Application of multi-ligand glycan binding protein 1 gene in regulating and controlling host to resist white spot syndrome virus

Abstract

The invention relates to application of a multi-ligand glycan binding protein 1 gene in regulation and control of white spot syndrome virus resistance of a host. A nucleotide sequence for coding the gene of the multi-ligand glycan binding protein 1 is shown as SEQ ID NO: 1. The length of the ORF sequence of the multi-ligand glycan binding protein 1 gene is 969bp, 322 amino acids are coded in total, and the gene can regulate the WSSV infection resistance of a host, is applied to prevention and treatment of WSSV infection as a potential target for gene editing animal design, and has great significance in reducing abuse of drugs.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and particularly relates to the application of a syntenin-1 gene in regulating the host's resistance to white spot syndrome virus. Background Art

[0002] The viral disease of crustacean cultured animals caused by white spot syndrome virus (WSSV) has seriously affected the healthy and sustainable development of the global crustacean aquaculture industry, causing huge economic losses. However, the pathogenic mechanism and life history of WSSV have not been clarified so far, which restricts the effective prevention and control of this disease. Existing studies have shown that after WSSV is endocytosed into cells, it uses the host cell endosomal system for intracellular transport, and completes the processes of viral envelope fusion and nucleocapsid release in endosomes, so as to promote the nucleic acid and targeted transport of the virus and subsequent viral replication and proliferation. Thus, it can be seen that the intracellular transport process of WSSV is a key step in the successful infection of the virus, but the key regulatory network and molecular mechanism involved in this process remain to be further explored.

[0003] Syntenin-1 (SDCBP) is a multifunctional adaptor protein containing PSD-95 / Dlg / ZO-1 (PDZ) domains, which is mainly involved in biological processes such as intracellular signal transduction, membrane protein sorting, cytoskeleton remodeling, and exosome formation. However, there is no report on the research of Syntenin-1 related to virus infection in crustaceans at present. Summary of the Invention

[0004] The present invention aims to solve at least one of the technical problems in the related art to some extent. To this end, the purpose of the present invention is to provide the application of a syntenin-1 gene in regulating the host's resistance to white spot syndrome virus.

[0005] To this end, in the first aspect of the present invention, the present invention proposes the application of a syntenin-1 or a gene encoding syntenin-1 in regulating the host's antiviral ability, wherein the virus is white spot syndrome virus, and the nucleotide sequence of the gene encoding syntenin-1 is as shown in SEQ ID NO:1.

[0006] According to the application of the present invention, the ORF sequence of the syntenin-1 gene is 969bp long and encodes 322 amino acids in total. This gene can regulate the host's ability to resist WSSV infection, and is used as a potential target for the design of gene-edited animals for the prevention and treatment of WSSV infection, which is of great significance for reducing drug abuse.

[0007] Optionally, the amino acid sequence of the syntenin-1 is as shown in SEQ ID NO:2.

[0008] Optionally, the host is Cherax quadricarinatus.

[0009] In a second aspect of the present invention, there is provided an application of a reagent for knocking down the syndecan binding protein 1 gene in the preparation of a drug against white spot syndrome virus, wherein the nucleotide sequence of the syndecan binding protein 1 gene is as shown in SEQ ID NO:1.

[0010] According to the application of the present invention, after the syndecan binding protein 1 gene is knocked down, the intracellular transport of WSSV is inhibited, and the fusion of the viral envelope and the endosomal membrane and the process of the nucleocapsid exiting the endosome cannot be successfully completed, thereby inhibiting the transcription and replication of WSSV and improving the ability of the host to resist WSSV infection.

[0011] In a third aspect of the present invention, there is provided a drug against white spot syndrome virus, which contains a reagent for knocking down the syndecan binding protein 1 gene, and the nucleotide sequence of the syndecan binding protein 1 gene is as shown in SEQ ID NO:1.

[0012] Additional aspects and advantages of the present invention will be given in part in the following description, become apparent in part from the following description, or be learned through the practice of the present invention. Description of the Drawings

[0013] Figure 1 Prediction of the Cq-Syntenin-1 protein domain according to an embodiment of the present invention;

[0014] Figure 2 Detection of the Cq-Syntenin-1 polyclonal antibody and observation of its endosomal localization according to an embodiment of the present invention;

[0015] Figure 3 Cq-Syntenin-1 promotes the endosomal transport of WSSV according to an embodiment of the present invention;

[0016] Figure 4 Cq-Syntenin-1 promotes the replication of WSSV according to an embodiment of the present invention;

[0017] Figure 5 Interaction between Cq-CD63 and Cq-Syntenin-1 according to an embodiment of the present invention. Detailed Embodiments

[0018] The technical solutions of the present invention will be described below through specific specific examples. It should be understood that one or more method steps mentioned in the present invention do not exclude the existence of other method steps before and after the combined steps or that other method steps can be inserted between these clearly mentioned steps; it should also be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. Moreover, unless otherwise specified, the numbers of each method step are only convenient tools for identifying each method step, rather than limiting the arrangement order of each method step or the scope in which the present invention can be implemented. The change or adjustment of their relative relationship, without substantial change in the technical content, should also be regarded as the scope in which the present invention can be implemented.

[0019] To better understand the above technical solutions, the exemplary embodiments of the present invention will be described in more detail below. Although the exemplary embodiments of the present invention are shown, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided so that the present invention can be understood more thoroughly and the scope of the present invention can be fully conveyed to those skilled in the art.

[0020] The test materials used in the present invention are all ordinary commercially available products and can be purchased in the market; the experiments involved are all conventional experimental methods unless otherwise specified.

[0021] The present invention will be described below with reference to specific embodiments. It should be noted that these embodiments are merely descriptive and do not limit the present invention in any way.

[0022] Example 1 Cloning of the Cq-Syntenin-1 Gene and Prediction of Protein Domains in Red Claw Crayfish

[0023] Search for the ORF sequence of the Cq-Syntenin-1 gene according to the red claw crayfish hematopoietic tissue transcriptome library constructed in the early stage of the laboratory, and design specific amplification primers for PCR. Upstream primer F: 5’-ATGAGTCTGTACCCGTCATT-3’, (SEQ ID NO:3) Downstream primer R: 5’-TTACAGATCTGGGATTGAATGAT-3’ (SEQ ID NO:4). Using red claw crayfish hematopoietic tissue cell cDNA (accession number: XM_053791667.2) as the gene amplification template, the PCR system: template, 50 ng; 1 μL each of the upstream and downstream primers of Cq-Syntenin-1; TaKaRa Max DNA Polymerase, 12.5 μL; Ultra-pure sterilized water was added to make the total system 25 μL. PCR amplification conditions: 98 °C for 5 min; 98 °C for 10 s, 58 °C for 15 s, 72 °C for 30 s, perform 30 cycles; 72 °C for 10 min; 16 °C for 5 min.

[0024] After recovering the PCR product, it was ligated to the pMD18-T vector, transformed into Escherichia coli DH5α, and positive monoclonal bacteria were picked for sequencing. Alignment analysis was performed to determine the obtained Cq-Syntenin-1 gene sequence, and the nucleotide sequence is shown as SEQ ID NO:1.

[0025] The results showed that the ORF sequence of the Cq-Syntenin-1 gene was 969 bp long and encoded 322 amino acids.

[0026] The prediction of the Cq-Syntenin-1 domain is shown in Figure 1 , and the predicted protein molecular weight was approximately 34.4 kDa by online prediction. Cq-Syntenin-1 consists of four domains: an N-terminal domain, a first PDZ domain, a second PDZ domain, and a C-terminal domain; that is, it has 2 PDZ domains.

[0027] Example 2 Preparation of polyclonal antibody against Cq-Syntenin-1 and observation of subcellular localization

[0028] Preparation of polyclonal antibody:

[0029] Prokaryotic expression of Cq-Syntenin-1 protein:

[0030] Primary immunization: The protein concentration for injection should be above 0.8 mg / mL. Use a syringe to aspirate the Cq-Syntenin-1 recombinant protein (obtained in Example 1) and Freund's complete adjuvant, add them in a 1:1 ratio, and emulsify the protein with a protein emulsifier. Use a 1 mL syringe to aspirate the emulsified protein and immunize subcutaneously by the three-point method, injecting 200 μL into each mouse.

[0031] Secondary immunization and tertiary immunization: Every other week, inject the same volume of protein in the same manner as the above steps. Blood was collected 3 - 5 days after the third immunization, and the expression of Cq-Syntenin-1 in Hpt cells was detected by Western Blot.

[0032] Booster immunization: Without adjuvant, directly immunize with 50 - 100 μg of protein, and it can be subcutaneously injected with a thin-tipped syringe (it can also be injected intramuscularly, into the footpad, intraperitoneally, intravenously, or into the spleen), and the process should be slower. Blood was collected 3 - 5 days after immunization.

[0033] Blood collection by enucleating the eyeballs of mice: Gently grasp the neck skin of the mouse with the thumb, index finger, and middle finger of the left hand. Use the little finger and ring finger of the left hand to fix the mouse's tail. Gently press the skin of the eye on the side where the eyeball needs to be removed in the mouse, so that the eyeball bulges more due to congestion. Use forceps to pick up and quickly remove the eyeball, and let the blood flow from the eye socket into a sterile centrifuge tube. Then, euthanize the mouse by cervical dislocation. The obtained blood is allowed to stand at room temperature for 30 min, then at 4 °C for 2 h, and centrifuged at 6000 g at room temperature for 5 min. Take the supernatant and transfer it to a new centrifuge tube to obtain the positive serum, which is stored at -80 °C.

[0034] Subcellular localization observation:

[0035] After pre-incubating Hpt cells with the endosome damage inhibitor DBeQ for 4 h, the subcellular localization of Cq-Syntenin-1 protein was observed using immunofluorescence (IF) assay. The specific method was as follows: Fix the cells with 4% paraformaldehyde at room temperature for 30 min, and wash the cells 3 times with crayfish phosphate buffer saline (CPBS); Permeabilize the cells with 0.2% TritonX-100 at room temperature for 30 min, and wash the cells 3 times with CPBS; Block the cells with 5% goat serum at room temperature for 1 h, then add the mouse polyclonal antibody against Cq-Syntenin-1 diluted at 1:300 and the endosome marker antibody RabGEF1, and incubate overnight at 4 °C. Wash the cells 3 times with CPBS; Add the DyLight488 rabbit fluorescent secondary antibody and DyLight649 mouse secondary antibody diluted at 1:500, incubate at room temperature for 1 h, wash the cells 3 times with CPBS, and stain the cell nuclei with DAPI. Place the cells under a two-photon confocal microscope for observation.

[0036] The results are shown in Figure 2 , the size of the Cq-Syntenin-1 polyclonal antibody is correct and the band is single; Cq-Syntenin-1 co-localizes with the endosome marker molecule RabGEF1, indicating that Cq-Syntenin-1 is localized in the endosome.

[0037] Example 3 Effect of Cq-Syntenin-1 gene knockdown on the endosomal transport of WSSV

[0038] According to the Life technologies T7 Transcription Kit double-stranded synthesis instructions, double-stranded RNA (dsRNA) was synthesized for gene interference experiments. Prepare red claw crayfish Hpt cells in advance and perform dsRNA interference experiments when the cell state is good.

[0039] Transfect according to the amount of 400 ng dsRNA per well in 24-well plates and 100 ng dsRNA per well in 96-well plates. Mix dsRNA with II(1:1) in DEPC water and incubate at room temperature for 10 min; add L15 medium to the mixture, mix well and add it to the cells, gently mix, and continue culturing the cells; 24 h after the first transfection, replace 1 / 2 of the L15 medium and perform the second RNA interference; 12 h after the second interference, replace 1 / 2 of the modified L15 medium again and perform the WSSV infection experiment; collect samples at 2 and 12 h after virus infection for Western blot to detect the change of VP28 protein, and pretreat Hpt cells with cycloheximide (CHX) for 2 h to inhibit protein translation in the cells, and detect the change of VP28 protein 12 h after virus infection. In addition, for the cell immunofluorescence (IF) experiment, observe the co-localization change of WSSV-VP28 and WSSV-VP664 proteins at 2 h after virus infection after knocking down the expression of the Cq-Syntenin-1 gene, and extract Hpt cell RNA 12 h after virus infection, and use relative fluorescence quantitative method to detect the change of the transcription levels of the virus early gene IE1 and the late gene VP28.

[0040] The results are shown in Figure 3 , compared with the control group, after knocking down the Cq-Syntenin-1 gene and infecting with the virus for 2 h, the protein level of VP28 increased, and after treatment with CHX, the VP28 protein level in the Cq-Syntenin-1 knockdown group was significantly higher than that in the control group. Imaging observation also showed obvious co-localization of VP28 and VP664 in the Cq-Syntenin-1 gene knockdown group and they were not completely separated, indicating that the endosomal transport of WSSV was inhibited at this time, hindering the virus uncoating process, and the virus was blocked in the endosome and could not penetrate after knocking down the expression of the Cq-Syntenin-1 gene.

[0041] The results are shown in Figure 4 , after knocking down the expression of the Cq-Syntenin-1 gene, at 3 h, 6 h, and 12 h after infecting with WSSV, the transcription levels of the virus early gene IE1 and the late gene VP28 were significantly reduced, and the expression level of VP28 protein was also significantly reduced. It shows that Cq-Syntenin-1 can promote the transcription and replication of WSSV.

[0042] Example 4 Effect of the binding of Cq-Syntenin-1 to Cq-CD63 and the complex formed by them on WSSV infection

[0043] Construct eukaryotic expression vectors of pXJ40-Cq-Syntenin-1-Myc and VR1012-Cq-CD63-GFP. Design specific primers to add restriction enzyme sites at the 5' ends of the upstream and downstream primers respectively, and perform ORF PCR amplification of the Cq-Syntenin-1 and Cq-CD63 genes. The primers are as follows:

[0044] BamH I-Cq-Syntenin-1-F: CGCGGATCCGCCACCATGAGTCTGTACCCGTCATT(SEQ ID NO:5)

[0045] Xhol I-Cq-Syntenin-1-R: CCGCTCGAGCAGATCTGGGATTGAATGATC(SEQ ID NO:6)

[0046] BamH I-Cq-CD63-F: CGGGATCCATGGCTGATCATAATTTGAGCTG(SEQ ID NO:7)

[0047] Sal I-Cq-CD63-R: GCGTCGACCAAGATCTCGTATCGCTCC(SEQ ID NO:8)

[0048] The PCR amplification system and reaction conditions are shown in Example 1. Recover the PCR products, then double-digest the PCR products and the expression vectors pXJ40-Myc and VR1012-GFP respectively. After ligating the genes with the digested expression vectors respectively, eukaryotic recombinant expression vectors are obtained.

[0049] One day before transfection, seed HEK-293T cells into a 6-well cell culture dish to reach a density of 60%-70% the next day. According to Beyotime Biotechnology Company's Lipo 293 TMTransfection reagent instruction manual: Transfect the pXJ40-Cq-Syntenin-1-Myc and VR1012-Cq-CD63-GFP vectors. Detection can be carried out 24 - 48 hours after transfection. Collect and lyse the cells with IP cell lysis buffer, place them on ice for 20 min, shake the cell plate continuously during this period, then place them on a shaker and shake rapidly for 10 min. Collect the cell lysate and centrifuge at 10000g for 5 min. Take 80 μL of the above solution and add 20 μL of 5×SDS as the Input sample. According to every 500 μL of lysate, take 20 μL of Anti-Myc magnetic beads, add 500 μL of PBS, place on a magnetic rack and wash the magnetic beads 2 times. Then mix the remaining protein solution with the magnetic beads and incubate at 4°C with swirling for 8 h. Wash the above magnetic beads 3 times with PBST, add 80 μL of 1×SDS loading buffer and boil for 10 min for denaturation. Electrophorese the protein samples in a 12% SDS-PAGE gel and perform Western blot experiments to detect protein-protein interactions using anti-GFP and anti-Myc antibodies.

[0050] The results are shown in Figure 5 , demonstrating that the interaction between Cq-CD63 and Cq-Syntenin-1 is conserved in the red swamp crayfish.

[0051] In summary, according to the embodiments of the present invention, on the basis of amplifying the Cq-Syntenin-1 gene, the RNA interference technology is used to knockdown the expression of its endogenous gene in the hematopoietic tissue (Hpt) cells of the red swamp crayfish to verify the function of Cq-Syntenin-1. In addition, the immunoprecipitation (Co-IP) experiment is used to prove the interaction between Cq-CD63 and Cq-Syntenin-1. The results show that after knocking down the expression of the Cq-Syntenin-1 gene in the in vitro cultured crayfish hematopoietic tissue (Hpt) cells, the endosomal trafficking of WSSV particles is inhibited, preventing WSSV from successfully completing the fusion of the viral envelope and the endosomal membrane and the process of the nucleocapsid exiting the endosome, thereby inhibiting the transcription and replication of WSSV. The interaction between Cq-CD63 and Cq-Syntenin-1 in the red swamp crayfish is conserved. Therefore, Cq-Syntenin-1 is of great significance in promoting the endosomal transport of WSSV and has good potential application prospects in the development and application of new drugs against WSSV infection targeting Syntenin-1.

[0052] In the description of this specification, the descriptions referring to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples", etc. mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms should not be understood as necessarily referring to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine the different embodiments or examples described in this specification.

[0053] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. Use of syndecan binding protein 1 or a gene encoding syndecan binding protein 1 in regulating host antiviral activity, characterized in that: The virus is white spot syndrome virus, and the nucleotide sequence of the gene encoding the syndecan binding protein 1 is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: Knocking down the syndecan-binding protein 1 gene can inhibit the replication of white spot syndrome virus and improve the host's anti-infection ability.

3. The use according to claim 1, characterized in that: The amino acid sequence of the syndecan binding protein 1 is shown in SEQ ID NO:

2.

4. The use according to claim 1, characterized in that: The host is red claw crayfish.

5. Use of an agent for knocking down the syndecan binding protein 1 gene in the preparation of a drug against white spot syndrome virus, wherein the nucleotide sequence of the syndecan binding protein 1 gene is shown in SEQ ID NO:

1.

6. A drug for resisting white spot syndrome virus, characterized in that: The drug contains an agent for knocking down the syndecan-binding protein 1 gene, and the nucleotide sequence of the syndecan-binding protein 1 gene is shown in SEQ ID NO:1.

Images