Salt-tolerant growth-promoting complex microbial inoculant and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a salt-tolerant growth-promoting complex microbial inoculant and application thereof. The active ingredients of the salt-tolerant growth-promoting complex microbial inoculant are actinomycetes S36 with the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.32928, trichoderma M2 with the preservation number of CGMCC No.41651 and bacillus velezensis Y10 with the preservation number of CGMCC No.32927. The complex microbial inoculant obtained by mixing three bacteria obtained by screening can improve the salt stress resistance of cotton and wheat, and provides a new microbial resource for improving the salt tolerance of cotton and wheat.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a salt-tolerant growth-promoting composite bacterial agent and its application. Background Art

[0002] Cotton ( Gossypium spp. ) is an important cash crop and an important source of feed and oil. At present, cotton fibers, seeds and straw are widely used in textile, food and feed processing, and papermaking. Due to factors such as cotton-grain competition and increasing labor costs, the main cotton-growing areas are gradually shifting to the northwest inland areas with a relatively high degree of soil salinization. However, soil secondary salinization seriously restricts the growth of cotton. Although cotton has a certain salt tolerance and is often used as a pioneer crop for the development of saline-alkali cultivated land, excessive salt ions will significantly inhibit the growth of cotton. After salt stress treatment, the biomass, superoxide dismutase, catalase and peroxidase activities of seeds decreased significantly, and the content of malondialdehyde increased. Salt stress will also cause a significant reduction in the fiber length and elongation rate of cotton, seriously affecting the yield and quality of cotton. Wheat is mainly winter wheat. The wheat planting area is extensive, from south to north, from plains to mountains, and almost all agricultural areas grow wheat. The planting area and total output of wheat are second only to rice. During the growth process of wheat, soil salinization has become one of the important ecological environment problems. An increase in soil salt content in the agricultural ecosystem will affect the growth and development of crops and lead to a reduction in production. In the prior art, chemical reagents or soil conditioners are usually used to improve saline-alkali land, thereby reducing the impact of soil salinization on the growth of cotton or wheat. However, long-term use of chemical reagents or soil conditioners will lead to soil compaction, damage the soil ecological system, affect the structure and function of the soil microbial community, and it cannot truly and effectively improve the salt tolerance of cotton or wheat. Summary of the Invention

[0003] To solve the above problems, the present invention provides a salt-tolerant growth-promoting composite bacterial agent and its application. The composite bacterial agent obtained by microbial compounding can effectively improve the salt tolerance of cotton and wheat, and at the same time will not damage the soil ecological system.

[0004] To achieve the above object, the technical solution of the present invention is as follows.

[0005] In the first aspect of the present invention, a salt-tolerant growth-promoting composite bacterial agent is provided, and its active ingredients are strains with a preservation number of CGMCC No. 32928 and a taxonomic name of Streptomyces rochei , named Actinomyces S36; strains with a preservation number of CGMCC No. 41651 and a taxonomic name of Trichoderma Trichoderma sp. , named Trichoderma M2; strains with a preservation number of CGMCC No. 32927 and a taxonomic name of Bacillus velezensis Bacillus velezensis , named Bacillus velezensis Y10.

[0006] The present invention has obtained Actinomyces S36, Trichoderma M2 and Bacillus velezensis Y10 through screening. Through experiments, it has been found that the salt-tolerant and growth-promoting compound microbial agent obtained from the above three kinds of bacteria as active ingredients can effectively improve the resistance of cotton and wheat to salt stress, providing a new microbial resource for improving the salt tolerance of cotton and wheat. At the same time, it can also avoid the damage to the soil ecosystem caused by chemical reagents or soil conditioners.

[0007] In a preferred embodiment, the salt-tolerant and growth-promoting compound microbial agent is obtained by mixing the Actinomyces S36 bacterial solution, Trichoderma M2 bacterial solution and Bacillus velezensis Y10 bacterial solution and then fermenting. The viable count of the Actinomyces S36 bacterial solution is 1×10 6 CFU / mL to 5×10 6 CFU / mL, the viable count of the Trichoderma M2 bacterial solution is 1×10 6 CFU / mL to 5×10 6 CFU / mL, and the viable count of the Bacillus velezensis Y10 bacterial solution is 2×10 8 CFU / mL to 5×10 8 CFU / mL.

[0008] In a preferred embodiment, the volume ratio of the Actinomyces S36 bacterial solution, Trichoderma M2 bacterial solution and Bacillus velezensis Y10 bacterial solution is 2 - 3:1 - 2:1 - 2.

[0009] The second aspect of the present invention provides the application of the described salt-tolerant and growth-promoting compound microbial agent in improving the salt tolerance of plants.

[0010] In a preferred embodiment, the improvement of the salt tolerance of plants refers to the improvement of the germination rate of plant seeds under salt stress.

[0011] In a preferred embodiment, the salt-tolerant and growth-promoting compound microbial agent is used as a seed soaking agent for plant seeds to improve the germination rate of plant seeds under salt stress.

[0012] In a preferred embodiment, the improvement of the salt tolerance of plants refers to the improvement of the fresh weight, dry weight and length of plant seedlings under salt stress.

[0013] In a preferred embodiment, the salt-tolerant and growth-promoting compound microbial agent is used as a root irrigation agent for plant seedlings to improve the fresh weight, dry weight and length of plant seedlings under salt stress.

[0014] In a preferred embodiment, the plant is cotton and wheat.

[0015] Compared with the prior art, the present invention has the following beneficial effects.

[0016] The three strains of actinomycetes S36, Trichoderma M2, and Bacillus velezensis Y10 screened in the present invention are used as active ingredients. The obtained salt-tolerant and growth-promoting compound microbial agent can not only effectively improve the salt tolerance of cotton and wheat, but also will not damage the soil ecosystem, providing a new solution to the growth problems of cotton and wheat caused by soil salinization.

[0017] Through experiments, it was found that the salt-tolerant and growth-promoting compound microbial agent can promote the growth of cotton and wheat seedlings. The results showed that the use of the compound microbial agent can significantly increase the fresh weight of cotton seedlings by 70.37%. Under salt stress, the use of the compound microbial agent significantly increased the fresh weight of cotton seedlings by 64.82%. The use of the compound microbial agent can significantly increase the dry weight of cotton seedlings by 21.86%. Under salt stress, the use of the compound microbial agent significantly increased the dry weight of cotton seedlings by 36.22%. The use of the compound microbial agent can significantly increase the length of cotton seedlings by 13.69%. Under salt stress, the use of the compound microbial agent significantly increased the length of cotton seedlings by 56.79%.

[0018] The salt-tolerant and growth-promoting compound microbial agent can increase the fresh weight of wheat seedlings by 10.78%. Under salt stress, the use of the compound microbial agent significantly increased the fresh weight of wheat seedlings by 45.47%. The use of the compound microbial agent can increase the dry weight of wheat seedlings by 23.05%. Under salt stress, the use of the compound microbial agent increased the dry weight of wheat seedlings by 25.54%. The use of the compound microbial agent can increase the length of wheat seedlings by 4.36%. Under salt stress, the use of the compound microbial agent significantly increased the length of wheat seedlings by 29.76%. Description of the Drawings

[0019] Figure 1 It is the morphological diagram of S36, M2, and Y10 on the PDA solid medium in the present invention. Among them, A is the morphological diagram of S36, B is the morphological diagram of M2, and C is the morphological diagram of Y10.

[0020] Figure 2 It is the result diagram of the germination of cotton seeds at different times under salt stress after soaking the seeds with the salt-tolerant and growth-promoting compound microbial agent diluted 100 times in the present invention. Among them, A is the result diagram of the germination of cotton seeds after 3 days, and B is the result diagram of the germination of cotton seeds after 6 days.

[0021] Figure 3 It is the diagram of the effect of different soaking times on the root length of cotton seed germination under salt stress after diluting the salt-tolerant and growth-promoting compound microbial agent 100 times in the present invention. Among them, A is the diagram of the effect on the root length of cotton seed germination after 3 days, and B is the diagram of the effect on the root length of cotton seed germination after 6 days.

[0022] Figure 4 It is the diagram of the effect of the salt-tolerant and growth-promoting compound microbial agent diluted 100 times on the length, fresh weight, and dry weight of cotton seedlings. Among them, A is the result diagram of the fresh weight of cotton seedlings, B is the result diagram of the dry weight of cotton seedlings, and C is the result diagram of the height of cotton seedlings; in the figure, H 2O 2 It represents the clean water treatment group, the microbial agent represents the treatment group with the fermented liquid of the strain diluted 100 times, NaCl represents the 150 mM saline treatment group, and NaCl + microbial agent represents the treatment group with 150 mM saline + the fermented liquid of the strain diluted 100 times.

[0023] Figure 5 This is a comparative legend diagram of the effect of the salt-tolerant and growth-promoting compound microbial agent diluted 100 times on cotton seedlings in the present invention.

[0024] Figure 6 This is a diagram of the effect of the salt-tolerant and growth-promoting compound microbial agent diluted 100 times on the length, fresh weight, and dry weight of wheat seedlings in the present invention; among them, A is the result diagram of the length of wheat seedlings, B is the result diagram of the fresh weight of wheat seedlings, and C is the result diagram of the dry weight of wheat seedlings.

[0025] Figure 7 This is a comparative diagram of the effect of the salt-tolerant and growth-promoting compound microbial agent diluted 100 times on wheat seedlings in the present invention. Detailed implementation manners

[0026] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0027] The salt-tolerant and growth-promoting compound microbial agent in the present invention includes the actinomycete S36 bacterial liquid, the Trichoderma M2 bacterial liquid, and the Bacillus velezensis Y10 bacterial liquid.

[0028] The actinomycete S36 is deposited in the China General Microbiological Culture Collection Center, the deposit date is December 05, 2024, the deposit number is CGMCC No. 32928, and the taxonomic name is Streptomyces rochei , hereinafter referred to as S36 for short.

[0029] The Trichoderma M2 is deposited in the China General Microbiological Culture Collection Center, the deposit date is December 05, 2024, the deposit number is CGMCC No. 41651, and the taxonomic name is Trichoderma Trichoderma sp. , hereinafter referred to as M2 for short.

[0030] The Bacillus velezensis Y10 is deposited in the China General Microbiological Culture Collection Center, the deposit date is December 05, 2024, the deposit number is CGMCC No. 32927, and the taxonomic name is Bacillus velezensis Bacillus velezensis , hereinafter referred to as Y10 for short.

[0031] Example 1: Screening and identification of strains.

[0032] 1. Strain screening: Isolate microbial strains from saline-alkali soil, screen strains with the abilities of dissolving phosphorus, fixing nitrogen, decomposing potassium, and producing IAA, and preserve them in glycerol tubes in an -80°C refrigerator. When in use, activate the bacteria with the abilities of dissolving phosphorus, fixing nitrogen, decomposing potassium, and producing IAA from the refrigerator. The specific steps are as follows.

[0033] Activate and propagate with PDA solid medium, and then inoculate the strains onto Mengjinna medium, Asbby medium, and silicate bacteria medium respectively. Observe the growth status of the strains in the petri dishes. The judgment method is that if a transparent circle is produced by the strains in the medium, it has this function.

[0034] The specific steps of the IAA color reaction are as follows: From the purified bacterial plates, pick single colonies with different morphological characteristics using a sterile inoculation loop and inoculate them into a triangular flask or test tube containing Czapek liquid medium. Place the inoculated medium in a constant temperature shaker and culture it for 7 days at 30°C and 200 rpm. Take out the cultured bacterial liquid, pipette 5 mL into a sterile centrifuge tube, centrifuge at 10000 rpm / min for 5 minutes, pipette 1 mL of the supernatant, and add 1 mL of Salkowski color reagent. After mixing evenly, place the test tube in the dark at room temperature for 30 minutes to allow IAA to fully react with the color reagent. The specific standard is that the mixed solution turns red. The effects of the strains are shown in Table 1. It can be seen from Table 1 that three strains all have the effect of producing IAA.

[0035] Table 1: Strain screening results

[0036] Note: “+” represents having an effect, “-” represents having no effect, the same below.

[0037] 2. Strain antagonism: Conduct mutual antagonism tests on the three screened strains. The results are shown in Table 2. It can be seen from Table 2 that the strains are not antagonistic to each other.

[0038] Table 2: Antagonistic effects between strains

[0039] 3. Strain identification: Pick strains S36, M2, and Y10 and inoculate them onto PDA medium. After culturing at 28°C for 10 days, collect the bacterial sludge. Use the 16s rDNA identification method to extract the genomic DNA of the strains. Use universal primers to amplify their gene sequences. The sequencing results are searched for similarity in NCBI using Blast software.

[0040] The DNA sequence alignment results of S36 obtained by sequencing were classified as Streptomyces ( Streptomyces rochei), with the deposit number of CGMCC No. 32928. The DNA sequence alignment results obtained by sequencing M2 were used to classify it as Trichoderma longibrachiatum ( Trichoderma longibrachiatum ), with the deposit number of CGMCC No. 41651. The DNA sequence alignment results obtained by sequencing strain Y10 were used to classify it as Bacillus velezensis ( Bacillus velezensis ), with the deposit number of CGMCC No. 32927.

[0041]

[0042] The 16s rDNA sequence of the M2 bacterium is as shown in SEQ ID NO.2: CCTCCGTAGGGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCCAAACTCTTTTTTCTCTCCGTCGCGGCTCCCGTCGCGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGKAATACCCGCTGAACTTAAGCATATCAATAAAGCGGAGGA。

[0043]

[0044] 4. Strain morphology: The three strains were separately activated and cultured in PDA petri dishes, and their morphologies in the petri dishes are as Figure 1 shown. S36 is as shown in A in Figure 1 , its colony texture is dense, the surface is relatively closely floccose or firm, dry, and wrinkled, the colony is small and does not spread; M2 is as shown in B in Figure 1 , its colony is initially white, and as conidia are produced, the colony gradually turns green, the aerial hyphae are less, and the conidia are usually arranged in concentric patterns; Y10 is as shown in C in Figure 1 , its colony is milky white, round, with a smooth and slightly convex surface.

[0045] Example 2. Cultivation and preparation of the compound microbial agent.

[0046] The three strains obtained in Example 1 were activated. Among them, S36 and Y10 were cultured using LB liquid medium as the seed liquid, with the conditions of 28 °C and 180 r / min for 2 days. The medium formula is 10 g of tryptone, 5 g of yeast extract, 5 g of NaCl, adjusted to pH 7.0, made up to 1 L with distilled water, sterilized at 121 °C for 20 min. Among them, the concentration of the activated actinomycete S36 bacterial liquid is 5×10 6 CFU / mL, and the concentration of the Y10 bacterial liquid is 5×10 8 CFU / mL.

[0047] Trichoderma M2 was cultured using 150 mL of PD medium as the seed liquid, with the conditions of 28 °C and 180 r / min for 2 days. The medium formula is 200 g of potato boiled starch, 20 g of glucose, adjusted to pH 7.0, made up to 1 L with distilled water, sterilized at 121 °C for 20 min. Among them, the concentration of the activated Trichoderma M2 bacterial liquid is 5×10 6 CFU / mL.

[0048] The above seed liquid was inoculated into the fermentation medium according to a volume ratio of 2:1:1, and the inoculation amount was 4% of the mass of the fermentation medium. The conditions were 28 °C and 220 r / min for 2 days. The viable bacteria count was detected to be ≥10 9 cfu / mL, and a salt-tolerant and growth-promoting compound microbial agent was obtained. After diluting it 100 times, subsequent experiments were carried out.

[0049] The fermentation medium formula is: 20 g of corn starch, 10 g of glucose, 20 g of soybean meal powder, 1.0 g of MgSO 4 , 0.6 g of KH 2 PO 4 , 7.5 g of NaCl. 150 mL was dispensed into 500 ml Erlenmeyer flasks, adjusted to pH 7, made up to 1 L with distilled water, sterilized at 121 °C for 20 min.

[0050] Example 3: Cotton seed soaking and germination test with salt-tolerant growth-promoting compound bacterium agent.

[0051] Select cotton seeds with plump grains and uniform sizes, disinfect them with 2.5 wt% hypochlorous acid for 15 min, and rinse them 4 times with sterile water to obtain disinfected seeds. Divide the disinfected seeds into 2 groups, and soak them in sterile water and the salt-tolerant growth-promoting compound bacterium agent diluted 100 times in Example 2 for 12 h respectively to obtain water-soaked seeds and bacterium agent-soaked seeds.

[0052] Use the vertical paper roll method to germinate the above 2 groups of seeds. The germination papers are moistened with clear water and 150 mM salt solution respectively, and are divided into 4 groups according to the germination paper environment, which are recorded as the control group H 2 O, the bacterium agent group is recorded as bacterium agent, the salt treatment group is recorded as NaCl, and the salt stress group is recorded as NaCl + bacterium agent. Arrange the seeds in each group at a spacing of 2 cm on the germination paper, place 8 cotton seeds on each germination paper, set 5 replicates for each treatment, fix the top of the rolled germination paper with a rubber band, and vertically place them in 5 self-sealing bags. Among them, add 20 mL of 150 mM salt solution to the salt treatment and salt stress groups, and add an equal amount of sterile water to the control group and the bacterium agent group, so that the sterile water and salt solution in the self-sealing bags soak about 1 / 4 of the germination paper respectively. Place them in the greenhouse with a day / night temperature of 30±2°C / 22±2°C and a 14 h photoperiod, and culture for 3 d.

[0053] 1. Determination of cotton seedling growth indexes.

[0054] Record the germination rate of cotton seeds after 3 d and 6 d of salt treatment, and measure the length of the cotton hypocotyl and root length with a ruler. The part from the cotyledon node to the boundary between the hypocotyl and the root is the hypocotyl, and the part from the boundary between the hypocotyl and the root to the root tip is the main root. Set 3 replicates for each treatment. The measurement results of the cotton hypocotyl and root length are as Figure 2 shown.

[0055] The results of investigating the root length on the third day show that the root length of cotton seeds treated with bacterium agent soaking is 5.04% higher than that treated with clear water, and the root length is 103.85% higher under salt stress conditions. The results of the investigation on the 5th day show that the root length of cotton seeds treated with bacterium agent soaking is 15.2% higher than that treated with clear water, and the root length is 14.4% higher under salt stress conditions. The results on the 3rd d and the 6th d are as Figure 3 shown in A and B.

[0056] 3. Determination of cotton hypocotyl enzyme activity.

[0057] 1) Superoxide dismutase: It was determined using a total superoxide dismutase assay kit purchased from Nanjing Jiancheng Bioengineering Institute, with the model number A001-1. After 3 days of salt stress, 0.15 g of the sample was weighed, 1.35 ml of phosphate buffer with a pH of 7.2 was added, and it was ground under ice bath conditions, centrifuged at 4000 r / min for 10 min. The supernatant was taken, and the operations were carried out successively according to the kit instructions. The absorbance was measured at a wavelength of 550 nm.

[0058] 2) Hydrogen peroxide: It was determined using a hydrogen peroxide assay kit purchased from Nanjing Jiancheng Bioengineering Institute, with the model number A064-1-1. After 3 days of salt stress, 0.15 g of the sample was weighed, 1.35 ml of phosphate buffer with a pH of 7.2 was added, and it was ground under ice bath conditions, centrifuged at 10000 r / min for 10 min. The supernatant was taken, and the operations were carried out successively according to the kit instructions. The absorbance was measured at a wavelength of 405 nm.

[0059] 3) Catalase: The sample was determined using a catalase assay kit purchased from Nanjing Jiancheng Bioengineering Institute, with the model number A007-1-1. After 3 days of salt stress, 0.15 g of the sample was weighed, 0.6 mL of phosphate buffer with a pH of 7.2 was added, and it was ground under ice bath conditions, centrifuged at 2500 r / min for 10 min. The supernatant was taken, and the operations were carried out successively according to the kit instructions. The absorbance was measured at a wavelength of 405 nm. The measurement results are shown in Table 3.

[0060] Table 3: Determination of enzyme activity in cotton hypocotyls

[0061] The results showed that when cotton suffered from salt damage, the use of the salt-tolerant and growth-promoting compound microbial agent could significantly increase the activities of SOD and CAT in cotton hypocotyls, and significantly reduce the H 2 O 2 activity. It indicated that the salt-tolerant and growth-promoting compound microbial agent could effectively improve the salt tolerance of cotton.

[0062] Example 4: Salt tolerance test of the compound microbial agent on cotton seedlings.

[0063] Cotton seeds of the same size and plumpness were selected and surface-sterilized with 5 wt% H 2 O 2 solution for 10 min, rinsed repeatedly with deionized water for many times, soaked in deionized water for 24 h, and then placed on a petri dish lined with moist gauze and germinated at 28 °C for 2 days. Seeds with the same bud length were selected and sown in plastic pots, with 4 seeds sown in each pot. Four treatments were set in the experiment, namely the control group treated with clear water was denoted as H 2The treatment groups of 100-fold diluted fermented liquid of the strain were recorded as the bacterial agent, the treatment group of 150mM saline was recorded as NaCl, and the treatment group of 150mM saline + 100-fold diluted fermented liquid of the strain was recorded as NaCl + bacterial agent. The root irrigation method was adopted, and 50mL of the above four groups of solutions were poured around the rhizosphere each time. The cotyledons were poured once, and one true leaf was poured once again when it was flat. The rest of the time was poured with normal water. After 21 days of treatment, samples were collected for index determination. The whole process was cultured at room temperature of 25℃~28℃, 30% humidity, and a light time of not less than 8 hours.

[0064] Slowly pull the cotton seedlings out of the nutrient pot, gently rinse off the soil attached to the roots with running water, wipe off excess water with toilet paper, lay the cotton seedlings flat on the table, and measure the plant height with a ruler. Use absorbent paper to absorb the surface moisture of the cotton seedlings, and weigh the fresh weight of the whole cotton plant; the plants with recorded fresh weight are sterilized at 105℃ for 20 minutes, and dried at 80℃ to constant weight before weighing. Test results are shown in Figure 4 The phenotypic results are shown in Figure 5 .

[0065] The results showed that the use of compound bacterial agents can significantly increase the fresh weight of cotton seedlings by 70.37%, and under salt stress, the use of compound bacterial agents significantly increased the fresh weight of cotton seedlings by 64.82%; the use of compound bacterial agents can significantly increase the dry weight of cotton seedlings by 21.86%, and under salt stress, the use of compound bacterial agents significantly increased the dry weight of cotton seedlings by 36.22%; the use of compound bacterial agents can significantly increase the length of cotton seedlings by 13.69%, and under salt stress, the use of compound bacterial agents significantly increased the length of cotton seedlings by 56.79%.

[0066] Example 5: Test on salt tolerance of wheat seedlings by composite bacterial agent.

[0067] Select cotton seeds of uniform size and fullness and use 5wt% H 2 O 2 The surface of the solution was disinfected for 10 minutes, and the seeds were repeatedly rinsed with deionized water for several times, soaked in deionized water for 24 hours, and then placed on a petri dish covered with moist gauze and germinated at 28°C for 2 days. Seeds with consistent bud length were selected and sown in plastic pots, with 12 seeds per pot. Four treatments were set up, namely, the clean water treatment group, the 100-fold diluted strain fermentation liquid treatment group, the 150mM saline treatment group, and the saline + 100-fold diluted strain fermentation liquid treatment group. The root irrigation method was adopted, and 50 mL of the above four groups of solutions were poured around the rhizosphere each time, once every 5 days, and sampled for index determination after a total of 4 pourings. The whole process was cultured at room temperature at 28°C, 30% humidity, and a light time of not less than 8 hours.

[0068] Slowly pull the wheat seedlings out of the nutrient pot, gently rinse off the soil attached to the roots with running water, wipe off excess water with toilet paper, place the cotton seedlings flat on the table, and measure the plant height with a ruler. Use absorbent paper to absorb the surface moisture of the wheat seedlings, and weigh the fresh weight of the whole cotton plant; the plants whose fresh weight has been recorded are sterilized at 105℃ for 20 minutes, and dried at 80℃ to constant weight before weighing. For the convenience of calculation, the measured data are all for one pot of wheat seedlings. Test results are shown in Figure 6 The phenotypic results are shown in Figure 7 .

[0069] The results showed that the use of salt-tolerant growth-promoting compound bacteria can increase the fresh weight of wheat seedlings by 10.78%. Under salt stress, the use of salt-tolerant growth-promoting compound bacteria can significantly increase the fresh weight of wheat seedlings by 45.47%; the use of salt-tolerant growth-promoting compound bacteria can increase the dry weight of wheat seedlings by 23.05%. Under salt stress, the use of salt-tolerant growth-promoting compound bacteria can increase the dry weight of wheat seedlings by 25.54%; the use of salt-tolerant growth-promoting compound bacteria can increase the length of wheat seedlings by 4.36%. Under salt stress, the use of salt-tolerant growth-promoting compound bacteria can significantly increase the length of wheat seedlings by 29.76%.

[0070] Although preferred embodiments of the present invention have been described, additional changes and modifications may be made to these embodiments by those skilled in the art once the basic inventive concepts are known. Obviously, various changes and modifications may be made to the present invention by those skilled in the art without departing from the spirit and scope of the present invention. Thus, the present invention is intended to include such changes and modifications if they fall within the scope of the technical equivalents of the present invention.

Claims

1. A salt-tolerant growth-promoting composite bacterial agent, characterized in that: Its active ingredient is actinomycetes with a deposit number of CGMCC No.32928 ( Streptomyces rochei ) S36, Trichoderma with the deposit number of CGMCC No.41651 ( Trichoderma sp. ) M2 and Bacillus velezii with a deposit number of CGMCC No.32927 ( Bacillus velezensis )Y10.

2. The salt-tolerant growth-promoting composite bacterial agent according to claim 1, characterized in that: The salt-tolerant growth-promoting composite bacterial agent is obtained by mixing actinomycete S36 bacterial solution, Trichoderma M2 bacterial solution and Bacillus Velez Y10 bacterial solution and fermenting the mixture; The live bacteria amount of the actinomycete S36 bacterial solution is 1×10 6 CFU / mL~5×10 6 CFU / mL, the viable bacteria volume of the Trichoderma M2 bacterial solution is 1×10 6 CFU / mL~5×10 6 CFU / mL, the live bacteria volume of the Bacillus Velez Y10 bacterial solution is 2×10 8 CFU / mL~5×10 8 CFU / mL.

3. The salt-tolerant growth-promoting composite bacterial agent according to claim 2, characterized in that: The volume ratio of actinomycete S36 culture solution, Trichoderma M2 culture solution and Bacillus Velez Y10 culture solution is 2~3:1~2:1~2.

4. Use of the salt-tolerant growth-promoting composite bacterial agent according to any one of claims 1 to 3 in improving the salt tolerance of plants.

5. The use of the salt-tolerant growth-promoting composite bacterial agent according to claim 4 in improving plant salt tolerance, characterized in that: Improving the salt tolerance of plants refers to improving the germination rate of plant seeds under salt stress.

6. Use of the salt-tolerant growth-promoting composite bacterial agent according to claim 5 in improving plant salt tolerance, characterized in that: The salt-tolerant growth-promoting composite bacterial agent is used as a seed soaking agent for plant seeds to improve the germination rate of plant seeds under salt stress.

7. Use of the salt-tolerant growth-promoting composite bacterial agent according to claim 4 in improving plant salt tolerance, characterized in that: Improving the salt tolerance of plants refers to increasing the fresh weight, dry weight and length of plant seedlings under salt stress.

8. Use of the salt-tolerant growth-promoting composite bacterial agent according to claim 7 in improving plant salt tolerance, characterized in that: The salt-tolerant growth-promoting composite bacterial agent is used as a root irrigation agent for plant seedlings to increase the fresh weight, dry weight and length of the plant seedlings under salt stress.

9. Use of the salt-tolerant growth-promoting composite bacterial agent according to claim 4 in improving plant salt tolerance, characterized in that: The plants are cotton and wheat.

Images