Drug loading system for targeting intratumoral microorganisms, preparation method and application

Abstract

The invention relates to a drug loading system for targeting intratumor microorganisms, a preparation method and application. The drug loading system for targeting the intracellular microorganisms comprises mesoporous silica and an AtpD antibody modified on the surface of the mesoporous silica. The invention provides a preparation method of a drug loading system for targeting in-tumor microorganisms. The preparation method comprises the following steps: preparing mesoporous silica particles by adopting a sol-gel method; carrying out amination modification on the surfaces of the mesoporous silica particles to obtain mesoporous silica particles with primary amine groups on the surfaces; the preparation method comprises the following steps: covalently coupling mesoporous silica particles with primary amine groups on the surfaces with AtpD antibody molecules, and then closing unreacted primary amine groups to obtain the drug delivery system. The invention also provides an application of the drug loading system as a drug delivery system for targeting intracellular microorganisms in esophageal squamous cell carcinoma. The invention solves the problem that the existing LTA-mediated intratumor microorganism targeting drug delivery system is easy to be off target in a systematic drug delivery route.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a drug delivery system targeting intratumoral microorganisms, a preparation method and an application thereof. Background Art

[0002] Antitumor therapies targeting intratumoral microorganisms are a rapidly developing field, and current research is developing new diagnostic markers and treatment methods for microorganisms enriched in the tumor microenvironment. For example, the application of intratumoral microbial combinations disclosed in CN117551763A in predicting the recurrence risk after GIST surgery. This application is, on the one hand, the application of the intratumoral microbial combination as a detection target in the preparation of a product for predicting the recurrence risk after GIST surgery; on the other hand, it is the application of a module for detecting the accumulation degree of intratumoral microorganisms in the preparation of a product for predicting the recurrence risk after GIST surgery. The intratumoral microbiome in this application can accurately predict the recurrence risk after GIST surgery, clarify that a specific intratumoral microbial combination can characterize the recurrence risk situation after GIST surgery, and confirm the specificity and accuracy of the combination as a marker.

[0003] Studies have shown that taking lipoteichoic acid (LTA) on the bacterial cell wall as a target, it has been verified in various tumor types that targeting LTA has better targeting than traditional tumor cell surface molecular markers. However, LTA is widely distributed in some Gram-positive bacteria and does not have the specificity of a single bacterial species. Systemic administration targeting LTA is prone to off-target problems, resulting in unnecessary side effects and reduced therapeutic effects. Therefore, it is necessary to seek a new type of antitumor drug carrier targeting intratumoral microorganisms. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a drug delivery system targeting intratumoral microorganisms, a preparation method and an application thereof, so as to solve the problem that the existing LTA-mediated drug delivery system targeting intratumoral microorganisms is prone to off-target in the systemic administration route.

[0005] To achieve the above purpose, the technical scheme adopted by the present invention is as follows:

[0006] A drug delivery system targeting intratumoral microorganisms, comprising mesoporous silica and an AtpD antibody modified on the surface of the mesoporous silica.

[0007] According to the above technical means, through the chemical bonding of the AtpD antibody that specifically binds to specific microbial surface molecules with the functional groups on the surface of mesoporous silica, targeted modification is achieved, enabling the obtained drug delivery system to specifically bind to microorganisms in the tumor microenvironment, thereby achieving precise targeting of tumors, significantly improving the targeting of drugs, reducing damage to normal tissues, and enhancing the safety and effectiveness of treatment.

[0008] Among them, the AtpD antibody refers to a rabbit anti-ATP synthase (AtpD) subunit polyclonal antibody, or simply referred to as an AtpD polyclonal antibody. Among them, AtpD is the CF1 delta subunit of ATP synthase and plays an important role in the process of ATP synthesis.

[0009] Preferably, the particle size of the drug delivery system (atpD-MSN) is 140 nm to 160 nm.

[0010] Preferably, the ζ potential of the drug delivery system (atpD-MSN) is -35 mV.

[0011] Preferably, the modification amount of the AtpD antibody is 100 μg of AtpD antibody per 5 mg of mesoporous silica.

[0012] The present invention also provides a preparation method of a drug delivery system targeting intratumoral microorganisms, including the following steps:

[0013] S1. Prepare mesoporous silica particles by the sol-gel method;

[0014] S2. Modify the surface of the mesoporous silica particles by amination to obtain mesoporous silica particles with primary amine groups on the surface;

[0015] S3. Covalently couple the mesoporous silica particles with primary amine groups on the surface to AtpD antibody molecules, and then block the unreacted primary amine groups to obtain the drug delivery system.

[0016] By aminating the surface of mesoporous silica particles, mesoporous silica particles with primary amine groups on the surface are obtained. This step improves the surface activity of the particles, provides reaction sites for subsequent covalent coupling, and at the same time, the primary amine groups have good biocompatibility, which is beneficial to the application of the drug delivery system in vivo. The mesoporous silica particles with primary amine groups on the surface are covalently coupled with AtpD antibody molecules to obtain a drug delivery system that specifically targets intratumoral microorganisms. This covalent coupling method can ensure the stable binding between the antibody molecules and the mesoporous silica particles, avoiding shedding or dissociation in vivo. At the same time, by blocking the unreacted primary amine groups, the stability and biocompatibility of the drug delivery system are further improved. And the sol-gel method is used to prepare mesoporous silica particles, which has the advantages of simple process and low cost. At the same time, mesoporous silica particles with high specific surface area and good pore structure can be prepared, providing a good basis for subsequent modification and drug loading. Therefore, the preparation method of the drug delivery system of the present invention has the advantages of simple process, low cost, good stability of the prepared drug delivery system, excellent biocompatibility and specific targeting of intratumoral microorganisms.

[0017] Preferably, in the step S1, it includes: mixing a silicon source and a template agent to obtain a mixed solution, adjusting the mixed solution to be alkaline, carrying out a sol-gel reaction, and eluting to obtain mesoporous silica particles.

[0018] Preferably, the sol-gel reaction is a stirring reaction for 12 h under the conditions of a temperature of 40 °C and a rotation speed of 300 rpm.

[0019] Preferably, the silicon source is selected from tetraethyl orthosilicate (TEOS).

[0020] Preferably, the template agent is selected from cetyltrimethylammonium bromide (CTAB).

[0021] Preferably, in the step S2, it includes: adding the mesoporous silica particles into 3-aminopropyltriethoxysilane, stirring and reacting for 24 h to achieve amination modification, and obtaining mesoporous silica particles with primary amine groups on the surface.

[0022] Preferably, in the step S3, it includes: adding the mesoporous silica particles with primary amine groups on the surface and AtpD antibody molecules into a cross-linking agent, stirring and reacting for 3 h under the conditions of a temperature of 4 °C and a rotation speed of 100-200 rpm for covalent coupling, and then using bovine serum albumin (BSA) to block the unreacted primary amine groups to obtain a drug delivery system.

[0023] By using bovine serum albumin (BSA) to block the unreacted primary amine groups, non-specific adsorption is effectively reduced.

[0024] Preferably, the method for preparing the AtpD antibody includes: obtaining an antibody against AtpD by using the polyclonal antibody preparation technique. During the preparation process, the AtpD protein is used as an antigen for animal immunization, and finally purified to obtain the AtpD antibody.

[0025] Preferably, the method for preparing the AtpD antibody specifically includes the following steps:

[0026] S1. Preparation of antigen: Expression and purification of AtpD protein: Using recombinant DNA technology, clone the AtpD gene into an expression vector, transform it into Escherichia coli BL21 for expression; Induce expression: Add IPTG (final concentration 0.1 - 1 mM), induce at 37 °C for 4 - 6 hours or induce overnight at 16 °C; Collect the bacteria, lyse them, and purify the AtpD protein by affinity chromatography (Ni-NTA column); Dialyze to remove impurities, measure the protein concentration (Bradford method), and aliquot and store at -80 °C. Antigen emulsification: Mix the purified AtpD protein with adjuvant in a volume ratio of 1:1, and emulsify until a stable milky white liquid is formed;

[0027] S2. Animal immunization: Select Balb / c mice, 3 in each group, for primary immunization (subcutaneously inject 100 - 200 μg of the emulsified antigen - AtpD protein into the animals); Thereafter, perform booster immunization every 2 - 4 weeks, emulsify the antigen with Freund's incomplete adjuvant, and the dose is 1 / 2 to 2 / 3 of the primary immunization; Finally, after 3 - 5 booster immunizations until the antibody titer reaches the requirement; 7 - 10 days after the last booster immunization, collect a small amount of blood (such as ear marginal vein blood collection or tail vein blood collection), separate the serum; Use the ELISA method to detect the titer of AtpD antibody in the serum, and a titer of 1:10,000 or more can be used for large-scale blood collection.

[0028] S3. Antibody purification: Serum pretreatment: Let the collected blood stand for 1 - 2 hours, centrifuge (3000 rpm, 10 minutes) to separate the serum; Filter to remove impurities; Purify the polyclonal antibody using a ProteinA / G affinity chromatography column: Dilute the serum with binding buffer (such as PBS, pH 7.4), load it onto the ProteinA / G column; Elute the antibody with a low pH elution buffer (such as 0.1 M glycine-HCl, pH 2.7 - 3.0), and immediately neutralize it with a neutralization buffer (such as 1 M Tris-HCl, pH 8.0); Dialyze the purified antibody into PBS buffer to remove the residual elution buffer; Use a UV spectrophotometer to measure the antibody concentration (A280 nm, 1.4 OD ≈ 1 mg / mL).

[0029] Preferably, the cross-linking agent is selected from glutaraldehyde.

[0030] The present invention also provides an application of the drug delivery system prepared by the preparation method as a drug delivery system targeting intratumoral microorganisms in esophageal squamous cell carcinoma.

[0031] Preferably, the drug delivery system is a drug delivery system targeting the surface membrane protein of Gemella haemolysans (G.h) in esophageal squamous cell carcinoma.

[0032] Advantages of the present invention:

[0033] For the drug delivery system of the present invention, through the chemical bonding of the AtpD antibody specifically binding to specific microbial surface molecules with the functional groups on the surface of mesoporous silica, targeted modification is achieved, enabling the obtained drug delivery system to specifically bind to microorganisms in the tumor microenvironment, thereby achieving precise targeting of tumors, significantly improving the targeting of drugs, reducing damage to normal tissues, and enhancing the safety and effectiveness of treatment, providing a theoretical basis and technical support for the development of bacterial-targeted drug delivery tools.

[0034] For the preparation method of the drug delivery system of the present invention, by subjecting the surface of mesoporous silica particles to amination modification, mesoporous silica particles with primary amine groups on the surface are obtained. This step improves the surface activity of the particles, provides reaction sites for subsequent covalent coupling, and at the same time, the primary amine groups have good biocompatibility, which is beneficial to the application of the drug delivery system in vivo. The mesoporous silica particles with primary amine groups on the surface are covalently coupled with AtpD antibody molecules to obtain a drug delivery system specifically targeting intratumoral microorganisms. This covalent coupling method can ensure the stable binding between antibody molecules and mesoporous silica particles, avoiding shedding or dissociation in vivo. At the same time, by blocking the unreacted primary amine groups, the stability and biocompatibility of the drug delivery system are further improved, and it has application value in the field of biomedical technology. Description of the Drawings

[0035] Figure 1 It is a result diagram of the analysis of the abundance and colony composition similarity of each bacterial phylum and genus in esophageal squamous cell carcinoma (ESCC) tumor tissues. Among them, A is a schematic diagram of the sampling and sequencing process of esophageal cancer, B is a diagram showing the change in the proportion of each bacterial phylum in normal (N) and tumor (T) tissues, C is a diagram showing the change in the proportion of each bacterial genus in normal (N) and tumor (T) tissues, D is a result diagram of the analysis of bacterial α-diversity in tissues, and E is a result diagram of the analysis of bacterial β-diversity in tissues;

[0036] Figure 2 It is a result diagram of the LEfSe flora difference analysis. Among them, A is a Circos diagram of the differential flora in the normal group and the tumor group, B is a bar chart of the differential flora in the normal group and the tumor group, C is a diagram of the within-group expression abundance of each sample group, and D is an expression volcano diagram of the differential flora in the normal group and the tumor group;

[0037] Figure 3 It is a result graph for qRT-PCR to verify the abundance of G.h bacteria in tissue samples;

[0038] Figure 4 It is a result graph for FISH experiment to verify the abundance of G.h bacteria in tissue samples;

[0039] Figure 5 It is a result graph for mass spectrometry to screen surface membrane proteins specific to G.h under hypoxic conditions. Among them, A is the principal component analysis graph of three groups of samples including the outer membrane protein normoxia group (OMP 20% O 2 ), the outer membrane protein hypoxia group (OMP 2% O 2 ), and the amino acid exposure hypoxia group (SE 2% O 2 ). B is the protein Venn graph between groups, and C is the bar graph of the quantitative difference results of proteins in each group;

[0040] Figure 6 It is a result graph that the atpD protein is significantly highly expressed under hypoxic conditions;

[0041] Figure 7 It is a TEM graph of the drug-loaded system prepared in Example 3;

[0042] Figure 8 It is a particle size distribution graph of the drug-loaded system;

[0043] Figure 9 It is a ζ potential graph of the drug-loaded system;

[0044] Figure 10 It is an energy-dispersive X-ray spectroscopy (EDX) graph of the drug-loaded system. Among them, D is NH2-MSN, and E is atpD-MSN modified with an antibody based on NH2-MSN;

[0045] Figure 11 It is a result graph of the in vitro targeting test of the drug-loaded system. Detailed implementation manners

[0046] The following will describe the implementation manners of the present invention with reference to the accompanying drawings and preferred embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be understood that the preferred embodiments are only for explaining the present invention, rather than for limiting the protection scope of the present invention.

[0047] It should be noted that the diagrams provided in the following embodiments only illustrate the basic concept of the present invention in a schematic manner. Therefore, only the components related to the present invention are shown in the diagrams, rather than being drawn according to the number, shape, and size of the components in actual implementation. The types, quantities, and proportions of the components in actual implementation can be arbitrarily changed, and the component layout type may also be more complex.

[0048] Example 1

[0049] As Figure 1 shown, enrichment analysis of Gemella haemolysans (G.h) in esophageal squamous cell carcinoma (ESCC)

[0050] First, 25 pairs of samples were selected for 16S rRNA sequencing to analyze the composition and characteristics of the microbiota in ESCC. Bacteria were identified and annotated at each level. At the phylum classification level, the relative abundances of Firmicutes and Proteobacteria were relatively high. At the genus classification level, the relative abundances of Streptococcus, Corynebacterium, Prevotella, and Gemella were relatively high. In ESCC tissues and adjacent cancer samples, by analyzing the Alpha and beta diversities of the samples, it was found that the differences in bacterial richness and microbiota composition similarity between the two groups were not significant.

[0051] As Figure 2 shown, LEfSe was used for microbiota differential analysis, and 25 significantly different microbiota were screened out, mainly concentrated in Gemella, Corynebacterium, Pseudomonas, and Treponema. Among them, the differential microbiota were mainly concentrated in Gemella, Corynebacterium, Pseudomonas, and Treponema; the abundances of Gemella and Treponema in ESCC were relatively high, while the abundances of Corynebacterium and Pseudomonas were relatively low, showing significant differences.

[0052] q-PCR experiments and FISH experiments were used for verification. The specific operation steps were as follows:

[0053] First, for the q-PCR experiment, a tissue bacterial DNA extraction kit (QIAGEN 51804) was used to extract the DNA of bacteria in tissue samples for qPCR amplification. Among them, the target primer sequences were: G.h-F (SEQ ID No.1): GTGGAGGGTCATTGGAAACT; R 1 (SEQ ID No.2): CCACTGGTTTCTCCTAATC; the internal reference primer 16S rRNA-F (SEQ ID No.3): CGGTGAATACGTTCYCGG; R 2(SEQ ID No.4): GGWTACCTTGTTACGACTT). The qPCR reaction conditions were: pre-denaturation at 95°C for 30 seconds, amplification cycle at 95°C for 5 seconds - 60°C for 30 seconds (40 cycles). Secondly, for the FISH experiment, the tissue samples were fixed with 4% paraformaldehyde, sectioned, washed and air-dried, dehydrated successively with 50%, 80%, and 100% ethanol for 3 minutes each step, and air-dried; then the hybridization buffer (formamide, SSC buffer, deionized formamide, 10 ng / μL probe) was prepared, the hybridization solution (20 - 50 μL) was added dropwise onto the samples, and a coverslip was covered; the slides were placed in a preheated humid box and hybridized at 46°C for 2 - 4 hours; after washing, DAPI nuclear staining was performed, and finally, the slides were mounted and observed under a fluorescence microscope. The probe sequences were as follows: G.h (SEQ ID No.5):

[0054] 5'-CACTCTCCCCTCTTGCAC-3' FITC; 16s rRNA (Eub338) (SEQ ID No.6): 5'-GCTGCCTCCCGTAGGAGT-3' Cy3, and the results were as Figure 3 and Figure 4 shown.

[0055] From Figure 3 and Figure 4 analysis, it was found that the abundance of G.h was the highest in ESCC tissue samples.

[0056] Example 2

[0057] Identification of the surface membrane protein of the specific bacterial species - Gemella haemolysans (G.h) under hypoxic conditions

[0058] To identify the surface membrane protein of G.h under hypoxic conditions, Gemella haemolysans (G.haemolysans ATCC10379) was cultured under hypoxic conditions containing 2% O 2 and under normoxic conditions containing 20% O 2 . Meanwhile, the membrane proteins were extracted using a bacterial membrane protein extraction kit (PH1461, PHYGENE); for the extraction of surface-exposed (SE) proteins, the cell-impermeable PEG-Biotin was used to label the primary amine groups exposed to the extracellular environment, and then the SE proteins were purified using a high-capacity streptavidin resin column (Thermo Fisher Scientific). The above experiments were performed with three biological replicates, and only the proteins identified in all three biological replicates were retained for subsequent analysis in the mass spectrometry experiment, and the results were as Figure 5 and Figure 6 shown.

[0059] From Figure 5 and Figure 6 Analysis shows that the results of proteomic analysis indicate that the principal component analysis (PCA) of the three groups of samples shows good discrimination among the samples. Meanwhile, a Venn diagram was constructed to analyze the protein distribution under hypoxic and normoxic conditions, screening for proteins unique to the hypoxic condition, and further screening for proteins that appear in both the hypoxic outer membrane proteins and the surface-exposed proteins but not in the normoxic outer membrane proteins. It was found that 109 outer membrane proteins were identified under normoxic conditions, while 141 outer membrane proteins were identified under hypoxic conditions, among which 39 were proteins unique to the hypoxic condition. 102 potential surface-exposed proteins were detected under hypoxic conditions, among which 12 were present in both the OMP hypoxic and SE hypoxic groups but not in the OMP normoxic group.

[0060] The above results indicate that G.h has a hypoxic adaptation mechanism, and it can adapt to the hypoxic environment by regulating the expression of outer membrane proteins and surface-exposed proteins. These changes are involved in ATP-dependent metabolic activities, material transport, signal transduction, and membrane stability regulation. Secondly, the 12 hypoxic-specific proteins screened out, including transport proteins and metabolism-related enzymes, among which the increase in AtpD expression is the most significant, thus demonstrating that AtpD can be a potential target for drug delivery or vaccine development.

[0061] Example 3

[0062] A method for preparing a drug delivery system targeting intratumoral microorganisms, comprising the following steps:

[0063] S1. Mix tetraethyl orthosilicate (TEOS) and cetyltrimethylammonium bromide (CTAB) to obtain a mixed solution, adjust the mixed solution to be alkaline, carry out a sol-gel reaction, and elute to remove the template agent to obtain mesoporous silica particles (MSNs) with uniform pore size, specifically including:

[0064] Dissolve 0.5 g of cetyltrimethylammonium bromide (CTAB) in a mixed solution of 50 mL of deionized water and 50 mL of absolute ethanol, stir until completely dissolved, add 1.0 mL of ammonia water, and stir evenly to adjust the mixed solution to be alkaline; then slowly drop 1.0 mL of tetraethyl orthosilicate (TEOS) into the mixed solution, continuously stir for 6 h under the conditions of a rotation speed of 500 rpm and room temperature to carry out the sol-gel reaction, centrifuge for 10 min under the condition of a rotation speed of 10000 rpm, collect the precipitate, wash the precipitate alternately with deionized water and ethanol 3 times, disperse the precipitate in ethanol, add 1 mL of hydrochloric acid (1 M), reflux at 80 °C for 24 hours to remove the CTAB template agent, centrifuge to collect the MSNs, wash with deionized water 3 times, and dry to obtain mesoporous silica particles (MSNs) with uniform pore size for standby;

[0065] S2. Add mesoporous silica particles (MSNs) to 3-aminopropyltriethoxysilane to perform amino modification on the surface of the mesoporous silica particles (MSNs), obtaining mesoporous silica particles with primary amine groups on the surface, specifically including:

[0066] Disperse 100 mg of the MSNs obtained in S1 in 50 mL of anhydrous toluene, ultrasonically treat for 10 minutes, then add 1.0 mL of 3-aminopropyltriethoxysilane (APTES), reflux and react at 80 °C for 12 h, centrifuge for 10 min at a rotation speed of 10000 rpm, collect the particles, wash the particles alternately with toluene and ethanol 3 times, and then dry to obtain mesoporous silica particles with primary amine groups on the surface (NH 2 -MSNs);

[0067] S3. Use the polyclonal antibody preparation technology to obtain an antibody against AtpD. During the preparation process, use the AtpD protein as an antigen for animal immunization, and finally purify to obtain the AtpD antibody, specifically including:

[0068] Emulsify the AtpD protein and Freund's complete adjuvant in equal volume, and immunize the animals for the first time (subcutaneous or intramuscular injection). The AtpD protein antigen is 100 μg per immunization, and the experimental animals are Balb / c mice; boost the immunization every 2 - 4 weeks, and emulsify the AtpD protein with Freund's incomplete adjuvant in equal volume; collect the serum 7 - 10 days after the last immunization, centrifuge and separate; use ProteinA / G affinity chromatography to purify the antibody to obtain the AtpD antibody, determine the concentration, and then aliquot and store at -20 °C;

[0069] S4. Add the mesoporous silica particles with primary amine groups on the surface and AtpD antibody molecules together to glutaraldehyde for covalent coupling reaction, and then use bovine serum albumin (BSA) to block the unreacted primary amine groups to reduce non-specific adsorption, obtaining a drug delivery system (atpD-MSN), specifically including:

[0070] Disperse 10 mg of NH 2 -MSNs in 10 mL of phosphate buffer (PBS, pH 7.4), ultrasonically treat for 10 minutes, then add 100 μL of glutaraldehyde (concentration 25%), stir and react at room temperature for 2 hours, then centrifuge for 10 min at a rotation speed of 10000 rpm, collect the particles, wash the particles 3 times with PBS, redisperse the particles in phosphate buffer (PBS, pH 7.4), then add 1 mg of AtpD antibody, react at room temperature for 4 hours, then add 1% bovine serum albumin (BSA) solution, block at room temperature for 1 hour, centrifuge to collect the particles, and wash the particles 3 times with PBS to obtain the drug delivery system (atpD-MSN).

[0071] Example 4

[0072] A preparation method of a drug-loaded system targeting intratumoral microorganisms, comprising the following steps:

[0073] S1. Mix tetraethyl orthosilicate (TEOS) and cetyltrimethylammonium bromide (CTAB) to obtain a mixed solution, adjust the mixed solution to be alkaline, carry out a sol-gel reaction, and elute and remove the template agent to obtain mesoporous silica particles (MSNs) with uniform pore sizes, specifically including:

[0074] Dissolve 0.5 g of cetyltrimethylammonium bromide (CTAB) in a mixed solution of 50 mL of deionized water and 50 mL of absolute ethanol, stir until completely dissolved, add 1.0 mL of ammonia water, and stir evenly to adjust the mixed solution to be alkaline; then slowly drop 1.0 mL of tetraethyl orthosilicate (TEOS) into the mixed solution, continuously stir for 6 h under the conditions of a rotation speed of 500 rpm and room temperature to carry out a sol-gel reaction, centrifuge for 10 min under the condition of a rotation speed of 10,000 rpm, collect the precipitate, alternately wash the precipitate 3 times with deionized water and ethanol, disperse the precipitate in ethanol, add 1 mL of hydrochloric acid (1 M), reflux at 80 °C for 24 hours to remove the CTAB template agent, centrifuge to collect MSNs, wash 3 times with deionized water, and dry to obtain mesoporous silica particles (MSNs) with uniform pore sizes for standby;

[0075] S2. Add the mesoporous silica particles (MSNs) to 3-aminopropyltriethoxysilane to carry out amino modification on the surface of the mesoporous silica particles (MSNs) to obtain mesoporous silica particles with primary amine groups on the surface, specifically including:

[0076] Disperse 100 mg of the MSNs obtained in S1 in 50 mL of absolute toluene, ultrasonically treat for 10 minutes, then add 1.0 mL of 3-aminopropyltriethoxysilane (APTES), reflux and react at 80 °C for 12 h, centrifuge for 10 min under the condition of a rotation speed of 10,000 rpm, collect the particles, alternately wash the particles 3 times with toluene and ethanol, and then dry to obtain mesoporous silica particles with primary amine groups on the surface (NH 2 -MSNs);

[0077] S3. Use the polyclonal antibody preparation technology to obtain an antibody against AtpD. During the preparation process, use the AtpD protein as an antigen for animal immunization, and finally purify to obtain the AtpD antibody, specifically including:

[0078] Mix the AtpD protein with an equal volume of Freund's complete adjuvant and emulsify it. Immunize the animals for the first time (subcutaneously or intramuscularly). The AtpD protein antigen is 100 μg per immunization, and the experimental animals are Balb / c mice. Boost the immunization every 2 - 4 weeks, and mix and emulsify the AtpD protein with an equal volume of Freund's incomplete adjuvant. Collect the serum 7 - 10 days after the last immunization, and centrifuge for separation. Purify the antibody using Protein A / G affinity chromatography to obtain the AtpD antibody. After measuring the concentration, aliquot and store it at -20°C.

[0079] S4. Add the mesoporous silica particles with a primary amine group on the surface and AtpD antibody molecules into glutaraldehyde for a covalent coupling reaction. Then use bovine serum albumin (BSA) to block the unreacted primary amine groups to reduce non-specific adsorption, and obtain the drug-loading system (atpD-MSN), which specifically includes:

[0080] Disperse 10 mg of NH 2 -MSNs in 10 mL of phosphate buffer (PBS, pH 7.4), sonicate for 10 minutes, then add 100 μL of glutaraldehyde (concentration 25%), stir and react at room temperature for 2 hours. Subsequently, centrifuge at 10000 rpm for 10 min, collect the particles, wash the particles 3 times with PBS, redisperse the particles in phosphate buffer (PBS, pH 7.4), then add 50 μg of AtpD antibody, react at room temperature for 4 hours, then add 1% bovine serum albumin (BSA) solution, block at room temperature for 1 hour, centrifuge to collect the particles, and wash the particles 3 times with PBS to obtain the drug-loading system (atpD-MSN).

[0081] Example 5

[0082] A preparation method of a drug-loading system targeting intratumoral microorganisms, comprising the following steps:

[0083] S1. Mix tetraethyl orthosilicate (TEOS) and cetyltrimethylammonium bromide (CTAB) to obtain a mixed solution. Adjust the mixed solution to be alkaline, carry out a sol-gel reaction, and elute to remove the template agent to obtain mesoporous silica particles (MSNs) with a uniform pore size, which specifically includes:

[0084] Dissolve 0.5 g of cetyltrimethylammonium bromide (CTAB) in a mixed solution of 50 mL of deionized water and 50 mL of absolute ethanol, stir until completely dissolved, add 1.0 mL of ammonia water, and stir evenly to adjust the mixed solution to alkaline; then slowly add 1.0 mL of tetraethoxysilane (TEOS) to the mixed solution, and continuously stir at a rotation speed of 500 rpm and room temperature for 6 h to carry out the sol-gel reaction. Centrifuge for 10 min at a rotation speed of 10,000 rpm, collect the precipitate, wash the precipitate alternately with deionized water and ethanol 3 times, disperse the precipitate in ethanol, add 1 mL of hydrochloric acid (1 M), and reflux at 80 °C for 24 h to remove the CTAB template agent. Centrifuge to collect MSNs, wash with deionized water 3 times, and dry to obtain mesoporous silica particles (MSNs) with uniform pore size for standby;

[0085] S2. Add the mesoporous silica particles (MSNs) to 3-aminopropyltriethoxysilane to carry out amino modification on the surface of the mesoporous silica particles (MSNs) to obtain mesoporous silica particles with primary amine groups on the surface, specifically including:

[0086] Disperse 100 mg of the MSNs obtained in S1 in 50 mL of absolute toluene, ultrasonically treat for 10 minutes, then add 1.0 mL of 3-aminopropyltriethoxysilane (APTES), reflux and react at 80 °C for 12 h, centrifuge for 10 min at a rotation speed of 10,000 rpm, collect the particles, wash the particles alternately with toluene and ethanol 3 times, and then dry to obtain mesoporous silica particles (NH 2 -MSNs) with primary amine groups on the surface;

[0087] S3. Use the polyclonal antibody preparation technology to obtain an antibody against AtpD. During the preparation process, use the AtpD protein as an antigen for animal immunization, and finally purify to obtain the AtpD antibody, specifically including:

[0088] Emulsify the AtpD protein and Freund's complete adjuvant in equal volume for primary immunization of animals (subcutaneous or intramuscular injection). The AtpD protein antigen is 100 μg per immunization, and the experimental animals are Balb / c mice; boost the immunization every 2 - 4 weeks, and emulsify the AtpD protein with an equal volume of Freund's incomplete adjuvant; collect the serum 7 - 10 days after the last immunization, centrifuge and separate; use Protein A / G affinity chromatography to purify the antibody to obtain the AtpD antibody, determine the concentration, and then aliquot and store at -20 °C;

[0089] S4. Add mesoporous silica particles with primary amine groups on the surface and AtpD antibody molecules together into the carbodiimide cross-linking agent EDC / NHS [1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride / N-hydroxysuccinimide] for covalent coupling reaction, and then use bovine serum albumin (BSA) to block the unreacted primary amine groups to reduce non-specific adsorption, obtaining a drug-loading system (atpD-MSN), specifically including:

[0090] Disperse 10 mg of NH 2 -MSNs in 10 mL of phosphate buffer (PBS, pH 6.0), sonicate for 10 minutes to ensure uniform dispersion of the particles, and then add EDC to a final concentration of 10 mM (for example, add 2 mg of EDC) and NHS to a final concentration of 5 mM (for example, add 1.2 mg of NHS), stir and react at room temperature for 30 minutes to 1 hour to activate the primary amine groups on the surface of NH 2 -MSNs. Subsequently, centrifuge at 10,000 rpm for 10 min, collect the activated particles, wash the activated particles 3 times with PBS buffer (pH 7.4) to remove the unreacted EDC and NHS, and redisperse the activated NH 2 -MSNs particles in 10 mL of phosphate buffer (PBS, pH 7.4). Then add 1 mg of AtpD antibody, gently mix, stir and react at room temperature for 2 - 4 hours or react overnight at 4 °C to covalently bind the antibody to the activated primary amine groups. After that, add 1% bovine serum albumin (BSA) solution (for example, add 1 mL of 1% BSA), block at room temperature for 1 hour to reduce non-specific adsorption, centrifuge at 10,000 rpm for 10 min, collect the particles, wash the particles 3 times with PBS to remove the unbound antibody and BSA, and redisperse the coupled particles in PBS buffer to obtain the drug-loading system (atpD-MSN), which is stored at 4 °C for standby.

[0091] Control Example 1

[0092] A preparation method of a drug-loading system targeting intratumoral microorganisms with lipoteichoic acid (LTA) as the target, including the following steps:

[0093] S1. Mix tetraethyl orthosilicate (TEOS) and cetyltrimethylammonium bromide (CTAB) to obtain a mixed solution, adjust the mixed solution to be alkaline, carry out a sol-gel reaction, and elute and remove the template agent to obtain mesoporous silica particles (MSNs) with uniform pore size;

[0094] S2. Add mesoporous silica particles (MSNs) to 3-aminopropyltriethoxysilane to conduct amino modification on the surface of the mesoporous silica particles (MSNs), and obtain mesoporous silica particles with primary amine groups on the surface.

[0095] S3. Add the mesoporous silica particles with primary amine groups and lipoteichoic acid (LTA) to glutaraldehyde together to conduct a covalent coupling reaction, and then use bovine serum albumin (BSA) to block the unreacted primary amine groups to reduce non-specific adsorption, and obtain a drug delivery system (LTA-MSN).

[0096] Detection and analysis

[0097] 1) Transmission electron analysis

[0098] Conduct transmission electron microscopy analysis on the drug delivery system (atpD-MSN) prepared in Example 3 to observe the microstructure and morphology of the MSNs (atpD-MSN) modified with AtpD antibody in the drug delivery system, and the results are as Figure 7 shown.

[0099] Figure 7 Among them, the left figure is the morphology diagram at a size of 100 nm, and the right figure is the morphology diagram at a size of 50 nm.

[0100] It can be observed from Figure 7 that the morphology of the nanoparticles is nearly spherical and has a mesoporous structure.

[0101] 2) Particle size analysis

[0102] Adopt dynamic light scattering (DLS) to conduct particle size analysis on the drug delivery system (atpD-MSN) prepared in Example 3 and the drug delivery system (LTA-MSN) prepared in Control Example 1, and the results are as Figure 8 shown.

[0103] It can be analyzed from Figure 8 that the average particle size of the drug delivery system (LTA-MSN) prepared in Example 3 is about 94 nm, while the average particle size of the drug delivery system (atpD-MSN) prepared in Control Example 1 is about 137 nm.

[0104] 3) Surface potential measurement

[0105] Adopt a Zeta potential analyzer to conduct ζ potential analysis on the drug delivery system (atpD-MSN) prepared in Example 3 and the drug delivery system (LTA-MSN) prepared in Control Example 1, and the results are as Figure 9 shown.

[0106] It can be seen from Figure 9Analysis shows that the ζ potential of the drug-loaded system (atpD-MSN) prepared in Example 3 is about -35.4 mV, while the ζ potential of the drug-loaded system (LTA-MSN) prepared in Control Example 1 is about -25.9 mV, thus proving that the drug-loaded system (atpD-MSN) of the present invention has good stability in solution.

[0107] 4) Elemental composition analysis

[0108] The elemental composition of the drug-loaded system (atpD-MSN) prepared in Example 3 was analyzed using an energy dispersive X-ray fluorescence spectrometer, and the results are as Figure 10 shown.

[0109] From Figure 10 analysis, it can be seen that characteristic peaks of P (phosphorus) and S (sulfur) appear after antibody modification, thus proving that the atpD antibody molecule has successfully bound to the surface of mesoporous silica particles (MSNs).

[0110] 5) Confocal laser scanning analysis

[0111] The Gemella haemolysans labeled with FITC (green fluorescence) was incubated with the drug-loaded system (atpD-MSNs) prepared in Example 3 labeled with Cy5 (red fluorescence) and NH 2 -MSNs for 2 hours respectively, and then fluorescence images were taken using a confocal laser scanning microscope (CLSM) to observe whether the red fluorescence was specifically enriched on the surface of bacteria to verify the targeting effect. The results are as Figure 11 shown.

[0112] Figure 11 In, the left figure is LTA-MSN, and the right figure is atpD-MSN.

[0113] From Figure 11 analysis, it can be seen that the red fluorescence-labeled atpD-MSNs are specifically enriched on the surface of the green fluorescence-labeled Gemella haemolysans, thus proving that the prepared surface-modified AtpD antibody achieves high-specific targeting of Gemella haemolysans. This system provides a theoretical basis and technical support for the development of bacterial-targeted drug delivery tools.

[0114] The above embodiments are only preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention.

Claims

1. A drug delivery system targeting intratumoral microorganisms, characterized in that: The invention comprises mesoporous silica and AtpD antibody modified on the surface of the mesoporous silica.

2. The drug delivery system targeting intratumoral microorganisms according to claim 1, characterized in that: The particle size of the drug delivery system is 140 nm to 160 nm; and / or, the zeta potential of the drug delivery system is -35 mV; And / or, the modification amount of the AtpD antibody is 100 μg AtpD antibody per 5 mg mesoporous silica.

3. A method for preparing a drug delivery system targeting intratumoral microorganisms according to claim 1 or claim 2, characterized in that: The following steps are involved: S1, preparing mesoporous silica particles by a sol-gel method; S2, modifying the surface of the mesoporous silica particles by amino modification to obtain mesoporous silica particles with primary amine groups on the surface; S3. Covalently couple the mesoporous silica particles with primary amine groups on the surface to the AtpD antibody molecules, and then block the unreacted primary amine groups to obtain a drug delivery system.

4. The preparation method according to claim 3, characterized in that: The step S1 includes: mixing a silicon source and a template to obtain a mixed solution, adjusting the mixed solution to be alkaline, performing a sol-gel reaction, and eluting to obtain mesoporous silica particles.

5. The preparation method according to claim 4, characterized in that: The silicon source is selected from tetraethoxysilane (TEOS); and / or, the template is selected from cetyltrimethylammonium bromide (CTAB); And / or, the sol-gel reaction is carried out by stirring at a temperature of 40° C. and a rotation speed of 300 rpm for 12 hours.

6. The preparation method according to claim 3, characterized in that: The step S2 includes: adding mesoporous silica particles into 3-aminopropyltriethoxysilane, stirring and reacting for 24 hours to obtain mesoporous silica particles with primary amine groups on the surface.

7. The preparation method according to claim 3, characterized in that: The S3 comprises: adding mesoporous silica particles with primary amine groups on the surface and AtpD antibody molecules to a cross-linking agent, glutaraldehyde, stirring the reaction for 3 hours at a temperature of 4°C and a rotation speed of 100-200 rpm for covalent coupling, and then using bovine serum albumin (BSA) to block the unreacted primary amine groups to obtain a drug delivery system; And / or, the method for preparing the AtpD antibody comprises: using the AtpD protein as an antigen, immunizing an animal, and finally purifying to obtain the AtpD antibody.

8. The preparation method according to claim 7, characterized in that: The cross-linking agent is selected from glutaraldehyde.

9. An application of a drug delivery system prepared by the preparation method according to any one of claims 3 to 7, characterized in that: The drug-loaded system is used as a drug delivery system targeting intratumoral microorganisms in esophageal squamous cell carcinoma.

10. The use according to claim 9, characterized in that: The drug loading system is used as a drug delivery system targeting the surface membrane protein of intratumoral hemolytic Gemini bacteria (G. h) in esophageal squamous cell carcinoma.

Images