Specific TCR CDR3 region sequence and application thereof

Abstract

The invention relates to the technical field of T cell immunotherapy drugs, in particular to a specific TCR CDR3 region sequence and application thereof. According to the invention, killer T cells are obtained by adopting an in-vitro antigen presentation method, antigen-specific killer T cells are sorted by a tetramer technology, and main TCR clones are obtained by TCR sequencing. A high variable loop region CDR3 of a main TCR chain is subjected to alanine substitution, a sequence with higher affinity is screened, and the sequence is suitable for all target antigens. The transformation of the natural sequence is beneficial to further understanding how the TCR affinity affects antigen recognition and TCR cross reaction and distinguishing TCR biochemical recognition and T cell function recognition, so that the TCR-based immunotherapy is more reasonably designed, and the TCR treatment safety is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of T cell immunotherapy drugs, and particularly relates to a specific TCR CDR3 region sequence and its application. Background Art

[0002] At present, tumor immunotherapy has developed rapidly and has become the fourth major treatment pillar after surgery, radiotherapy, and chemotherapy. T cell receptor engineered T cell (TCR-T) therapy is one of the most effective ways of current tumor immunocyte therapy. In recent years, the research on TCR-T for the treatment of various solid tumors has increased significantly. In August 2024, the TCR-T therapy Afami-cel for synovial sarcoma developed by Adaptimmune Therapeutics was rapidly approved by the US Food and Drug Administration, which is the world's first approved TCR-T cell therapy. T cell (antigen) receptor (TCR) is a heterodimeric protein located on the surface of T cells and is a molecule that specifically recognizes antigens and mediates immune responses on the surface of T cells. Due to the complex V(D)J rearrangement mechanism of TCR during cell development, the TCR gene sequence has extremely rich diversity. Therefore, TCR has very high diversity and is one of the regions with the highest polymorphism in the human genome, determining how the human immune system adapts to environmental changes.

[0003] TCR is composed of two polypeptide chains (α / β or γ / δ), and 95% of T cells express TCRαβ. The mature heavy chain TCR gene is composed of four gene fragments: variable region (V), diversity region (D), joining region (J), and constant region (C) (VDJC), while the light chain TCR lacks the D region (VJC). Both the heavy chain and light chain TCRs have three complementarity-determining regions (CDRs), CDR1 (complementarity-determining regions, CDR, complementarity-determining cluster 1), CDR2, and CDR3, which play a major role in antigen recognition. Among them, CDR3 is the TCR region that directly contacts the antigen. CDR3 is encoded by a part of V, all of D and J, and the joining regions between V-D and D-J. Therefore, the degree of variation of CDR3 is the highest. Due to the diversity of the V (65 - 100 types), D (2 types), and J (13 types) gene fragments themselves, in addition, during the rearrangement process, non-template nucleotides are often randomly inserted or deleted in the VD and D-J joining regions, further increasing the diversity of the CDR3 region. Theoretically, 2×10 19A TCRαβ. The CDR3 region largely determines the diversity of TCRs. The KRAS gene is one of the most frequently mutated oncogenes in tumors, and approximately 30% of human malignancies are associated with this mutation. In pancreatic cancer tumors, more than 90% of patients have KRAS mutations. However, the protein at the KRAS gene structure is small in size and has a smooth surface, lacking the 'deep pocket' structure that traditional small molecule drugs can bind to. It was once recognized by the pharmaceutical industry as an 'undruggable' target, and effective treatment methods targeting KRAS mutations need to be developed.

[0004] The interaction between TCR and the appropriate pMHC complex is a key part of an effective anti-tumor immune response. The binding between TCR and MHC or the specific recognition ability of TCR-T to the target antigen is usually characterized by TCR affinity, which plays a central role in TCR sensitivity and specificity. High-affinity TCRs recognize lower levels of antigen, do not require the CD8 co-receptor, and can enable CD4 + T cells to recognize and lyse tumor cells in an MHC class I-dependent manner. For example, using DMF5 TCR with a higher affinity than the DMF4 receptor, better response rates were observed in transduced T cells in experiments. It is suggested that high-affinity TCRs that can recognize pMHC with low expression on the surface of tumor cells are a better choice for most clinical trials. Since the affinity of natural TCR sequences for antigens is likely to be low, once the TCR sequence is determined, it needs to be optimized to improve TCR expression and affinity.

[0005] Currently, there is little research on the optimization of the Kras G12D CDR3 region. Modifying the TCR CDR3 region sequence provides new ideas for further research on antigen-specific recognition and binding and for the treatment of Kras mutations. Summary of the Invention

[0006] To make up for the deficiencies of the prior art, the present invention provides a specific TCR CDR3 region sequence and its application.

[0007] The present invention is achieved through the following technical solutions: In a first aspect, the present invention provides a specific TCR CDR3 region sequence. The TCR sequence contains two sequences, TRA and TRB, respectively. Among them, TRA is as shown in SEQ ID NO.1, and TRB is as shown in SEQ ID NO.2. The CDR3 region protein sequence includes TRAJ23_1 and TRBJ1-2_4. The amino acid sequence of TRAJ23_1 is AVAIYNQGGKLIF, and the amino acid sequence of TRBJ1-2_4 is CASADSGADGTYF.

[0008] In a second aspect, the present invention provides the use of the Kras G12D antigen-specific TCR CDR3 region sequence in the preparation of TCR-T cells in anti-cancer drugs.

[0009] Compared with the prior art, the advantages of the present invention are as follows: (1) Compared with the natural specific TCR structure, the present invention sequence optimizes the CDR3 of the highly variable loop region of the TCR chain, improving the affinity between TCR and pMHC; (2) The modification of the natural sequence helps to further understand how TCR affinity affects antigen recognition and TCR cross-reactivity, distinguish TCR biochemical recognition and T cell functional recognition, so as to more rationally design TCR-based immunotherapy and improve the safety of TCR treatment; (3) The interaction between TCR and the appropriate pMHC complex is a key part of an effective anti-tumor immune response. Affinity plays a central role in TCR sensitivity and specificity. The optimized sequence can enhance the anti-cancer efficacy and is more suitable for subsequent clinical trials. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] The present invention will be further described below with reference to the accompanying drawings.

[0011] Figure 1 It is a diagram for sorting antigen-specific T cells of the present invention; wherein Figure 1 A and B in it are diagrams for sorting antigen-specific T cells using the tetramer technology by flow cytometry respectively; Figure 2 It is the main TCR cloning map of KRAS G12D; Figure 3 They are TRBV6-4, TRAV1-2 and their respective corresponding sequences; Figure 4 It is a list of mutation nomenclatures; Figure 5 It is for ELISA to detect the binding concentration of each mutant TCR complex tetramer to KRAS G12D HLA-A*11:01, wherein Figure 4 A and B in it are the column chart and table analysis respectively; Figure 6 It is the expression efficiency of the control group TCR on T cells; wherein Figure 6 A in it is the circled lymphocyte population, Figure 6 B in it is the circled CDR3 T cell population, Figure 6 C in it is to stain with the tetramer (pe fluorescence) and circle the specific TCR-T to verify the expression of TCR on T cells, Figure 6 D in it is the corresponding peak chart; Figure 7 It is the expression efficiency of the experimental group TCR on T cells; whereinFigure 7 In A, the circled lymphocyte population is shown, Figure 7 in B, the circled CDR3 T cell population is shown, Figure 7 in C, through staining with tetramer (pe fluorescence), the specific TCR-T is circled to verify the expression of TCR on T cells, Figure 7 in D, the corresponding peak graph is shown; Figure 8 For the control group's killer factor test, among which Figure 8 in A, the circled lymphocyte population is shown, Figure 8 in B, the circled CDR3 T cell population is shown, Figure 8 in C, D, and E, the expressions of granzyme B (Gra B), interferon-γ (IFN-γ), and tumor necrosis factor α (TNF-α) are detected respectively; Figure 9 For the experimental group's killer factor test, among which Figure 9 in A, the circled lymphocyte population is shown, Figure 9 in B, the circled CDR3 T cell population is shown, Figure 9 in C, D, and E, the expressions of granzyme B (Gra B), interferon-γ (IFN-γ), and tumor necrosis factor α (TNF-α) are detected respectively. Specific implementation manners

[0012] The present invention will be further described below in conjunction with the accompanying drawings.

[0013] Example 1 (1) In this example, the method of in vitro antigen presentation is used to obtain cytotoxic T cells, and the tetramer technology is used to sort out antigen-specific cytotoxic T cells targeting the Kras G12D mutation (see Figure 1 ).

[0014] pMHC tetramer technology: A complex composed of 4 MHC-antigen peptide monomer molecules and a fluorescent dye. It is based on streptavidin with a signal label, crosslinking four MHC molecule monomers to form an MHC tetramer. One MHC tetramer molecule can recognize and bind to 3-4 TCRs on the surface of the same T cell.

[0015] As Figure 1 shown in A and B, the antigen-specific T cells are sorted by flow cytometry using the tetramer technology.

[0016] (2) TCR sequencing, comparing the clone numbers of each TCR VDJ combination and the sequences of the CDR3 region, to obtain the main TCR clones of KRASG12D (see Figures 2 - 3TRBV6-4 and TRAV1-2 and their respective corresponding CDR3 sequences constitute the main TCR clone of KRASG12D.

[0017] Figure 2 For TCR sequencing, the purpose was to analyze the main TCR clones, and the results are as follows: TRBV6-4 and TRAV1-2 are the main clones of the KRAS G12D HLA-A1101 antigen-specific TCR, and the sequences are: The sequence of the KRAS G12D HLA-A1101 antigen-specific TCR is: >TRA(v-j) CCCACATGAAGTGTCTACCTTCTGCAGACTCCAATGGCTCAGGAACTGGGAATGCAGTGCCAGGCTCGTGGTATCCCAGCAGATGTGGGGAGTTTTCCTTCTTTATGTTTCCATGAAGATGGGAGGCACTACAGGACAAAACATTGACCAGCCCACTGAGATGACAGCTACGGAAGGTGCCATTGTCCAGATCAACTGCACGTACCAGACATCTGGGTTCAACGGGCTGTTCTGGTACCAGCAACATGCTGGCGAAGCACCTACATTTCTGTCTTACAATGTTCTGGATGGTTTGGAGGAGAAAGGGTTTTTCTTCATTCCTTAGTCGGTCTAAAGGGTACAGTTACCTCCTTTTGAAGGAGCTCCAGATGAAAGACTCTGCCTCTTACCTCTGTGCTGTGATCTATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAACGGAGTTATCTGTGAAACCCAATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTTGTGCTGTGATCTATAACCAGGGAGAAGCTTATCTTC; >TRB(v-j) GGGGACAGCCCTGTTCGCCTTTCATCAACACAGACCCAGAAGACCTCTCTGTCTTGTAGCATCTGCCATGAGAATCAGGCTCCTGTGCTGTGTGGCCTTTTCTCTCCTGTGGGCAGGTCCAGTGATTGCTGGGATCACCCAGCACCAACATCTCAGATCCTGGCAGCAGGACGGCGCATGACACTGAGATGTACCCAGGATATGAGACATAATGCCATGTACTGGTATAGACAAGATCTAGGACTGGGGCTAAGGCTCCCATTATTCAAATACTGCAGGTACCACTGGCAAAGGAGAAGTCCCTGATGGTTATAGTGTCTCCAGAGCAAACACAGATGATTTCCCCCTCACGTTGGCGTCTGCTGTACCCTCTCAGACATCTGTGTACTTCTGTGCCAGCAGTGACTCCGGGGCTGATGGCTACACCTTCGGTTCGGGGACCAGGTTAACCGTTGTAGAGGACCTGAACAAGGTGTTCCCACCCGAGCGCTGTGTTTGAGCCATCAGATGTGCCAGCAGTGACTCCGGGGCTGATGGCTACACCTTC; CDR3 region protein sequence: TRA CDR3: Cys Val Ala Ile Tyr Asn Gln Gly Gly Lys Leu Ile Phe (CVAIYNQGGKLIF); TRB CDR3: Cys Ala Ser Ser Asp Ser Gly Ala Asp Gly Thr Tyr Phe (CASSDSGADGTYF).

[0018] (3) T cells engineered with high-affinity TCR have better anti-tumor effects. Alanine substitution was performed on the CDR3 region of the TCR chain hypervariable loop to screen for sequences with higher affinity.

[0019] Such as Figure 2As shown, the wild-type TRA CDR3 region sequence is CVAIYNQGGKLIF, and the wild-type TRB CDR3 region sequence is CASSDSGADGTYF. According to the above sequences, a WT-type TCR protein without mutations in the CDR3 region was synthesized and named wTCR. Site-directed mutations were performed on the TRA and TRB CDR3 regions respectively, with a total of 23 mutation sites. Each time a single site was mutated while other sites remained unchanged, a recombinant protein (pET28(+) as the expression plasmid) was constructed, and a total of 23 recombinant proteins were constructed. The results are shown in Figure 3 .

[0020] The binding concentration of each mutant TCR complex tetramer to KRAS G12D HLA-A*11:01 was detected by ELISA. The results are shown in Figure 5 . The p-value for evaluating the difference between duplicate wells was obtained using the t-test compared with the positive control, and the average fold difference in concentration (with the positive control as the denominator). The following table was obtained. The p-value of the binding concentration of the TCR marked in yellow to KRAS G12D HLA-A*11:01 compared with the positive control is <0.05, indicating that the TCR marked in yellow does not bind to KRAS G12D HLA-A*11:01. (Positive control settings: OVA-H2KB as the positive peptide-MHC control, and OT1 TCR as the positive TCR complex control with three duplicate wells).

[0021] Compared with the wild-type TCR (wTCR), after the amino acid at TRAJ23_1 was mutated to alanine, the affinity for KRAS G12D HLA-A*11:01 was higher. The concentration difference between the mutant TCR-KRAS G12D HLA-A*11:01 complex detected by ELISA and the positive control was 0.84, higher than that of wTCR, and p > 0.05. After the amino acids at two positions, TRBJ1-2_4 and TRBJ1-2_5, in TRB were mutated to alanine, the affinity for KRAS G12D HLA-A*11:01 was closer to the positive control group, and the increase in affinity at TRBJ1-2_4 was more significant. The concentration differences between the TCR-KRAS G12D HLA-A*11:01 complexes after these two mutations detected by ELISA and the positive control were 0.94 and 0.91, the fold differences were close to 1, and p > 0.05. The amino acid sequence of TRAJ23_1 is AVAIYNQGGKLIF, and the amino acid sequence of TRBJ1-2_4 is CASADSGADGTYF.

[0022] In summary, in this example, TRAJ23_1 and TRBJ1-2_4 were selected as TRA and TRB, respectively, to improve the affinity of the natural TCR chain.

[0023] Example 2 As Figures 6 - 7 shown, in this embodiment, T cells were transfected with TCR plasmids by electroporation, and flow cytometry staining analysis (PE fluorescence) was performed using the tetramer technology mentioned above. Compared with the control group, the TCR expression efficiency in the experimental group was very high, and TCR-T cells were successfully constructed.

[0024] In the present invention, TCR-T cells were co-cultured with target cells Panc-1 (human pancreatic cancer cells), and the secretion of killing factors was detected. As Figures 8 - 9 shown, compared with the control group, the expressions of granzyme B (Gra B), interferon-γ (IFN-γ), and tumor necrosis factor α (TNF-α) were all significantly up-regulated, indicating a significant enhancement in the killing ability of TCR-T cells.

Claims

1. A specific TCR CDR3 region sequence, characterized in that: The TCR sequence contains two sequences, TRA and TRB, wherein TRA is shown in SEQ ID NO.1, TRB is shown in SEQ ID NO.2, and the CDR3 region protein sequence includes TRAJ23_1 and TRBJ1-2_4, the amino acid sequence of TRAJ23_1 is AVAIYNQGGKLIF, and the amino acid sequence of TRBJ1-2_4 is CASADSGADGTYF.

2. Use of the TCR CDR3 region sequence as claimed in claim 1 in the preparation of TCR-T cells for anticancer drugs.

Images