CRISPR Cas13a mutant Cas13a-Y967A as well as gene, recombinant protein expression system and application thereof

Abstract

The invention provides a CRISPR (clustered regularly interspaced short palindromic repeats) Cas13a mutant Cas13a-Y967A as well as a gene, a recombinant protein expression system and application thereof, and belongs to the technical field of protein engineering modification. According to the CRISPR Cas13a mutant Cas13a-Y967A disclosed by the invention, after a wild CRISPR Cas13a gene from Leptotricia buccal and an amino acid sequence are analyzed, a plurality of key sites are determined, the key sites are respectively subjected to site-specific mutagenesis, the molecular structure of the CRISPR Cas13a is modified, and the CRISPR Cas13a mutant Cas13a-Y967A of which the RNA cutting activity is remarkably improved compared with that of Cas13a-WT is finally obtained through screening. The CRISPR Cas13a mutant Cas13a-Y967A disclosed by the invention has a wide application value in the aspects of pathogen detection, disease treatment and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of protein engineering modification, and particularly relates to a CRISPR Cas13a mutant Cas13a-Y967A, its gene, recombinant protein expression system and application. Background Art

[0002] Clustered regularly interspaced short palindromic repeats (CRISPR) is a repetitive sequence structure that naturally and widely exists in prokaryotes such as bacteria and archaea. It is an important immune system of these prokaryotes and plays a key role in antiviral defense. The Cas genes are located near the CRISPR locus or scattered at other positions throughout the genome. The proteins encoded by them work together with the CRISPR gene sequence to jointly constitute this immune mechanism of prokaryotes. When the bacteria are infected again by foreign nucleic acids homologous to the spacer region, the CRISPR array will be activated and transcribed to produce precursor crRNA (pre-crRNA). Under the action of RNase and Cas proteins, mature crRNA is generated, which together with Cas proteins forms a ribonucleoprotein (RNP) complex and directs to viral nucleic acids, thereby mediating an antiviral response.

[0003] Cas13a (or C2c2) is a type VI-A CRISPR-Cas system. As a single-component crRNA-guided RNA ribonuclease, it functions to degrade the invasive RNA targeted by crRNA, that is, cis-cleavage. Once Cas13a cleaves the target RNA through crRNA guidance, it will also produce a collateral effect of non-specifically cleaving non-target RNA, that is, trans-cleavage. This property has enabled the CRISPR-Cas13a system to be rapidly and widely applied in fields such as RNA editing, pathogen detection, gene therapy, disease treatment and biosensing.

[0004] Currently, the methods for improving the sensitivity, i.e., the enzymatic cleavage activity, of Cas13a as an RNA ribonuclease mainly include optimizing other components of the detection system such as crRNA and divalent metal ions, inserting an RNA-binding domain into the Cas13a protein to enhance its ability to recognize RNA, or combining with other techniques such as isothermal amplification. The detection stability of the above methods needs to be improved, or they have deficiencies such as long time consumption and complex instrument operation. Therefore, protein engineering modification and screening of Cas13a to obtain a novel Cas13a protein with high stability and high RNA cleavage activity is of great significance for its applications in pathogen detection, disease treatment and other fields. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a CRISPR Cas13a mutant Cas13a-Y967A, its gene, recombinant protein expression system and application, so as to solve the problems of low enzymatic cleavage activity and poor detection stability of the existing Cas13a protease.

[0006] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0007] The present invention provides a CRISPR Cas13a mutant Cas13a-Y967A, and the amino acid sequence of the CRISPR Cas13a mutant Cas13a-Y967A is shown in SEQ ID NO.2.

[0008] The present invention also provides a gene encoding the CRISPR Cas13a mutant Cas13a-Y967A, and the nucleotide sequence of the gene is shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.7.

[0009] The present invention also provides a recombinant protein expression system of the CRISPR Cas13a mutant Cas13a-Y967A, including the gene encoding the CRISPR Cas13a mutant.

[0010] The present invention also provides a ribonucleoprotein complex, including the CRISPR Cas13a mutant Cas13a-Y967A and crRNA.

[0011] The present invention also provides the application of the CRISPR Cas13a mutant Cas13a-Y967A or the ribonucleoprotein complex in detecting RNA.

[0012] Preferably, the RNA includes HIV virus RNA.

[0013] Preferably, the method for detecting RNA comprises the following steps:

[0014] 1) Mix and incubate the CRISPR Cas13a mutant Cas13a-Y967A and crRNA to obtain the ribonucleoprotein complex;

[0015] 2) Mix the ribonucleoprotein complex, RNase inhibitor, reporter RNA, target RNA to be detected, and cleavage buffer to obtain a mixture;

[0016] 3) Detect the fluorescence signal of the mixture to determine whether the target RNA is present.

[0017] Preferably, the temperature of the incubation in step 1) is 35-40 °C, and the incubation time is 15-40 min.

[0018] Preferably, the reporter RNA in step 2) is an RNA with a fluorescent group at the 5' end and a quenching group at the 3' end. The nucleotide sequence of the reporter RNA is polyuracil, and the number of bases of the polyuracil is 5-20.

[0019] Preferably, the final concentration of the ribonucleoprotein complex in step 2) is 80-120 nM; the final concentration of the RNase inhibitor is 0.5-1.5 U / mL; the final concentration of the reporter RNA is 380-800 nM.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] After analyzing the wild-type CRISPR Cas13a gene and amino acid sequence derived from Leptotricia buccalis, the present invention identified multiple key sites, performed site-directed mutagenesis on the key sites respectively, and modified the molecular structure of CRISPR Cas13a. Finally, through screening, the CRISPR Cas13a mutant Cas13a-Y967A with significantly improved RNA cleavage activity compared to Cas13a-WT was obtained. The CRISPR Cas13a mutant Cas13a-Y967A of the present invention has broad application value in pathogen detection, disease treatment, and other aspects. Description of the Drawings

[0022] Figure 1 is a schematic diagram of site-directed mutagenesis of wild-type CRISPR Cas13a;

[0023] Figure 2 is a plasmid map of p2CT-His-MBP-Lbu_C2c2_WT containing the LbuCas13a gene;

[0024] Figure 3 It is the agarose gel electrophoresis diagram of the PCR product after the mutation of the Cas13a-WT plasmid (where the left diagram is the agarose gel electrophoresis diagram of the PCR product of Kit A, and the right diagram is the agarose gel electrophoresis diagram of the PCR product of Kit B);

[0025] Figure 4 It is the comparison of the cleavage activities of Cas13a-WT and mutants against two different target RNAs (where the left diagram is the 1-hour background-corrected fluorescence measurement of the RNA cleavage experiment, the abscissa represents time (seconds), and the ordinate represents the background-corrected fluorescence measurement value; the right diagram is the percentage of cleavage products obtained by normalizing the 1-hour end point value of the left diagram to the data of Cas13a-WT);

[0026] Figure 5 It is the comparison of the cleavage activities of Cas13a-WT and mutants against the same target RNA at different concentrations (where A, C, E, and G are the 1-hour background-corrected fluorescence measurements of the cleavage experiments of 1 pM, 100 pM, 200 pM, and 400 pM target RNA-1 respectively, the abscissa represents time (seconds), and the ordinate represents the background-corrected fluorescence measurement value, and B, D, F, and H are the percentages of cleavage products obtained by normalizing the 1-hour end point values of A, C, E, and G to the data of Cas13a-WT respectively);

[0027] Figure 6 It is the comparison of the cleavage activities of Cas13a-WT and the mutant Cas13a-Y967A against the 1-hour end point values of the target RNA of the gag gene of different concentrations of HIV-1 virus. Detailed implementation manners

[0028]

[0029] In the present invention, the amino acid sequence of the CRISPR Cas13a mutant Cas13a-Y967A is obtained by mutating tyrosine at position 967 of the amino acid sequence of wild-type CRISPR Cas13a to alanine (such as Figure 1

[0030]

[0031] The present invention also provides a recombinant protein expression system for the CRISPR Cas13a mutant Cas13a-Y967A, which includes the gene encoding the CRISPR Cas13a mutant.

[0032] In the present invention, the recombinant protein expression system for the CRISPR Cas13a mutant Cas13a-Y967A further includes a host cell, and the host cell includes bacteria, yeast, mammalian cells or insect cells.

[0033] The present invention also provides a ribonucleoprotein complex, which includes the CRISPR Cas13a mutant Cas13a-Y967A and crRNA. In the present invention, the crRNA includes an anchoring sequence that binds to the CRISPR Cas13a mutant Cas13a-Y967A and a guide sequence that is complementary to the target RNA sequence; the number of the crRNAs is preferably one or more.

[0034] The present invention also provides the use of the CRISPR Cas13a mutant Cas13a-Y967A or the ribonucleoprotein complex in detecting RNA.

[0035] In the present invention, the RNA includes HIV virus RNA; the method for detecting RNA includes the following steps:

[0036] 1) Mix and incubate the CRISPR Cas13a mutant Cas13a-Y967A and crRNA to obtain the ribonucleoprotein complex;

[0037] 2) Mix the ribonucleoprotein complex, RNase inhibitor, reporter molecule RNA, target RNA to be detected and cleavage buffer to obtain a mixture;

[0038] 3) Detect the fluorescence signal of the mixture to determine whether the target RNA exists.

[0039] In the present invention, the CRISPR Cas13a mutant Cas13a-Y967A and crRNA are mixed and incubated to obtain the ribonucleoprotein complex. The incubation temperature is preferably 35-40 °C, more preferably 36-39 °C, and the incubation time is preferably 15-40 min, more preferably 20-35 min. When the number of crRNAs is 1, the concentration ratio of the crRNA to the CRISPR Cas13a mutant Cas13a-Y967A is preferably 0.5-2:1, more preferably 0.8-1.5:1; when the number of crRNAs is 2, the concentration ratio of the crRNA to the CRISPR Cas13a mutant Cas13a-Y967A is preferably 0.3-0.7:0.3-0.7:1, more preferably 0.4-0.6:0.4-0.6:1; when the number of crRNAs is 3, the concentration ratio of the crRNA to the CRISPR Cas13a mutant Cas13a-Y967A is preferably 0.2-0.4:0.2-0.4:0.2-0.4:1, more preferably 0.25-0.35:0.25-0.35:0.25-0.35:1.

[0040] In the present invention, the ribonucleoprotein complex, RNase inhibitor, reporter RNA, target RNA to be tested, and cleavage buffer are mixed to obtain a mixed solution. The reporter RNA is an RNA with a fluorescent group at the 5' end and a quenching group at the 3' end. The fluorescent group is preferably 6-FAM, and the quenching group is preferably BHQ1; the nucleotide sequence of the reporter RNA is polyuracil, and the number of bases of the polyuracil is preferably 5-20. The reporter RNA is specifically preferably 5'6-FAM-rUrUrUrUrU-3'BHQ1. The final concentration of the ribonucleoprotein complex is preferably 80-120 nM, more preferably 90-110 nM; the final concentration of the RNase inhibitor is preferably 0.5-1.5 U / mL, more preferably 0.8-1.2 U / mL; the final concentration of the reporter RNA is preferably 380-800 nM, more preferably 390-700 nM.

[0041] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0042] Example 1

[0043] Construction of Cas13a Mutant

[0044] Using the plasmid p2CT-His-MBP-Lbu_C2c2_WT (Addgene, 83482) containing the LbuCas13a gene (obtained from https: / / www.addgene.org / 83482 / , and the plasmid map is as Figure 2 shown) as the DNA template. According to the candidate sites, upstream and downstream primers for PCR were designed, and the whole plasmid PCR was performed using Kit A (MutExpress II Fast Mutagenesis Kit V2, Nanjing Novoprotein Scientific Co., Ltd., C214) and Kit B ( Site-Directed Mutagenesis Kit, NEB, 0552S) respectively. The upstream and downstream primers for the PCR are shown in Table 1. Among them, SEQ ID NO.8 - SEQ ID NO.11 are the primers designed according to Kit B, and SEQ ID NO.12 - SEQ ID NO.19 are the primers designed according to Kit A.

[0045] Table 1 Design of site-directed mutagenesis primers

[0046]

[0047] 1. The reaction system and method for whole plasmid PCR using Kit A are as follows:

[0048] (1) Amplification of the target plasmid

[0049] Add each component respectively: 18 μL of ddH 2 O, 25 μL of 2×Max Buffer, 1 μL of dNTPMix (10 mM each), 1 μL of Cas13a-WT plasmid DNA (1.2496 ng / μL), 2 μL of the upstream primer (10 μM), 2 μL of the downstream primer (10 μM), and 1 μL of Phanta Max Super-Fidelity DNA Polymerase.

[0050] The PCR amplification conditions are: 95°C for 30 s; 95°C for 15 s, 61°C for 15 s, 72°C for 10 min, repeat 30 cycles; continue to extend at 72°C for 5 min.

[0051] (2) Verification of the amplified fragment

[0052] After the reaction, take a small amount of the amplified product for agarose gel electrophoresis to verify the successful amplification of the target gene. The operation is as follows:

[0053] Weigh 0.2 g of agarose and add it to 25 mL of 1×TAE solution to prepare a 0.8% agarose gel solution. Heat it in a microwave oven until the solution becomes clear and transparent, then pour it into the gel casting tray, insert the comb, and let it stand at room temperature for about 30 min until the gel solidifies. Pull out the comb, place the gel in the electrophoresis tank containing 1×TAE solution, and ensure that the TAE solution covers the gel. After preparing the samples according to Table 2, add 4 μL of DNA Marker and the samples to the gel wells respectively, cover the electrophoresis tank lid, and use a voltage of 90 V for 30 min. After electrophoresis, take out the gel and stain it in the agarose gel electrophoresis staining solution for 30 min, and then take a photo of the gel with a gel imaging system for preservation.

[0054] Table 2 Sample preparation system for agarose gel electrophoresis

[0055]

[0056]

[0057] Experimental results: As Figure 3 shown. It can be seen from the left figure of Figure 3 that the DNA bands of the PCR products are all in the correct positions and the bands are single.

[0058] (3) Determination of the concentration of the amplified product

[0059] The size of the PCR product has been verified by agarose gel electrophoresis to be correct and the band is single. There is no need to perform Dpn I digestion. Use a ultra-micro ultraviolet-visible spectrophotometer to determine the concentration of the PCR amplified product.

[0060] (4) Calculation of the amount of the PCR amplified product used

[0061] The optimal molar ratio of the single-base site-directed mutagenesis recombination reaction system is 0.03 pmol. Use the following formula to calculate the DNA mass corresponding to the molar amount: Optimal usage amount of the amplified product = [0.02 × number of base pairs of the fragment] ng.

[0062] (5) Recombination reaction

[0063] Prepare the reaction system on ice according to Table 3:

[0064] Table 3 Recombination reaction system

[0065]

[0066] Note: NC: Negative Control, negative control.

[0067] After gently mixing, place the reaction system in a 37°C constant temperature incubator for 30 min, and immediately cool it on ice.

[0068] (6) Transformation of the recombinant product

[0069] Take out the competent cells Escherichia coli DH5α from the -80°C refrigerator, quickly place them on ice to thaw for 10 minutes to thaw the competent cells, and avoid repeated freezing and thawing. Aliquot the competent cells into sterile centrifuge tubes, 25 μL per tube, for a total of 8 tubes. Take 2.5 μL of each of the 8 groups of recombinant products from the previous step and add them to the aliquoted competent cells, gently mix, avoid violent shaking, and let stand on ice for 30 minutes to allow the recombinant plasmid DNA to fully contact the competent cells. Heat shock at 42°C for 45 seconds and then let stand on ice for 2 minutes. In the laminar flow hood, add 225 μL of antibiotic-free LB liquid medium to each centrifuge tube, gently mix, and incubate in a 37°C constant temperature shaker at 200 rpm for 1 h. Centrifuge at 5000 rpm for 5 min, discard 225 μL of the supernatant, resuspend the remaining bacterial solution, and spread the bacterial solution on LB solid medium containing ampicillin resistance, and incubate upside down in a 37°C incubator overnight.

[0070] (7) Identification of recombinant products

[0071] Take 4 positive plates of the recombinant products after overnight culture, pick 3 monoclonal strains from each plate and inoculate them into 20 mL of LB medium with a final concentration of 50 μg / mL ampicillin resistance, and shake culture overnight at 37°C and 180 rpm. Take 2 mL of the bacterial solution and send it to Jilin Kumei Biotechnology Co., Ltd. for sequencing, and compare and analyze the sequencing results with the designed mutant sequences. Extract the plasmid from the remaining bacterial solution for later use.

[0072] 2. The reaction system and method for whole plasmid PCR using Kit B are as follows:

[0073] (1) Amplification of target plasmid

[0074] Add each component separately: 12.5 μL of Q5 Hot Start High-Fidelity 2X Master Mix (final concentration 1×), 1.25 μL of upstream primer (original concentration 10 μM, final concentration 0.5 μM), 1.25 μL of downstream primer (original concentration 10 μM, final concentration 0.5 μM), 1.0 μL of Cas13a-WT plasmid DNA (original concentration 1.2496 ng / μL, final concentration 1 - 25 ng), and 9.0 μL of Nuclease-free Water.

[0075] Perform cycle amplification on a PCR instrument, and the amplification conditions are: 98°C for 30 s; 98°C for 10 s, 60°C for 30 s, 72°C for 4 min 45 s, repeat 25 cycles; continue to extend at 72°C for 2 min.

[0076] (2) Verification of amplified fragment

[0077] After the reaction, take a small amount of the amplified product for agarose gel electrophoresis to verify the successful amplification of the target gene. The operation is as follows:

[0078] Weigh 0.2 g of agarose and add it to 25 mL of 1× TAE solution to prepare a 0.8% agarose gel solution. Heat it in a microwave oven until the solution is clear and transparent, then pour it into the gel casting tank, insert the comb, and let it stand at room temperature for about 30 min until the gel solidifies. Pull out the comb, place the gel in the electrophoresis tank containing 1× TAE solution, and make sure the TAE solution covers the gel. After preparing the samples according to Table 4, add 4 μL of DNA Marker and the samples to the gel wells respectively, cover the electrophoresis tank lid, and use a voltage of 90 V for 30 min. After electrophoresis, take out the gel and stain it with the agarose gel electrophoresis staining solution for 30 min, and then take a photo of the gel with a gel imaging system for preservation.

[0079] Table 4 Sample preparation system for agarose gel electrophoresis

[0080]

[0081] Unit: μL.

[0082] Experimental results: As Figure 3 shown. As can be seen from the right figure of Figure 3 , the DNA bands of the PCR products of Cas13a-Y967E and Cas13a-Y967A are both in the correct positions and the bands are single. Cas13a-Y967A was successfully mutated using both Kit A and Kit B.

[0083] (3) Kinase-Ligase-DpnI (KLD) reaction

[0084] The size of the PCR product verified by agarose gel electrophoresis is correct and the band is single. Digest and recombine the PCR product with DpnI. The reaction system is: 1 μL of the PCR product, 5 μL of 2X KLD Reaction Buffer (final concentration 1×), 1 μL of 10X KLD Enzyme Mix (final concentration 1×), and 3 μL of Nuclease-free Water (final concentration 1), and incubate at room temperature for 5 min.

[0085] (4) Transformation of KLD product

[0086] Take out 50 μL of competent Escherichia coli DH5α cells from an -80 °C refrigerator, quickly place them on ice to thaw for 10 minutes to thaw the competent cells, and avoid repeated freezing and thawing. Add 5 μL of the KLD product from the previous step to the competent cells, gently mix well, avoid violent shaking, let it stand on ice for 30 minutes, heat shock at 42 °C for 90 seconds, and then let it stand on ice for 5 minutes. In a laminar flow hood, add 650 μL of antibiotic-free SOC liquid medium to the centrifuge tube respectively, gently mix well, and recover and culture in a constant temperature shaker at 37 °C at a rotation speed of 250 rpm for 1 h.

[0087] Take an appropriate amount of the bacterial solution and dilute it by concentration gradients to 0 times, 2 times, 4 times, 8 times, 16 times, and 32 times. Respectively take 70 μL and coat it on an LB solid medium containing ampicillin resistance, and incubate it upside down in an incubator at 37 °C overnight.

[0088] (5) Identification of the KLD product

[0089] Take the plates after overnight culture, respectively pick several monoclonal strains and inoculate them into 20 mL of LB medium with a final concentration of 50 μg / mL ampicillin resistance, and shake and culture overnight at 37 °C at 180 rpm. Respectively take 2 mL of the bacterial solution and send it to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and compare and analyze the sequencing results with the designed mutant sequences. Extract the plasmids from the remaining bacterial solution for standby.

[0090] Example 2

[0091] Induced expression of Cas13a mutant protein and wild-type protein

[0092] Respectively take 2 μL of the correctly sequenced mutant plasmids and wild-type plasmids from Example 1 and add them to 50 μL of Escherichia coli competent cells E. coli BL21(DE3), and place them on ice for 30 min. Heat shock at 42 °C for 90 sec, ice bath for 3 min, and add 500 μL of LB medium. Shake and culture at 37 °C at 180 rpm for 1 h. Spread the bacterial solution on an LB solid medium containing ampicillin resistance and incubate it upside down at 37 °C overnight. The next morning, pick monoclonal strains and inoculate them into 20 mL of LB medium with a final concentration of 50 mg / L ampicillin resistance, and shake and culture at 37 °C at 180 rpm until OD 600nm is about 0.6. Take 10 mL of the cultured bacterial solution and transfer it to 1 L of LB medium for scale-up culture, and shake and culture at 37 °C at 180 rpm until OD 600nm is about 0.6. Add IPTG with a final concentration of 0.5 mM to the culture, and shake and culture at 16 °C at 160 rpm overnight. Centrifuge the bacterial solution at 8000 rpm at 4 °C for 30 min, collect the bacterial cells and perform high-pressure crushing on the bacterial cells.

[0093] Example 3

[0094] Purification of Cas13a Mutant Protein and Wild-Type Protein

[0095] 1. After packing the NW Rose Ni FF chromatography column, equilibrate the column with 5 column volumes of Binding Buffer (200 mM sodium phosphate, pH 7.0). Centrifuge the cell lysate of Example 2 (12000 rpm, 4 °C, 30 min), take the supernatant, and load it onto the column for chromatography. Wash the column with 10 column volumes of Binding Buffer until the eluate reaches OD 280 baseline value. Use Eluting Buffer (200 mM sodium phosphate, 500 mM imidazole, pH 7.0) to perform gradient elution with 2 column volumes of different concentrations of imidazole, and collect the eluates of different elution peaks separately. Take the eluate for SDS-PAGE electrophoresis.

[0096] 2. After packing the UniGel-80CM chromatography column, equilibrate the column with 5 column volumes of Binding Buffer (50 mM Tris-Cl, 50 mM KCl, 1 mM TCEP, 5% glycerol, pH 7.0). Load the eluate from the NW Rose Ni FF chromatography column containing the target protein verified by SDS-PAGE electrophoresis, wash the column with 10 column volumes of Binding Buffer until the eluate reaches OD 280 baseline value. Use Eluting Buffer (50 mM Tris-Cl, 1 M KCl, 1 mM TCEP, 5% glycerol, pH 7.0) to perform gradient elution with 2 column volumes of different concentrations, and collect the eluates of different elution peaks separately. Take the eluate for SDS-PAGE electrophoresis.

[0097] 3. Ultrafilter and replace the protein buffer of the eluate from the UniGel-80CM chromatography column containing the target protein verified by SDS-PAGE electrophoresis into Protein Storage Buffer (20 mM HEPES-K, 200 mM KCl, 1 mM TCEP, 10% glycerol, pH 7.0).

[0098] Example 4

[0099] In Vitro Transcription and Purification of crRNA and Target RNA

[0100] The DNA sequences corresponding to the crRNA and target RNA sequences in Table 5 were synthesized by Jilin Kumei Biotechnology Co., Ltd. and used as the DNA templates for in vitro transcription.

[0101] Table 5 crRNA and Target RNA Sequences

[0102]

[0103]

[0104] Use HiScribe TM The T7 Quick High Yield RNA Synthesis Kit (NEB) was used for in vitro transcription. The reaction system consisted of 6.5 μL of nuclease-free water, 10 μL of NTP Buffer Mix, 10 μL of DNA Template, 1.5 μL of DTT (0.1 M)*, and 2 μL of T7 RNA Polymerase Mix, and was incubated overnight at 37°C.

[0105] 45 μL of nuclease-free water and 3 μL of DNase I were added to the transcription product and reacted at 37°C for 15 min to remove the DNA template in the transcription product.

[0106] Use The Spin RNA Cleanup Kit (NEB) was used to purify the transcription product. 100 μL of Buffer BX and 150 μL of absolute ethanol were added to every 50 μL of the transcription product, gently mixed and then transferred to a spin column, centrifuged at 16,000 g for 1 min, and the effluent was discarded; 500 μL of Washing Buffer was added, centrifuged at 16,000 g for 1 min, and the effluent was discarded; repeated once; 50 μL of nuclease-free water was added, centrifuged at 16,000 g for 1 min, and the effluent was collected, which was the solution containing the target RNA. Its concentration was detected and stored at -80°C in a refrigerator.

[0107] Example 5

[0108] Detection of the cleavage activity of Cas13a mutants

[0109] In the presence of the target RNA, the target RNA initiates the RNA cleavage experiment, exerts its cis-cleavage and trans-cleavage functions, cleaves the target RNA and the reporter molecule RNA respectively and generates fluorescence signals. The RNA cleavage activity of Cas13a can be judged according to the intensity of the generated fluorescence signals.

[0110] 1. Two different groups of target RNAs were used to compare the cleavage activities of Cas13a-WT, mutant Cas13a-Y967A (amplified by Kit A), and other designed mutant Cas13a-R963A, Cas13a-R963E, Cas13a-Y967R, and Cas13a-Y967E. The specific process is as follows:

[0111] The crRNAs of Example 4 (SEQ ID NO.20 or SEQ ID NO.22) were respectively incubated with the Cas13a proteins (including wild-type and each mutant) purified in Example 3 at a concentration ratio of 1:1 at 37 °C for 30 min to form Cas13a-crRNA RNP complexes. The detection system for the experimental group was 50 μL, containing the RNP complex with a final concentration of 100 nM, the final concentration of RNase inhibitor of 1 U / mL, the final concentration of reporter molecule RNA (5’6-FAM-rUrUrUrUrU-3’BHQ1) of 400 nM, and the final concentrations of target RNAs (SEQ ID NO.21 or SEQ ID NO.23) of 100 pM, and nuclease-free water was added to make up to 50 μL with cleavage buffer. The negative control group added nuclease-free water with the same volume as the target RNA to replace the target RNA. The fluorescence values within 1 h were detected at 37 °C using a fluorescence microplate reader (λex = 485 nm, λem = 520 nm, Gain = 50), and measured every 5 min. The detection values were determined by comparing the differences between the experimental group and the negative control group.

[0112] Experimental results: As Figure 4 shown. It can be Figure 4 seen that the mutant Cas13a-Y967A and Cas13a-Y967E produced stronger fluorescence signals compared with Cas13a-WT, and the end-point values of the fluorescence signals after 1 h of reaction were about 2-5 times that of Cas13a-WT (there were certain differences in the end-point value multiples for different target RNAs). Therefore, the mutant Cas13a-Y967A and Cas13a-Y967E had higher cleavage activities on RNAs, and the mutant Cas13a-Y967A was particularly prominent.

[0113] 2. The cleavage activities of Cas13a-WT, mutant Cas13a-Y967A (obtained by amplification with Kit A), and other designed mutant Cas13a-R963A, Cas13a-R963E, Cas13a-Y967R, and Cas13a-Y967E were compared using target RNAs (target RNA-1) with different concentrations. The specific process was as follows:

[0114] The crRNA-1 (SEQ ID NO.20) of Example 4 was incubated with the Cas13a protein (including wild type and mutants) purified from Example 3 at a concentration ratio of 1:1 at 37 °C for 30 min to form a Cas13a-crRNARNP complex. The experimental group detection system was 50 μL, including a final concentration of 100 nM RNP complex, a final concentration of 1 U / mL of RNase inhibitor, a final concentration of 400 nM of reporter RNA (5'6-FAM-rUrUrUrUrU-3'BHQ1), and a final concentration of 1 pM, 100 pM, 200 pM, and 400 pM of target RNA-1 (SEQ ID NO.21), respectively, and the cutting buffer was supplemented to 50 μL. The negative control group added the same volume of nuclease-free water as the target RNA-1 to replace the target RNA-1. The fluorescence values ​​were measured at 37°C for 1 hour (λex=485nm, λem=520nm, Gain=50) using a fluorescence microplate reader, and the measurement was performed every 5 minutes. The difference between the experimental group and the negative control group was compared to determine the detection value.

[0115] Experimental results: Figure 5 As shown. The mutant Cas13a-Y967A still showed significantly higher enzymatic activity than Cas13a-WT in each concentration group, especially in the low concentration target RNA group. The enzymatic activity of the mutant Cas13a-Y967E was significantly higher than that of Cas13a-WT as the target RNA concentration increased. Cas13a-Y967A performed well at low concentrations of target RNA, while Cas13a-Y967E performed poorly. This phenomenon of the mutant Cas13a-Y967A is highly consistent with the demand for obtaining significant detection results under low concentrations of target RNA such as pathogens or disease biomarkers in actual detection scenarios.

[0116] Example 6

[0117] Cas13a mutant Cas13a-Y967A for non-amplification detection of HIV-1 virus gag gene

[0118] The mutants Cas13a-Y967A (amplified by kit A) and Cas13a-WT with significantly improved RNA cleavage activity in Example 5 were co-incubated with three HIV crRNAs (SEQ ID NO.24, SEQ ID NO.25, and SEQ ID NO.26) to form RNP complexes. The three RNP complexes were used to treat different concentrations (2.84 copies / mL to 2.84×10 11RNA cleavage experiments were performed on the same target RNA (SEQ ID NO.27) at a concentration of 2.84 copies / mL), while exerting its functions of specifically cleaving the target RNA and non-specifically cleaving the reporter RNA to generate fluorescence signals. The RNA cleavage ability of Cas13a can be judged according to the intensity of the generated fluorescence signals. The specific process is as follows:

[0119] One or more of the HIV crRNAs (SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26) were incubated with Cas13a proteins (Cas13a-Y967A, Cas13a-WT) at 37 °C for 30 min to form RNP complexes. If one HIV crRNA was selected, the HIV crRNA and Cas13a protein were co-incubated at a ratio of 1:1. If two HIV crRNAs were selected, the HIV crRNAs and Cas13a protein were co-incubated at a ratio of 0.5:0.5:1. If three HIV crRNAs were selected, the HIV crRNAs and Cas13a protein were co-incubated at a ratio of 0.33:0.33:0.33:1.

[0120] The detection system for the experimental group was 50 μL, containing a final concentration of 100 nM RNP complex (obtained by incubating three HIV crRNAs with Cas13a protein), a final concentration of 1 U / mL of RNase inhibitor, a final concentration of 400 nM of reporter RNA (5’6-FAM-rUrUrUrUrU-3’BHQ1), the target RNA (SEQ ID NO.27), and the cleavage buffer was supplemented to 50 μL. The concentration of the target RNA was 2.84 copies / mL to 2.84×10 11 copies / mL. In the negative control group, nuclease-free water with the same volume as the target RNA was added to replace the target RNA. The fluorescence values were measured every 5 min within 1 h at 37 °C using a fluorescence microplate reader (λex = 485 nm, λem = 520 nm, Gain = 50). The detection values were determined by comparing the differences between the experimental group and the negative control group.

[0121] The target RNA sequence of the HIV-1 virus is located on the conserved gag gene of the HIV-1 virus. The three HIV crRNAs include an anchor sequence that binds to the LbuCas13a protein and a guide sequence that is complementary to the target RNA of the HIV-1 virus. The anchor sequence that binds to the LbuCas13a protein is GACCACCCCAAAAAUGAAGGGGACUAAAAC (SEQ ID NO.31). The guide sequence that is complementary to the target RNA of the HIV-1 virus is shown in Table 6.

[0122] Table 6 Complementary Fragments of Three crRNAs of HIV with Target RNA

[0123]

[0124] Experimental Results: As Figure 6 shown. Figure 6 This is the 1-hour background-corrected fluorescence measurement of the RNA cleavage experiment. The abscissa represents the target RNA copy number (copies / mL), and the ordinate represents the background-corrected fluorescence measurement value. At 12 different target RNA concentrations (2.84 copies / mL - 2.84×10 11 copies / mL), the fluorescence values generated by the mutant Cas13a-Y967A cutting RNA were all higher than those of Cas13a-WT. At the concentrations of 2.84 copies / mL and 2.84×10 copies / mL, the background-corrected fluorescence measurement values of Cas13a-WT were less than 0, and there was no statistical significance. Its detection limit was 2.84×10 2 copies / mL, while the mutant Cas13a-Y967A still had relatively high background-corrected fluorescence measurement values, and its detection limit was 2.84 copies / mL. It can be seen that after different concentrations of target RNA activated the cleavage function of Cas13a, the fluorescence signals generated by the mutant Cas13a-Y967A were stronger than those of Cas13a-WT, indicating that the mutant Cas13a-Y967A had a significantly improved RNase cleavage activity against the gag gene of HIV-1 virus compared with Cas13a-WT and a lower detection limit, further demonstrating the great potential of the mutant Cas13a-Y967A described in the present invention in pathogen detection applications.

[0125] As can be seen from the above examples, based on the wild-type CRISPR Cas13a from Leptotricia buccalis, the molecular structure of CRISPR Cas13a was modified by site-directed mutagenesis technology, and finally the CRISPR Cas13a mutant Cas13a-Y967A with significantly improved RNA cleavage activity compared with Cas13a-WT was obtained. The CRISPR Cas13a mutant of the present invention has broad application values in pathogen detection, disease treatment, etc.

[0126] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A CRISPR Cas13a mutant Cas13a-Y967A, characterized in that The amino acid sequence of the CRISPR Cas13a mutant Cas13a-Y967A is shown in SEQ ID NO.

2.

2. A gene encoding the CRISPR Cas13a mutant Cas13a-Y967A according to claim 1, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.

7.

3. A recombinant protein expression system of a CRISPR Cas13a mutant Cas13a-Y967A, characterized in that: Including the gene encoding the CRISPR Cas13a mutant Cas13a-Y967A as described in claim 2.

4. A ribonucleoprotein complex, characterized in that Comprising the CRISPR Cas13a mutant Cas13a-Y967A and crRNA described in claim 1.

5. Use of the CRISPR Cas13a mutant Cas13a-Y967A described in claim 1 or the ribonucleoprotein complex described in claim 4 in detecting RNA.

6. The use according to claim 5, characterized in that: The RNA includes HIV viral RNA.

7. The use according to claim 5, characterized in that: The method for detecting RNA comprises the following steps: 1) mixing and incubating the CRISPR Cas13a mutant Cas13a-Y967A described in claim 1 and crRNA to obtain the ribonucleoprotein complex described in claim 4; 2) mixing the ribonucleoprotein complex, RNase inhibitor, reporter RNA, target RNA to be detected and cleavage buffer to obtain a mixed solution; 3) Detecting the fluorescent signal of the mixed solution to determine whether the target RNA exists.

8. The use according to claim 7, characterized in that: The incubation temperature of step 1) is 35-40° C., and the incubation time is 15-40 min.

9. The use according to claim 7, characterized in that: Step 2) The reporter RNA is an RNA containing a fluorescent group at the 5' end and a quenching group at the 3' end, and the nucleotide sequence contained in the reporter RNA is polyuracil, and the number of bases of the polyuracil is 5-20.

10. The use according to claim 7, characterized in that: Step 2) The final concentration of the ribonucleoprotein complex is 80-120 nM; the final concentration of the RNase inhibitor is 0.5-1.5 U / mL; and the final concentration of the reporter RNA is 380-800 nM.

Images