Paphiopedilum purpuratum mycorrhizal fungus CNOCC PP26 and application thereof in promoting plant root growth

By providing the fungic agent prepared by CNOCC PP26 of the Pyramidal Papyrus mycorrhizal fungus, co-cultivated with Pyramidal Papyramidal seedlings, the problem of slow seedling growth during the seedling cultivation process is solved, and the effect of shortening the seedling cultivation time is achieved.

CN120059972AActive Publication Date: 2025-05-30SHENZHEN ORCHID PLANT PROTECTION RES CENT
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202510533850.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-27
Publication Date
2025-05-30
Estimated Expiration
2045-04-27

AI Technical Summary

Technical Problem

The prior art lacks the fungi of the genus Mycorrhizal that can promote the formation of the root system of artificial seedlings of Purple Paphiolenum, resulting in a longer seedling cultivation time.

Method used

A purple-shaped Paphiodopsis mycorrhizal fungus CNOCC PP26 was provided. By inoculating it on the culture medium, a bacterial promoter was prepared for co-culture with purple-shaped Paphiodopsis seedlings to promote its root growth.

Benefits of technology

It effectively promotes the formation and growth of new roots of Purple Papyrus seedlings, shortens the seedling cultivation time, and solves the problem of slow seedling growth.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120059972A_ABST
    Figure CN120059972A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms, in particular to paphiopedilum purpuratum mycorrhizal fungi CNOCC PP26 and application of the paphiopedilum purpuratum mycorrhizal fungi CNOCC PP26 in promoting plant root growth. The invention provides a paphiopedilum purpuratum mycorrhizal fungus CNOCC PP26, and the preservation number is GDMCC (China General Microbiological Culture Collection Center) NO: 65861. The paphiopedilum purpuratum mycorrhizal fungus CNOCC PP26 is a nodule mycorrhizal fungus separated from mycorrhiza of a paphiopedilum purpuratum adult plant, when the strain and a paphiopedilum purpuratum sterile seedling are co-cultured, formation and growth of new roots of the paphiopedilum purpuratum seedling can be effectively promoted, the problem that the seedling grows slowly in the seedling raising process of the paphiopedilum purpuratum is effectively solved, and the paphiopedilum purpuratum mycorrhizal fungus CNOCC PP26 has a good application prospect. The seedling raising time of paphiopedilum purpuratum is shortened, and technical support is provided for artificial breeding and regression of paphiopedilum purpuratum.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, in particular to the mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum and its application in promoting the growth of plant roots. Background Art

[0002] There is an important relationship between the growth and development of Orchidaceae plants and the interaction with mycorrhizal fungi. There have been certain studies on the existence of mycorrhizal fungi in Orchidaceae plants in overcoming the difficulty of seed germination due to lack of endosperm, promoting the absorption of mineral elements by plants, the secretion of growth regulator substances by fungi to promote plant growth and enhance plant stress resistance. The genus Epulorhiza is an important class of mycorrhizal fungi in Orchidaceae plants and plays an important role in physiological processes such as the germination of seeds of various Orchidaceae plants.

[0003] Paphiopedilum purpuratum is the Paphiopedilum species with the lowest distribution altitude among Paphiopedilum plants in China. At present, the number of wild Paphiopedilum purpuratum is small, so the efficient cultivation and return of Paphiopedilum purpuratum are more important. However, there is currently a lack of Epulorhiza fungi that can promote the formation of roots of artificial seedlings of Paphiopedilum purpuratum. Summary of the Invention

[0004] In order to solve the above problems, the present invention provides the mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum and its application in promoting the growth of plant roots. The mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum provided by the present invention can promote the formation of roots of artificial seedlings of Paphiopedilum purpuratum and shorten the seedling raising time of Paphiopedilum purpuratum.

[0005] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a mycorrhizal fungus of Paphiopedilum purpuratum ( Epulorhiza sp.) CNOCC PP26, with the preservation number of GDMCC NO: 65861.

[0006] The present invention provides a growth-promoting bacterium agent, including the mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum described in the above technical solution.

[0007] The present invention provides a preparation method of the growth-promoting bacterium agent described in the above technical solution, including: Inoculating the mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum described in the above technical solution onto a culture medium and culturing it in the dark to obtain the growth-promoting bacterium agent.

[0008] Preferably, the culture medium includes PDA medium; the temperature for culturing in the dark is 25 - 28 °C.

[0009] The present invention provides the application of the mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum described in the above technical solution, or the growth-promoting agent described in the above technical solution, or the growth-promoting agent prepared by the preparation method described in the above technical solution in promoting the growth of plant roots.

[0010] Preferably, the promotion of plant root growth includes: promoting the formation and / or growth of new plant roots.

[0011] Preferably, the plant is a plant of the genus Paphiopedilum.

[0012] Preferably, the plant of the genus Paphiopedilum is Paphiopedilum purpuratum.

[0013] The present invention provides a method for promoting the growth of plant roots, including: co-culturing plant seedlings and a growth-promoting agent; the growth-promoting agent is the growth-promoting agent described in the above technical solution or the growth-promoting agent prepared by using the preparation method described in the above technical solution.

[0014] Preferably, the plant seedlings include seedlings of plants of the genus Paphiopedilum; the culture medium used for the co-culture includes a 1 / 2MS solid medium containing 4 g / L of oatmeal; the conditions for the co-culture include: the temperature is 23-27 °C, the light intensity is 1200 Lux, and the light-dark ratio is 16 h:8 h.

[0015] Beneficial effects: The present invention provides a mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum, with the preservation number of GDMCC NO: 65861. The mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum in the present invention is a fungus of the genus Rhizoctonia isolated from the mycorrhizae of adult plants of Paphiopedilum purpuratum. When this strain is co-cultured with axenic seedlings of Paphiopedilum purpuratum, it can effectively promote the formation and growth of new roots of Paphiopedilum purpuratum seedlings, effectively solve the problem of slow growth of seedlings during the seedling raising process of Paphiopedilum purpuratum, shorten the seedling raising time of Paphiopedilum purpuratum, and provide technical support for the artificial breeding and return of Paphiopedilum purpuratum. Description of the drawings

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments.

[0017] Figure 1 It is a comparative physical map of the root formation of Paphiopedilum purpuratum seedlings; Figure 2 It is a colony map of the mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum on a PDA medium.

[0018] Biological preservation description The mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum, classified and named as Epulorhizasp., deposited at the Guangdong Microbial Strain Preservation Center (GDMCC) on February 7, 2025. The preservation address is on the 5th floor of the Experimental Building, No. 100 Compound, Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, and the preservation number is GDMCC N: 65861. Detailed implementation manners

[0019] The present invention provides a mycorrhizal fungus of Paphiopedilum purpuratum CNOCC PP26 with a preservation number of GDMCC NO: 65861.

[0020] The mycorrhizal fungus of Paphiopedilum purpuratum CNOCC PP26 described in the present invention is a fungus of the genus Rhizoctonia isolated from the mycorrhizae of adult plants of Paphiopedilum purpuratum. The colony is milky yellow, with slightly wrinkled central mycelial cakes and irregularly serrated edges; the hyphae are thin and weak during the growth period, showing a cloud-like shape; the hyphae are knotted into cords or granular protrusions during the mature period. When this strain is co-cultured with axenic seedlings of Paphiopedilum purpuratum, it can effectively promote the formation and growth of new roots of Paphiopedilum purpuratum seedlings, effectively solve the problem of slow seedling growth during the seedling raising process of Paphiopedilum purpuratum, and shorten the seedling raising time of Paphiopedilum purpuratum.

[0021] Based on the above advantages, the present invention provides a growth-promoting bactericide, which includes the mycorrhizal fungus of Paphiopedilum purpuratum CNOCC PP26 described in the above technical solution.

[0022] The present invention provides a preparation method of the growth-promoting bactericide described in the above technical solution, including: Inoculating the mycorrhizal fungus of Paphiopedilum purpuratum CNOCC PP26 described in the above technical solution onto a culture medium and culturing it in the dark to obtain the growth-promoting bactericide.

[0023] As an implementation manner, the culture medium is a PDA culture medium. As an implementation manner, the temperature for culturing in the dark is 25 - 28 °C; as another implementation manner, the temperature for culturing in the dark is 25 - 27 °C; as another implementation manner, the temperature for culturing in the dark is 25 - 26 °C. As an implementation manner, the time for culturing in the dark is 3 weeks. As an implementation manner, the growth-promoting bactericide can be a fungal cake containing hyphae obtained by culturing.

[0024] Based on the above advantages, the present invention provides the application of the mycorrhizal fungus of Paphiopedilum purpuratum CNOCC PP26 described in the above technical solution, or the growth-promoting bactericide described in the above technical solution, or the growth-promoting bactericide prepared by using the preparation method described in the above technical solution in promoting plant root growth.

[0025] As an implementation manner, the promotion of plant root growth includes: promoting the formation and / or growth of new roots of plants. As an implementation manner, the plant is a plant of the genus Paphiopedilum; as another implementation manner, the plant of the genus Paphiopedilum is Paphiopedilum purpuratum. The Paphiopedilum mycorrhizal fungus CNOCC PP26 provided by the present invention can promote the formation and growth of new roots of Paphiopedilum purpuratum seedlings.

[0026] Based on the above advantages, the present invention provides a method for promoting plant root growth, including: co-culturing Paphiopedilum purpuratum seedlings and a growth-promoting bacterium agent; the growth-promoting bacterium agent is the growth-promoting bacterium agent described in the above technical solution or the growth-promoting bacterium agent prepared by using the preparation method described in the above technical solution.

[0027] As an implementation manner, the plant seedlings are seedlings of the genus Paphiopedilum. As an implementation manner, the seedlings of the genus Paphiopedilum are Paphiopedilum purpuratum seedlings. As an implementation manner, the Paphiopedilum purpuratum seedlings are sterile Paphiopedilum purpuratum seedlings. As an implementation manner, the sterile Paphiopedilum purpuratum seedlings are sterile Paphiopedilum purpuratum seedlings obtained by artificial aseptic sowing and germination culture of mature seeds of Paphiopedilum purpuratum. As an implementation manner, the sterile Paphiopedilum purpuratum seedlings are sterile Paphiopedilum purpuratum seedlings with 3 to 4 leaves. As an implementation manner, the culture medium used for the co-culture is a 1 / 2MS solid medium containing 4 g / L oatmeal. As an implementation manner, the temperature of the co-culture is 25 ± 2 °C, the light intensity is 1200 Lux, and the light-dark ratio time is 16 h:8 h. As an implementation manner, the time of the co-culture is 2 to 3 months. The method provided by the present invention can promote the formation and growth of new roots of Paphiopedilum purpuratum seedlings and shorten the artificial seedling raising time.

[0028] To further illustrate the present invention, the following describes in detail the Paphiopedilum mycorrhizal fungus CNOCC PP26 provided by the present invention and its application in promoting plant root growth with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0029] Example 1 The isolation and identification process of strain CNOCC PP26 is as follows: Pick the roots of Paphiopedilum purpuratum with complete appearance, no rot, and plumpness, wash the surface of the roots with water, disinfect them with 1% sodium hypochlorite aqueous solution for 15 min, gently scrape the root epidermis with a scalpel, observe and cut the part with a color different from most areas on the root segment, cut it into 1-mm-thick slices and inoculate them on a PDA medium added with streptomycin (this medium is purchased from Guangdong Huankai Microbial Science and Technology Co., Ltd.), inoculate 1 to 3 slices in each petri dish, culture them in an incubator at 28 °C for 3 days, pick the grown mycelia, transfer them to a new medium for purification until a pure strain is obtained.

[0030] Cut a pure strain bacterial block and inoculate it in the center of a PDA medium culture dish. Place it in an incubator at 28°C for cultivation and observe the preliminary morphology of the colony. After preliminary morphological identification of this mycorrhizal fungus, the colony is milky yellow, with slightly wrinkled central bacterial cakes and irregular serrated edges; the hyphae are thin and weak during the growth period, showing a cloud-like shape; the hyphae are knotted into cords or granular protrusions during the mature period ( Figure 2 ).

[0031] Molecular identification of fungi: The ITS ( Internal Transcribed Space ) gene of fungi, including ITS1 and ITS2 two parts, has a fast evolutionary rate and polymorphism, and is suitable for differentiating and identifying strains with relatively close genetic relationships. Design primers using the conserved sequence of rDNA, PCR amplify the ITS region of the unknown fungus, and compare the homology with the known sequences in GenBank after sequencing to obtain the genus and species information for identifying the fungus. The nucleotide sequence of the ITS region of the unknown fungus is shown in SEQ ID NO:1 as follows: 5'-CCTGCGGAAGGATCATTAAAGAATGTTCAATGGGATGTGCTGGCGGTTTAAACGCCGCATGTGCACTCCCTTAACCAATCTTACACACCTGTGAACCTCGGACCTCGTCCGCCTCTGTTCGGAGGTGGACTTGTGTTCTTACCATACAAAACCCAGTCGAGTTAGCTCTGGAATACATGTTGTAATTAAAAACAACCATCAGCAACGGATCTCTTGGCATCCCAATCGATGAAGAACGTAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTCTGGTATTCCGGAGGGCATGCCCGGTTGAGTGTCATGAATATCTCAAACCCGATGCTTTGTTTGAAGTGCCGGGGCTTGGACTTGAGCCTTGTCGGCGATCCGTCGACTTGCTTGAAATTGATCAGTGATGTACGATCCCTTGTCGGGTCCGTCTCAGCGTGATAAGTTGATCGCTGCATAGGACTCGCGCATCGGTGAAGGCACGCTCCTAACCGTCTTAGGACAGCTCTTGACGTTTACACCTCAACTCGGGTAGGACTACCCGCTGAACTTAAGCATATCAATAC-3'.

[0032] In summary, strain CNOCC PP26 was identified as a fungus of the genus Rhizoctonia through morphological and ITS sequencing, and was named Rhizoctonia paphiopedilii ( Epulorhiza sp.) CNOCC PP26. It was deposited in the Guangdong Provincial Microbial Strain Collection Center (GDMCC) with the deposit number GDMCC NO: 65861.

[0033] Example 2 1) Inoculate Rhizoctonia paphiopedilii CNOCC PP26 with the deposit number GDMCC NO: 65861 in Example 1 onto a PDA medium. The medium is 25 mL placed in a 9 mm petri dish and cultured in the dark at 28 °C in a fungal incubator for 3 weeks until the mycelium covers the petri dish, and set aside for use.

[0034] 2) Prepare a 1 / 2MS solid medium supplemented with 4 g / L of oatmeal in a tissue culture flask to meet the growth requirements of the fungus and seedlings.

[0035] 3) Select aseptic paphiopedilum seedlings with 3 - 4 healthy leaves, transplant them into a tissue culture flask in a laminar flow hood, 1 seedling per flask, and then place them in a plant culture room at a temperature of 25 ± 2 °C, a light intensity of 1200 Lux, and a light - dark ratio of 16 h:8 h for 3 weeks until the paphiopedilum seedlings fully recover growth.

[0036] 4) Cut the fungal colonies cultured in step 1) into 5 mm × 5 mm pieces and inoculate them into the culture flasks cultured in step 3) for 3 weeks, and co - culture them with the aseptic paphiopedilum seedlings. After 2 months of co - culture, the occurrence and rapid growth of new roots of the paphiopedilum seedlings can be clearly seen ( Figure 1 ); the conditions for the co - culture are: temperature 25 ± 2 °C, light intensity 1200 Lux, light - dark ratio 16 h:8 h.

[0037] Comparative Example 1 1) Prepare a 1 / 2MS solid medium supplemented with 4 g / L of oatmeal in a tissue culture flask.

[0038] 2) Select aseptic paphiopedilum seedlings with 3 - 4 healthy leaves, transplant them into a tissue culture flask in a laminar flow hood, 1 seedling per flask, and then place them in a plant culture room at a temperature of 25 ± 2 °C, a light intensity of 1200 Lux, and a light - dark ratio of 16 h:8 h for 3 weeks until the paphiopedilum seedlings fully recover growth.

[0039] 3) Cut the aseptic PDA solid medium into 5 mm × 5 mm pieces, inoculate them into the culture flask, and co - culture them with the aseptic paphiopedilum seedlings. After 2 months of co - culture, the occurrence and growth of new roots of the paphiopedilum seedlings are slow ( Figure 1); The conditions for the co-culture are as follows: temperature 25 ± 2 °C, light intensity 1200 Lux, and light-dark ratio 16 h:8 h.

[0040] Test Example 1 Determine the number of newly formed roots and the newly increased root length of the Paphiopedilum purpuratum seedlings co-cultured in Example 2 and Comparative Example 1 for 3 months. Each group was subjected to 3 parallel repeated experiments, with 7 seedlings in each group. The results are shown in Table 1.

[0041] Table 1 Results of the determination of newly formed roots of Paphiopedilum purpuratum seedlings

[0042] It can be seen from the results that the mycorrhizal fungus CNOCC PP26 of Paphiopedilum purpuratum provided by the present invention can effectively promote the formation and growth of new roots of Paphiopedilum purpuratum seedlings, effectively solve the problem of slow seedling growth during the seedling raising process of Paphiopedilum purpuratum, and shorten the seedling raising time of Paphiopedilum purpuratum.

[0043] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Paphiopedilum purpurogenum mycorrhizal fungi ( Epulorhiza sp.) CNOCC PP26, characterized in that The deposit number is GDMCC NO:65861.

2. A growth-promoting agent, characterized in that: Including the purple-veined Paphiopedilum mycorrhizal fungus CNOCC PP26 described in claim 1.

3. The method for preparing the growth-promoting bacterium agent according to claim 2, characterized in that: include: The purple-veined Paphiopedilum mycorrhizal fungus CNOCC PP26 described in claim 1 is inoculated onto a culture medium and cultured in the dark to obtain the growth-promoting bacterial agent.

4. The preparation method according to claim 3, characterized in that: The culture medium includes PDA culture medium; the temperature of the light-proof culture is 25-28°C.

5. Use of the purple-veined Paphiopedilum mycorrhizal fungus CNOCC PP26 according to claim 1, the growth-promoting agent according to claim 2, or the growth-promoting agent prepared by the preparation method according to claim 3 or 4 in promoting the growth of plant roots.

6. The use according to claim 5, characterized in that: The promoting the growth of plant roots includes: promoting the formation and / or growth of new roots of plants.

7. The use according to claim 5 or 6, characterized in that: The plant is a Paphiopedilum plant.

8. The use according to claim 7, characterized in that: The Paphiopedilum plant is Paphiopedilum purpurogenum.

9. A method for promoting plant root growth, characterized in that: include: The plant seedlings and the growth-promoting bacteria are co-cultivated; the growth-promoting bacteria is the growth-promoting bacteria according to claim 2 or the growth-promoting bacteria prepared by the preparation method according to claim 3 or 4.

10. The method according to claim 9, characterized in that The plant seedlings include Paphiopedilum plant seedlings; the culture medium used for co-cultivation includes 1 / 2MS solid culture medium containing 4g / L oatmeal powder; the co-cultivation conditions include: temperature of 23-27°C, light intensity of 1200Lux, and light-dark ratio of 16h:8h.

Citation Information

Patent Citations

  • Method for culturing orchid special strain thereof

    CN101338290A

  • Fungus for promoting symbiotic germination of paphiopedilum hirsutissimum seed and application thereof

    CN103087927A

  • Epulorhiza sp. strain, application thereof and mycorrhiza fungi inoculation method

    CN103497900A

  • Tumomycorrhiza strain TP-13 with capability of promoting growth of new roots of dendrobium and application of tumomycorrhiza strain TP-13

    CN114717139A

  • Fungus for promoting germination of paphiopedilum leucopeniculatum seeds and application thereof

    CN118222409A