117 bp, and the amplified bands of Samples 4-18 are located at 138 bp.
[0050] From Figure 1 it can be clearly seen that Samples 1-3 from Yichun, Nanchang, and Jiujiang in Jiangxi are indeed the eel strains in the Jiangxi region, while Samples 4-18 are from other regions.
[0051] The above results indicate that the Indel marker B described can effectively identify whether it is an eel strain in the Jiangxi region. Therefore, the Indel marker provided by the present invention can be applied to the rapid identification of germplasm resources of specific geographical strains, so as to obtain the excellent traits of the strain and ultimately achieve precision breeding.
Claims
1. An Indel molecular marker for identifying the origin of Monopterus albus, characterized in that, The sequence of the Indel molecular marker is the nucleic acid sequence shown in SEQ ID NO: 3 or SEQ ID NO:
4.
2. Use of the product for identifying the Indel molecular marker according to claim 1 in identifying the origin of Monopterus albus, characterized in that, When the nucleic acid sequence of the amplification product of the product is consistent with the Indel molecular marker shown in SEQ ID NO: 3 in Claim 1, or when the band of the amplification product is 117 bp, it is the eel strain in Jiangxi region; when the nucleic acid sequence of the amplification product of the product is consistent with the Indel molecular marker shown in SEQ ID NO: 4 in Claim 1, or when the band of the amplification product is 138 bp, it is the eel strain in non-Jiangxi region.
3. The application according to claim 2, characterized in that, The product includes primers, and / or probes, and / or kits, and / or gene chips, and / or devices.
4. A primer for identifying the Indel molecular marker according to claim 1, characterized in that, The primer pair is shown as SEQ ID NO: 1 and SEQ ID NO:
2.
5. A product containing the primer according to Claim 4, and the product is any one selected from the following: (1) A kit for the Indel molecular marker for identifying the origin of eels; (2) A gene chip for the Indel molecular marker for identifying the origin of eels; (3) A device for the Indel molecular marker for identifying the origin of eels.
6. A method for identifying the origin of swamp eels, characterized in that the steps It includes: Using the eel genomic DNA as a template, amplifying with the primer according to Claim 4 or the product according to Claim 5 to obtain an amplification product; comparing the amplification product with the Indel molecular marker according to Claim 1. When the nucleic acid sequence of the amplification product is consistent with the Indel molecular marker shown in SEQ ID NO: 3 in Claim 1, or when the band of the amplification product is 117 bp, it is the eel strain in Jiangxi region; when the nucleic acid sequence of the amplification product is consistent with the Indel molecular marker shown in SEQ ID NO: 4 in Claim 1, or when the band of the amplification product is 138 bp, it is the eel strain in non-Jiangxi region.
Citation Information
Patent Citations
Indel molecular marker for identifying ricefield eel strain in southwest region and application of Indel molecular marker
CN119265316A