Method for detecting viruses in fetal calf serum by multiple qPCR (quantitative polymerase chain reaction) method based on Taqman probe

Abstract

The invention relates to the technical field of molecular detection, and discloses a method for detecting viruses in fetal calf serum based on Taqman probe method multiple qPCR (quantitative polymerase chain reaction). According to the method, a high-throughput multiple qPCR fetal bovine serum virus detection scheme is established on the basis of fluorescence with different wavelengths in combination with PCR amplification, and bovine parvovirus (BPV), rabies virus (RV), reovirus (REO-3), bovine parainfluenza virus (PI3), bovine diarrhea virus (BVDV) and bovine adenovirus (BAV-3) can be simply, rapidly and simultaneously detected. And the detection specificity and sensitivity of the fetal bovine serum virus can be improved, the detection efficiency can be improved, and the time-sensitive detection requirements in clinical and research can be met.

Description

Technical Field

[0001] The present invention relates to a method for multiplex qPCR detection of viruses in fetal bovine serum based on Taqman probe method. Based on fluorescence of different wavelengths and combined with PCR amplification, it can achieve simultaneous detection of multiple target RNA / DNA sequences and belongs to the field of molecular detection technology. Background Art

[0002] Fetal Bovine Serum (FBS) is widely used in cell culture, vaccine production and biomedical research. Any virus contamination may have a serious impact on downstream cell cultures, experimental results and the safety of biological products. Detecting and excluding virus contamination can ensure the safety and reliability of various research and production processes using FBS. For example, bovine parvovirus that causes diarrhea, dehydration and growth stagnation in cattle, rabies virus that can infect a variety of mammals including humans, reovirus (REO-3) that can cause intestinal and respiratory diseases in various animals, bovine parainfluenza virus (PI3) and bovine adenovirus (BAV-3) that cause respiratory diseases in cattle, bovine diarrhea virus (BVDV) and bovine parvovirus (BPV) that can cause diarrhea, immunosuppression and reproductive disorders in cattle, and rabies virus (RV) is a zoonotic pathogen that is fatal to humans. Once it appears in fetal bovine serum and is not properly handled, it may be transmitted to humans through vaccines or other biological products. These viruses not only affect experiments but also pose a threat to the health of laboratory personnel. Detecting viruses in fetal bovine serum can reduce the risk of laboratory personnel being exposed to potential pathogens and safeguard their health and safety.

[0003] Currently, the methods for virus detection are mainly divided into two categories: protein-based detection and nucleic acid-based detection. The former, protein-based detection methods, always have some drawbacks. For example, enzyme-linked immunosorbent assay (ELISA) requires high-quality specific antibodies and has a relatively long preparation time. Its sensitivity and specificity may not be as good as nucleic acid detection. The lateral flow assay (LFA) is fast and convenient, but its sensitivity and specificity are relatively low, making it suitable for preliminary screening and on-site detection. Western Blot is complex and time-consuming, and is more suitable for research purposes rather than large-scale screening. These drawbacks limit the effectiveness and universality of protein-based detection methods in certain application scenarios. The latter mainly uses polymerase chain reaction (PCR), with the detection target being the genomic nucleic acid of the virus. Fluorescent quantitative PCR based on Taqman probes has high specificity and high sensitivity. By specifically binding to the target sequence to generate a fluorescent signal, it ensures the accuracy and reliability of the detection. It can monitor the accumulation of fluorescent signals during the PCR amplification process in real time, without subsequent processing steps, providing rapid and efficient quantitative results. In addition, qPCR based on Taqman probes can perform multiplex detection. By using probes with different fluorescent dyes to simultaneously detect multiple target sequences, it is suitable for the analysis of complex samples. Its high degree of automation makes it suitable for high-throughput detection platforms, improving the repeatability and reliability of experiments, and meeting the time-sensitive detection requirements in clinical and research settings.

[0004] There are a wide variety of viruses in fetal bovine serum, and RNA viruses have a high mutation rate. Specific primers and probes for different viruses need to be designed and ensured to be able to identify mutant strains. This requires continuous updating and optimization of the detection protocol. Simultaneously detecting multiple viruses still poses certain technical challenges, and multiplex qPCR protocols that can efficiently detect multiple targets simultaneously need to be developed and validated to ensure the detection sensitivity and specificity of each virus. The virus concentration in fetal bovine serum may be very low, increasing the difficulty of detection. The qPCR reaction conditions need to be optimized to improve the detection sensitivity to ensure that low-concentration viruses can be detected.

[0005] In summary, establishing a high-throughput multiplex qPCR fetal bovine serum virus detection protocol through qPCR technology based on Taqman probes will help improve the specificity and sensitivity of fetal bovine serum virus detection, increase the detection efficiency, and meet the time-sensitive detection requirements in clinical and research settings. Summary of the Invention

[0006] To solve the above-mentioned defects in the prior art, the present invention is based on the Taqman probe-based fluorescence quantitative PCR method. By designing specific primers and probes for different viruses and optimizing the reaction conditions, a high-throughput multiplex qPCR fetal bovine serum virus detection scheme has been established to simply and rapidly detect bovine parvovirus (BPV), rabies virus (RV), reovirus (REO-3), bovine parainfluenza virus (PI3), bovine diarrhea virus (BVDV), and bovine adenovirus (BAV-3) simultaneously.

[0007] To achieve the above-mentioned invention purpose, the present application adopts the following technical solutions:

[0008] In the first aspect, the present application provides a reagent for detecting viruses in fetal bovine serum, including a combination of one or more of the following primer pairs:

[0009] A primer pair for detecting BPV, the sequences of which are shown in SEQ ID NO: 1-2;

[0010] A primer pair for detecting RV, the sequences of which are shown in SEQ ID NO: 4-5;

[0011] A primer pair for detecting REO-3, the sequences of which are shown in SEQ ID NO: 7-8;

[0012] A primer pair for detecting PI3, the sequences of which are shown in SEQ ID NO: 10-11;

[0013] A primer pair for detecting BVDV, the sequences of which are shown in SEQ ID NO: 13-14;

[0014] A primer pair for detecting BAV-3, the sequences of which are shown in SEQ ID NO: 16-17.

[0015] Furthermore, the reagent also includes a combination of one or more of the following probes:

[0016] A probe for detecting BPV, the sequence of which is shown in SEQ ID NO: 3;

[0017] A probe for detecting RV, the sequence of which is shown in SEQ ID NO: 6;

[0018] A probe for detecting REO-3, the sequence of which is shown in SEQ ID NO: 9;

[0019] A probe for detecting PI3, the sequence of which is shown in SEQ ID NO: 12;

[0020] A probe for detecting BVDV, the sequence of which is shown in SEQ ID NO: 15;

[0021] A probe for detecting BAV-3, the sequence of which is shown in SEQ ID NO:18.

[0022] Furthermore, the reagent further comprises an internal reference primer pair, the sequences of which are shown in SEQ ID NO.19-20.

[0023] In a second aspect, the present application provides a fetal bovine serum virus detection product, comprising the reagent described in the first aspect.

[0024] Furthermore, the product is a detection kit.

[0025] In a third aspect, the present application provides a method for detecting viruses in fetal bovine serum by multiplex qPCR based on Taqman probes.

[0026] Design a pair of specific primers and probes for the specific sequence of each virus, optimize the reaction conditions, and establish a multiplex virus detection scheme. Specific implementation scheme:

[0027] 1) Construction of virus standards for bovine parvovirus (BPV), rabies virus (RV), reovirus (REO-3), bovine parainfluenza virus (PI3), bovine viral diarrhea virus (BVDV), and bovine adenovirus (BAV-3)

[0028] Retrieve and download the BVDV conserved sequence 5'UTR (MT179836.1), BPIV-3 matrix protein (M) gene sequence (OM522950.1), VP2 gene of BPVD as the target gene (GenBank: MN567108.1), G gene of RV strain 9 (AF499686) (GenBank: LT575363.1), highly conserved sequence in the E2B region of BAV3 (GenBank: AC_000002.1: 5800-6000), and conserved region sequence of the M1 gene of reo-3 (GenBank: NC_077841.1) from the GenBank database on the NCBI website.

[0029] Add the same amplification sequence and T7 promoter in front of the respective designed target sequences to construct recombinant plasmids. Amplify the respective target sequences with unified primer probes, perform agarose gel electrophoresis, and purify and recover with a gel recovery kit. Use the purified product as a template for in vitro transcription, digest the DNA with DNaseI, purify the RNA, measure the concentration, and store it in a -80°C refrigerator.

[0030] 2) Primer and probe design

[0031] For the constructed templates of bovine parvovirus (BPV), rabies virus (RV), reovirus (REO-3), bovine parainfluenza virus (PI3), bovine diarrhea virus (BVDV), and bovine adenovirus (BAV-3), a pair of specific primers and taqman probes were designed respectively; universal sequences were added to both ends of their respective specific sequences, and the complementary sequence of the T7 promoter was added to the 5' end.

[0032] The primers and probes are as follows:

[0033] BPV-qPCR-primer-F: ACGGATCCATTCCAATGTCAC (SEQ ID NO:1);

[0034] BPV-qPCR-primer-R: CCCCTCTTTTCTACCTCCCAG (SEQ ID NO:2);

[0035] BPV-qPCR-Taqman probe: 6-FAM-CCGCCAGGAACCATCTTCATCAAGC-BHQ1 (SEQ ID NO:3);

[0036] RV-qPCR-primer-F: CAGTTTTGGACCCATATGACAGA (SEQ ID NO:4);

[0037] RV-qPCR-primer-R: ATCCAAATGGTGTAATCGTGGTT (SEQ ID NO:5);

[0038] RV-qPCR-Taqman probe: HEX-AAGACACCGCTACTCCTGAGCAC-BHQ1 (SEQ ID NO:6);

[0039] REO-3-qPCR-primer-F: GCCGCTATAACGCCAAC (SEQ ID NO:7);

[0040] REO-3-qPCR-primer-R: GACTACTTCACTCACTACCGC (SEQ ID NO:8);

[0041] REO-3-qPCR-Taqman probe: ROX-TGCCTTGCTGACGATGTCCCCAC-BHQ2 (SEQ ID NO:9);

[0042] PI3-qPCR-primer-F: ACTCCTACAAGCCGCAAT (SEQ ID NO:10);

[0043] PI3-qPCR-primer-R: GACCATGGGTACAGTTCAGGTTT (SEQ ID NO:11);

[0044] PI3-qPCR-Taqman probe: 6-FAM-CCGTGGCTTTGACAGTTCTTCTCACT-BHQ1 (SEQ ID NO:12);

[0045] BVDV-qPCR-primer-F: GCCATGCCCTTAGTAGGACTAGC (SEQ ID NO:13);

[0046] BVDV-qPCR-primer-R: CCTAAGGCGTCGAACCACTGA (SEQ ID NO:14);

[0047] BVDV-qPCR-Taqman probe: HEX-CAGCCATCCAATGAACTCGCCACT-BHQ1 (SEQ ID NO:15);

[0048] BAV-3-qPCR-primer-F: CAAGCTTCTTACGTGGCTACCATC (SEQ ID NO:16);

[0049] BAV-3-qPCR-primer-R: GTCCAGCCTTCAATGCCGAG (SEQ ID NO:17);

[0050] BAV-3-qPCR-Taqman probe: ROX-TTGCTGGCGCTCATTCACACCCAT-BHQ2 (SEQ ID NO:18);

[0051] Universal-PCR-primer-F: ACGCAGAAATACGACGTAG (SEQ ID NO:19);

[0052] Universal-PCR-primer-R: ACATAAACGACCATAATGGGTG (SEQ ID NO:20).

[0053] 3) PCR amplification

[0054] Plasmid dilution: Dilute the viral plasmid with an original concentration of 10 ng / μl to 0.01 ng / μl according to (5 μl plasmid + 45 μl 40 ng / μl protamine DNA diluent).

[0055] 4) Electrophoresis of PCR amplification products:

[0056] The electrophoresis sample loading volume is 2 μl, 2.5% gel, 200 v, 30 min

[0057] 5) Gel extraction:

[0058] Purify and recover using the Novoprotein Gel Extraction Kit.

[0059] 6) In vitro transcription:

[0060] Use the purified product as a template for in vitro transcription, and digest the DNA with DNaseI.

[0061] 7) Product purification:

[0062] Further purify the product using the Novoprotein Purification Kit.

[0063] 6) RNA quality analysis

[0064] Perform electrophoresis analysis on the in vitro transcribed and purified RNA to check if it meets the actual length and if there is interference; perform the original PCR amplification on the RNA solution and then electrophoresis analysis to check for residual DNA;

[0065] 7) Establishment of multiplex fluorescence quantitative PCR detection system

[0066] The qPCR reaction system is 10 μL;

[0067] The first group: Bovine parvovirus (BPV)-F(10p) 0.2 μl, Bovine parvovirus (BPV)-R(10p) 0.2 μl, Bovine parvovirus (BPV)-P(10p) 0.1 μl; Rabies virus (RV)-F(10p) 0.2 μl, Rabies virus (RV)-R(10p) 0.2 μl, Rabies virus (RV)-P(10p) 0.1 μl; Reovirus (REO-3)-F(10p) 0.2 μl, Reovirus (REO-3)-R(10p) 0.2 μl, Reovirus (REO-3)-P(10p) 0.1 μl; Internal reference phage-F(10p) 0.1 μl, Internal reference phage-R(10p) 0.1 μl, Internal reference phage-P(10p) 0.05 μl; Water 3.25 μl; Viral RNA 2 μl; Internal reference phage RNA 1 μl.

[0068] Second group: Bovine parainfluenza virus type 3 (PI3)-F (10p) 0.2 ul, Bovine parainfluenza virus type 3 (PI3)-R (10p) 0.2 ul, Bovine parainfluenza virus type 3 (PI3)-P (10p) 0.1 ul; Bovine viral diarrhea virus (BVDV)-F (10p) 0.2 ul, Bovine viral diarrhea virus (BVDV)-R (10p) 0.2 ul, Bovine viral diarrhea virus (BVDV)-P (10p) 0.1 ul; Bovine adenovirus type 3 (BAV3)-F (10p) 0.2 ul, Bovine adenovirus type 3 (BAV3)-R (10p) 0.2 ul, Bovine adenovirus type 3 (BAV3)-P (10p) 0.1 ul; Internal reference phage-F (10p) 0.1 ul, Internal reference phage-R (10p) 0.1 ul, Internal reference phage-P (10p) 0.05 ul; Water 3.25 ul; Viral RNA 2 ul; Internal reference phage RNA 1 ul.

[0069] Using Tianlong detection and analysis, the reaction conditions are: 55 °C for 15 min, 95 °C for 30 s for pre-denaturation; The cycling conditions are: 95 °C for 10 s, 60 °C for 30 s, and fluorescence collection at 60 °C for 45 cycles.

[0070] In summary, the present application has the following beneficial effects:

[0071] Based on the Taqman probe qPCR method in the multiplex detection of fetal bovine serum viruses, its high specificity reduces the possibility of non-specific amplification through the precise binding of the probe to the specific virus sequence, ensuring the specific detection of each target virus. High sensitivity enables the detection of extremely low concentrations of viral nucleic acids, achieving early diagnosis and prevention. The real-time quantitative function allows real-time monitoring of the fluorescence signal changes in the PCR reaction, providing accurate quantitative results and helping to evaluate the viral load. The multiplex detection ability enables the simultaneous detection of multiple viruses in one reaction system by using probes with different fluorescent dyes, improving the detection efficiency and saving time and cost. It is usually completed within 1-2 hours, significantly shortening the detection time and being suitable for high-throughput screening and rapid response requirements. The high degree of automation makes the qPCR detection process easy to standardize and automate, reducing human operation errors and improving the repeatability and reliability of the detection results. This method can detect DNA viruses and RNA viruses through the reverse transcription step (RT-qPCR). The closed reaction system and real-time monitoring reduce the risk of cross-contamination between samples, provide accurate quantitative information, and quantify the virus copy number through the standard curve, helping with viral load monitoring and epidemiological research. The dedicated software can automatically analyze and interpret qPCR data, providing an intuitive result display and simplifying the data processing process. Brief Description of the Drawings

[0072] Figure 1 : Triple fluorescence quantitative sensitivity detection of BPV, RV, and REO-3 based on Taqma probe

[0073] Figure 2 : Triple fluorescence quantitative sensitivity detection of PI3, BVDV, and BAV-3 based on Taqma probes. Detailed implementation manners

[0074] The technical solutions and effects of the present application will be further described in detail below in conjunction with embodiments. It can be understood that the specific embodiments described herein are only used to explain the invention-creation and not to limit the invention-creation.

[0075] Embodiment

[0076] The present invention is used to perform multiplex detection on six RNA / DNA viruses, namely bovine parvovirus (BPV), rabies virus (RV), reovirus (REO-3), bovine parainfluenza virus (PI3), bovine viral diarrhea virus (BVDV), and bovine adenovirus (BAV-3).

[0077] For the specific sequences of each virus, a pair of specific primers and probes are designed, the reaction conditions are optimized, and a multiplex virus detection scheme is established. Specific implementation scheme:

[0078] (1) Construction of virus standards for bovine parvovirus (BPV), rabies virus (RV), reovirus (REO-3), bovine parainfluenza virus (PI3), bovine viral diarrhea virus (BVDV), and bovine adenovirus (BAV-3)

[0079] Retrieve and download the BVDV conserved sequence 5'UTR (MT179836.1), the BPIV-3 matrix protein (M) gene sequence (OM522950.1), the VP2 gene of BPVD as the target gene (GenBank: MN567108.1), the G gene of RV strain 9 (AF499686) (GenBank: LT575363.1), the highly conserved sequence in the E2B region of BAV3 (GenBank: AC_000002.1: 5800-6000), and the conserved region sequence of the M1 gene of reo-3 (GenBank: NC_077841.1) from the GenBank database on the NCBI website.

[0080] (2) Primer and probe design

[0081] For the constructed templates of bovine parvovirus (BPV), rabies virus (RV), reovirus (REO-3), bovine parainfluenza virus (PI3), bovine diarrhea virus (BVDV), and bovine adenovirus (BAV-3), a pair of specific primers and taqman probes were designed respectively; universal sequences were added to both ends of their respective specific sequences, and the complementary sequence of the T7 promoter was added at the 5' end. The qPCR primer sequences and names are shown in Table 1.

[0082] Table 1 Primer sequences for fluorescence quantitative PCR detection

[0083]

[0084]

[0085] (3) PCR amplification

[0086] Plasmid dilution: Dilute the virus plasmid with an original concentration of 10 ng / μl to 0.01 ng / μl according to (5 μl plasmid + 45 μl 40 ng / μl fish sperm DNA diluent).

[0087] The PCR primer sequences are shown in Table 2;

[0088] The PCR system preparation is shown in Table 3;

[0089] The PCR reaction program is shown in Table 4.

[0090] Table 2 PCR amplification primer sequences

[0091] Names of primers and probes Sequences of primers and probes (5’→3’) Universal-PCR-primer-F ACGCAGAAATACGACGTAG Universal-PCR-primer-R ACATAAACGACCATAATGGGTG

[0092] Table 3 PCR amplification system

[0093] Volume for one well TOTAL 50μl 2×MIX (containing buffer) 25μl Forward and reverse primers 10p 2μl RNase Free Water 16μl Plasmid template 5μl

[0094] Table 4 PCR amplification reaction program

[0095]

[0096] (4) Electrophoresis of PCR amplification products

[0097] The electrophoresis loading volume is 2 μl, 2.5% gel, 200 v, 30 min.

[0098] (5) Gel extraction

[0099] Purify and recover using the Novoprotein Gel Extraction Kit.

[0100] (6) In vitro transcription

[0101] Perform in vitro transcription using the purified product as a template, and digest the DNA with DNaseI to remove it.

[0102] (7) Product purification

[0103] The product was further purified using a Novoprotein purification kit.

[0104] (8) RNA quality analysis

[0105] The electrophoretic analysis was performed on the in vitro transcribed and purified RNA to check whether it was of the actual length and whether there was interference; the RNA solution was subjected to primary PCR amplification and then electrophoretic analysis to check for residual DNA;

[0106] (9) Establishment of multiplex fluorescence quantitative PCR detection system

[0107] (10) Establishment of multiplex detection system

[0108] The qPCR reaction system was 10 μL.

[0109] The first group: Bovine parvovirus (BPV)-F (10 p) 0.2 μL, Bovine parvovirus (BPV)-R (10 p) 0.2 μL, Bovine parvovirus (BPV)-P (10 p) 0.1 μL; Rabies virus (RV)-F (10 p) 0.2 μL, Rabies virus (RV)-R (10 p) 0.2 μL, Rabies virus (RV)-P (10 p) 0.1 μL; Reovirus (REO-3)-F (10 p) 0.2 μL, Reovirus (REO-3)-R (10 p) 0.2 μL, Reovirus (REO-3)-P (10 p) 0.1 μL; Internal reference phage-F (10 p) 0.1 μL, Internal reference phage-R (10 p) 0.1 μL, Internal reference phage-P (10 p) 0.05 μL; Water 3.25 μL; Viral RNA 2 μL; Internal reference phage RNA 1 μL.

[0110] The second group: Parainfluenza virus 3 (PI3)-F (10p) 0.2 μl, Parainfluenza virus 3 (PI3)-R (10p) 0.2 μl, Parainfluenza virus 3 (PI3)-P (10p) 0.1 μl; Bovine viral diarrhea virus (BVDV)-F (10p) 0.2 μl, Bovine viral diarrhea virus (BVDV)-R (10p) 0.2 μl, Bovine viral diarrhea virus (BVDV)-P (10p) 0.1 μl; Bovine adenovirus 3 (BAV3)-F (10p) 0.2 μl, Bovine adenovirus 3 (BAV3)-R (10p) 0.2 μl, Bovine adenovirus 3 (BAV3)-P (10p) 0.1 μl; Reference phage-F (10p) 0.1 μl, Reference phage-R (10p) 0.1 μl, Reference phage-P (10p) 0.05 μl; Water 3.25 μl; Viral RNA 2 μl; Reference phage RNA 1 μl. Using Tianlong detection and analysis, reaction conditions: 55 °C for 15 min, 95 °C for 30 s, pre-denaturation; Cycling conditions: 95 °C for 10 s, 60 °C for 30 s, fluorescence collection at 60 °C, for 45 cycles.

[0111] The qPCR amplification reaction procedure is shown in Table 5.

[0112] The multiplex standard curves of BPV, RV, and REO-3 are as Figure 1 shown;

[0113] The multiplex standard curves of PI3, BVDV, and BAV-3 are as Figure 2 shown.

[0114] Table 5 qPCR amplification reaction procedure

[0115]

[0116] This specific embodiment is only an explanation of the present application, and it is not a limitation of the present application. Those skilled in the art can make modifications to this embodiment without creative contributions according to needs after reading this specification, but as long as it is within the scope of the claims of the present application, it is protected by the patent law.

Claims

1. A reagent for detecting viruses in fetal bovine serum, characterized in that A combination of one or more of the following primer pairs: A primer pair for detecting BPV, the sequences of which are shown in SEQ ID NOs: 1 to 2; A primer pair for detecting RV, whose sequences are shown in SEQ ID NOs: 4-5; The primer pair for detecting REO-3, whose sequences are shown in SEQ ID NOs: 7 to 8; A primer pair for detecting PI3, the sequences of which are shown in SEQ ID NOs: 10-11; A primer pair for detecting BVDV, the sequences of which are shown in SEQ ID NOs: 13-14; The sequences of the primer pairs used to detect BAV-3 are shown in SEQ ID NOs: 16-17.

2. The reagent according to claim 1, characterized in that Also included are combinations of one or more of the following probes: A probe for detecting BPV, the sequence of which is shown in SEQ ID NO: 3; A probe for detecting RV, the sequence of which is shown in SEQ ID NO:6; A probe for detecting REO-3, the sequence of which is shown in SEQ ID NO:9; A probe for detecting PI3, the sequence of which is shown in SEQ ID NO: 12; A probe for detecting BVDV, the sequence of which is shown in SEQ ID NO: 15; The sequence of the probe used to detect BAV-3 is shown in SEQ ID NO:

18.

3. The reagent according to claim 1, characterized in that It also includes an internal reference primer pair, whose sequences are shown in SEQ ID NOs. 19-20.

4. A fetal bovine serum virus detection product, characterized in that: The invention comprises the reagent according to any one of claims 1 to 3.

5. The product according to claim 4, characterized in that The product is a detection kit.

6. A method for detecting viruses in fetal bovine serum using multiplex qPCR based on Taqman probes, characterized in that: The following steps are involved: S1, construction of virus standards for bovine parvovirus (BPV), rabies virus (RV), reovirus (REO-3), bovine parainfluenza virus (PI3), bovine diarrhea virus (BVDV), and bovine adenovirus (BAV-3); S2, primer and probe design for bovine parvovirus (BPV), rabies virus (RV), reovirus (REO-3), bovine parainfluenza virus (PI3), bovine diarrhea virus (BVDV), and bovine adenovirus (BAV-3); S3, PCR amplification, electrophoresis of amplified products, gel recovery, in vitro transcription, product purification, and quality analysis; S4, establishment of multiplex fluorescence quantitative PCR detection system.

Images