Tea tree CsU3 gene promoter and application thereof
By cloning and verifying the promoter of the CsU3 gene of tea tree and applying it to the CRISPR/Cas9 gene editing system, the problem of lack of effective promoters in tea trees is solved, efficient editing of tea trees and tobacco genomes is achieved, and the process of tea tree breeding and variety improvement is promoted.
Patent Information
- Application Number
- CN202510526552.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-25
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-04-25
AI Technical Summary
The lack of effective U3 and U6 promoters in tea trees limits the application of CRISPR/Cas9 gene editing system and the efficiency of tea tree breeding.
The activities of the tea tree CsU3a, CsU3b, CsU3c and CsU3d were cloned and verified, and they were constructed into a gene editing vector to drive the expression of gRNA and realize genome editing of tea tree and tobacco.
Through the CRISPR/Cas9 system driven by the endogenous CsU3 promoter of tea trees, efficient editing of tea trees and tobacco genomes has been achieved, and the process of tea tree breeding and variety improvement has been promoted.
Smart Images

Figure CN120060262A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant biotechnology and genetic engineering, and particularly relates to a tea plant CsU3 gene promoter and application thereof. Background Art
[0002] tea tree( Camellia sinensis Tea (L.) O. Kuntze is a perennial cash crop. Tea, produced from the shoots of the tea plant, provides a variety of beneficial nutrients, including flavonoids, alkaloids, and theanine. Consumed by over two-thirds of the world's population, tea has become the world's most popular healthy, non-alcoholic beverage, second only to water in consumption. Tea plants are characterized by a large genome, high heterozygosity, and high species diversity. However, widespread hybrid incompatibility within and between tea species severely limits the free selection of parents and the utilization of superior genes in tea hybrid breeding, becoming a bottleneck restricting the development of tea breeding. Currently, the creation of new tea material and the selection of new varieties primarily rely on conventional hybridization and radiation-induced mutagenesis, which are characterized by long breeding times, low efficiency, and complex procedures. Therefore, efficient technical means are urgently needed for the genetic improvement of tea plants.
[0003] Gene editing primarily uses sequence-specific nucleases to create double-strand breaks in DNA at specific gene loci, thereby activating the cell's own repair mechanisms—non-homologous end joining or homologous recombination—to achieve gene knockout, targeted insertion, replacement, and chromosomal reorganization, ultimately altering the genome sequence. Gene editing technology has been successfully applied in animals, plants, and other organisms, playing a vital role in the precision breeding of major food and cash crops. It holds great promise for improving crop yield, quality, and resistance. Existing gene editing systems primarily include zinc finger nucleases, transcription activator-like effector nucleases, and the CRISPR / Cas system. The CRISPR / Cas system has become the most widely used gene editing system due to its simplified vector construction process and high editing efficiency. Currently, the main CRISPR / Cas gene editing systems include the CRISPR / Cas9 and CRISPR / Cas12a systems. The CRISPR / Cas9 system consists of gRNA (guide RNA) and the Cas9 endonuclease. The gRNA binds to the target DNA through base pairing with the target sequence, simultaneously recruiting the Cas9 protein. The Cas9 protein binds to the gRNA and recognizes the PAM (protospacer adjacent motifs) site downstream of the target sequence. It cuts the DNA double strand approximately 3 bp upstream of the PAM, forming a double-strand break, which then triggers endogenous DNA double-strand break repair. During the DNA double-strand break repair process, several bases are inserted or deleted at the site of the double-strand break, resulting in gene editing at the target DNA site.
[0004] In gene editing systems, gRNA expression is driven by RNA polymerase III type promoters U3 or U6. While numerous U3 and U6 promoters have been reported in many species, research on the U3 and U6 promoters in tea plants remains lacking. Although U3 and U6 promoters have been successfully used for gene editing in multiple species, the same promoter may not always be effective between distantly related species. Furthermore, multiple U3 or U6 promoters often exist within a gene from the same species, with varying activity and transcriptional efficiency. Therefore, cloning the endogenous U3 and U6 promoters of more target plants will facilitate the refinement of the CRISPR / Cas9 gene editing system and its application in tea genetics and breeding. Therefore, identifying functionally active U3 promoters in tea plants has significant implications for the development of tea genetics and breeding technologies. Summary of the Invention
[0005] In view of the problems existing in the prior art, the purpose of the present invention is to provide a technical solution for the tea plant CsU3 gene promoter and its application.
[0006] The present invention is specifically implemented by the following technical solutions: In a first aspect, the present invention provides a tea plant CsU3 gene promoter, which includes promoters CsU3a, CsU3b, CsU3c and CsU3d. The nucleotide sequence of CsU3a is shown in SEQ ID NO.1, the nucleotide sequence of CsU3b is shown in SEQ ID NO.2, the nucleotide sequence of CsU3c is shown in SEQ ID NO.3, and the nucleotide sequence of CsU3d is shown in SEQ ID NO.4.
[0007] The second aspect of the present invention provides the use of the tea plant CsU3 gene promoter in the field of plant molecular breeding technology, wherein the plant is tea plant or tobacco.
[0008] The third aspect of the present invention provides a tea plant gene editing vector, which contains the above-mentioned tea plant CsU3 gene promoters CsU3a and CsU3b.
[0009] Furthermore, the tea tree gene editing vector is pUC19-CRISPR / Cas9P 35S -CsU3a / CsU3b-T7-CsPDX2.1.
[0010] A fourth aspect of the present invention provides a method for constructing the above-mentioned tea plant gene editing vector, wherein the method drives the gRNA expression of the above-mentioned tea plant CsU3a and CsU3b gene promoters.
[0011] A fifth aspect of the present invention provides a method for genome editing of tea trees, wherein the method introduces the above-mentioned tea tree gene editing vector into tea tree protoplasts.
[0012] The sixth aspect of the present invention provides the application of the above-mentioned tea tree gene editing vector in the field of tea tree molecular breeding technology.
[0013] The seventh aspect of the present invention provides a tobacco gene editing vector, which contains the above-mentioned tea plant CsU3a and CsU3b gene promoters.
[0014] Furthermore, the tobacco gene editing vector is a recombinant plasmid pYLCRISPR / Cas9P 35s -H-CsU3a / CsU3b-sgRNA-NbPDS.
[0015] The eighth aspect of the present invention provides a method for constructing the above-mentioned tobacco and tea tree gene editing vector, wherein the method drives the gRNA expression of the above-mentioned tea tree CsU3a and CsU3b gene promoters.
[0016] A ninth aspect of the present invention provides a method for genome editing of tobacco, wherein the method involves transferring the above-mentioned tobacco gene editing vector into tobacco.
[0017] The tenth aspect of the present invention provides the application of the above-mentioned tobacco gene editing vector in the field of tobacco molecular breeding technology.
[0018] The eleventh aspect of the present invention provides a method for cloning the tea plant CsU3 promoter, the method comprising the following steps: (1) Using the genomic DNA of the leaves of the tea variety 'Longjing 43' as a template, specific primers were designed; (2) PCR reaction was performed in 50 μL system using high-fidelity enzyme 2×Phanta Max Master Mix (Dye Plus). The PCR amplification reaction system was: 1 μL template DNA (50-400 ng), 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 25 μL 2×Phanta Max Master Mix (Dye Plus), 20 μL ddH2O; The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 53°C for 15 s, extension at 72°C for 30 s, 35 cycles, and final extension at 70°C for 5 min.
[0019] (3) The amplified product was cloned into the pDONR221 vector by BP reaction, transformed into Escherichia coli DH5α, and single clones were picked for sequencing, thereby obtaining the pDONR221 vectors containing the CsU3a, CsU3b, CsU3c and CsU3d sequences of the tea plant CsU3 gene promoter.
[0020] Furthermore, in this method, the primers for the promoter CsU3a are CsU3a-attB1 and CsU3a-attB2, the nucleotide sequence of the CsU3a-attB1 is shown in SEQ ID NO.5, and the nucleotide sequence of the CsU3a-attB2 is shown in SEQ ID NO.6; the primers for the promoter CsU3b are CsU3b-attB1 and CsU3b-attB2, the nucleotide sequence of the CsU3b-attB1 is shown in SEQ ID NO.7, and the nucleotide sequence of the CsU3b-attB2 is shown in SEQ ID NO.8; the primers for the promoter CsU3c are CsU3c-attB1 and CsU3c-attB2, the nucleotide sequence of the CsU3c-attB1 is shown in SEQ ID NO.9, and the nucleotide sequence of the CsU3c-attB2 is shown in SEQ ID NO.10. NO.10; the primers for the promoter CsU3d are CsU3d-attB1 and CsU3d-attB2, the nucleotide sequence of CsU3d-attB1 is shown in SEQ ID NO.11, and the nucleotide sequence of CsU3d-attB2 is shown in SEQ ID NO.12.
[0021] The twelfth aspect of the present invention provides a method for detecting the activity of the tea plant CsU3 gene promoters CsU3a, CsU3b, CsU3c and CsU3d, the method comprising the following steps: (1) The CsU3-pDONR221 plasmid was ligated to the pMDC162 vector via LR reaction and transformed into Escherichia coli DH5α. Single clones were picked for sequencing, and finally four promoter activity detection vectors, CsU3a-pMDC162, CsU3b-pMDC162, CsU3c-pMDC162, and CsU3d-pMDC162, were obtained.
[0022] (2) The four promoter activity detection vectors were transformed into tobacco respectively, and the transcriptional activities of the four CsU3 promoters were compared by GUS staining and quantitative detection.
[0023] The present invention has the following beneficial effects: the two CsU3 promoters CsU3a and CsU3b with the highest transcriptional activity are constructed into a gene editing vector to obtain a gene editing vector pUC19-CRISPR / Cas9P in which the endogenous U3 gene promoter of tea plant drives gRNA transcription. 35S-CsU3a / CsU3b-T7-CsPDX2.1, and verified the feasibility of this promoter in the tea tree CRISPR / Cas9 gene editing system in tea plant protoplasts, and achieved CRISPR / Cas9-mediated targeted editing of the tea plant genome. At the same time, the tobacco gene editing vector pYLCRISPR / Cas9P, which drives gRNA transcription from the tea tree CsU3 promoter, was also obtained. 35s -H-CsU3a / CsU3b-sgRNA-NbPDS, and the feasibility of this promoter in tobacco CRISPR / Cas9 gene editing system was also verified. Therefore, the cloned tea plant CsU3 gene promoter of this invention can be applied not only to the tea plant gene editing system but also to tobacco genome editing, achieving efficient and precise germplasm innovation and variety genetic improvement in tea plants, as well as efficient editing of tobacco genomes. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 This is the alignment of the tea plant CsU3 gene promoter CsU3a, CsU3b, CsU3c and CsU3d with the Arabidopsis thaliana AtU3b and AtU3d promoter sequences. The red boxes are the key elements USE (Upstream Sequence Element) and TATA-like box of U3 snRNA transcription, the green box is the transcription start site A, and the red horizontal line marks the U3 snRNA sequence.
[0025] Figure 2 This is the electrophoresis diagram of the cloning of tea plant CsU3 gene promoters CsU3a, CsU3b, CsU3c and CsU3d.
[0026] Figure 3 Figure 3. GUS expression driven by the CsU3 gene promoter in tea plants. (A) Staining of GUS expression driven by CsU3a, CsU3b, CsU3c, and CsU3d. (B) Quantitative analysis of GUS activity in tea plants driven by CsU3a, CsU3b, CsU3c, and CsU3d. CK represents a control group transiently infected with Agrobacterium tumefaciens GV3101.
[0027] Figure 4 Schematic diagram of the tea tree gene editing vector structure. (A) Schematic diagram of the PUC19-Cas9 vector structure, (B) Schematic diagram of the pUC19+gRNA scaffold+terminator+35S+Cas9 vector structure, (C) Schematic diagram of the pUC19-CRISPR / Cas9P 35S -Schematic diagram of the CsU3a / CsU3b-T7-CsPDX2.1 vector structure.
[0028] Figure 5 The gene editing of the tea plant gene CsPDX2.1 by the CsU3 promoter was detected in tea plant protoplasts.
[0029] Figure 6 Tobacco gene editing vector pYLCRISPR / Cas9P 35s -Schematic diagram of the H-CsU3a / CsU3b-sgRNA-NbPDS structure.
[0030] Figure 7 The gene editing of the tobacco gene NbPDS by the tea tree CsU3 promoter was detected in tobacco. DETAILED DESCRIPTION
[0031] In order to better understand the present invention, the present invention is further described in detail below in conjunction with specific examples and drawings of the specification. However, those skilled in the art should understand that the following specific examples are not limitations on the scope of protection of the present invention. Any changes and variations made on the basis of the present invention are within the scope of protection of the present invention. Unless otherwise specified, the examples are carried out in accordance with conventional experimental methods or according to the manufacturer's instructions. In the following examples, pDONR™221 is a commonly used cloning vector, which is commercially available; PMDC162 is a commonly used GUS expression vector, which is commercially available; and pYLCRISPR / Cas9P 35s -H is a multi-target CRISPR / Cas9 gene targeting vector commonly used in plants and is commercially available; the wild-type tobacco variety is Nicotiana benthamiana; Escherichia coli strain DH5α and Agrobacterium tumefaciens strain GV3101 are commonly used strains and are available in most molecular biology laboratories.
[0032] The main reagents in the following examples are: High-fidelity enzyme 2× Phanta Max Master Mix (Dye Plus) was purchased from Vazyme; BP and LR reaction kits were purchased from ThermoFisher Scientific; plasmid extraction kits and agarose gel recovery kits were purchased from Axygen; Bradford protein concentration assay kits were purchased from Solarbio; X-Gluc (5-bromo-4-chloro-3-indole-β-D-glucoside) and MUG (4-methylumbelliferyl-β-D-glucuronide) were purchased from Coolaber; agarose, kanamycin, rifampicin, and other reagents were purchased from Sigma-Aldrich. All other chemical reagents used in the examples were imported or domestically produced analytical grade reagents and were commercially available.
[0033] The primers required for synthesis and the vectors required for sequencing in the examples were provided by Hangzhou Youkang Biotechnology Co., Ltd.
[0034] Example 1: Acquisition of Tea Plant U3 Gene Promoters CsU3a, CsU3b, CsU3c and CsU3d The specific operations are as follows: (1) Based on the conservation of U3 snRNA sequences among different species, the snRNA sequence of Arabidopsis thaliana AtU3b promoter was used to The BLAST alignment of ACGACCTTACTTGAACAGGATCTGTTCTATAGGCTCGTACCTCTGTTTCCTTGATTTCTCAAGAGACAGGCCCTTAACCCTGGTTGATGAACCATGACCGTGCGGCTAGAGCGTGATTGACGGCTACGATCGTCCTCGGACGCATCCGGTGCTGTAGAGGATCGTTACTCGGCTCGGTTTCTACCTTGCCGGGGTGGTCGCACGGCGGTCTGACAGGTCCCTTTCCTTTTTTCTTTTTTTTGCCATAAACTTAAATTTGTATATCGATCATTGTAGATATTGAAAACCTAGAACAAACCAACATCCATGTGAATGTCTTTCATGACTGATTTAGAGATAATTCTTGAATTTTGGAACTAGAATCTATAATGAGCCT) with the tea plant genome sequence in NCBI showed that the tea plant genome contained four copies of the U3 gene. The CARE online analysis website (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) was used to analyze the cis-elements of the promoters of these U3 genes, including cis-elements such as USE and TATA boxes, e.g. Figure 1 Finally, specific primers were designed to clone the four copies of the CsU3 promoter.
[0035] (2) Using the genomic DNA of the leaves of the tea variety 'Longjing 43' as a template, the following specific primers were designed. The lowercase sequences are the attB1 and attB2 linker sequences: The primers for promoter CsU3a are: CsU3a-attB1 (SEQ ID NO.5): GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACAAAAAATAGATATTTTCTTTCCT; CsU3a-attB2 (SEQ ID NO.6): GGGGACCACTTTGTACAAGAAAGCTGGGTCATCCTTCACTGCTTGCGC; The primers for promoter CsU3b are: CsU3b-attB1 (SEQ ID NO.7): GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACAAAAAAATATTATTTTCCACC; CsU3b-attB2 (SEQ ID NO.8): GGGGACCACTTTGTACAAGAAAGCTGGGTCGCTCCTAATTGCTCACTCC; The primers for the promoter CsU3c are: CsU3c-attB1 (SEQ ID NO.9): GGGGACAAGTTTGTACAAAAAAGCAGGCTCCTTCTTCTTCGAGTCTAAACAA; CsU3c-attB2 (SEQ ID NO.10): GGGGACCACTTTGTACAAGAAAGCTGGGTCACCTTGTGCTTCTCTTCTC; The primers for the promoter CsU3d are: CsU3d-attB1 (SEQ ID NO.11): GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACAGATTCCAAATCCACTTACA; CsU3d-attB2 (SEQ ID NO.12): GGGGACCACTTTGTACAAGAAAGCTGGGTCCATGCCTTTATTTCCTCTTCTA.
[0036] (3) PCR reaction was performed in 50 μL system using high-fidelity enzyme 2×Phanta Max Master Mix (Dye Plus). The reaction system for PCR amplification was: 1 μL template DNA (50-400 ng), 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 25 μL 2×Phanta Max Master Mix (Dye Plus), 20 μL ddH2O. The PCR amplification program was: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 53℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles, and final extension at 70℃ for 5 min. All four CsU3 promoters amplified bands of the expected size, such as Figure 2 shown.
[0037] (4) The amplified product was cloned into the pDONR221 vector by BP reaction, transformed into Escherichia coli DH5α, and single clones were selected for sequencing, thereby obtaining the tea plant CsU3 gene promoters CsU3a, CsU3b, CsU3c, and CsU3d. The nucleotide sequence corresponding to the promoter CsU3a is shown in SEQ ID NO.1, the nucleotide sequence corresponding to CsU3b is shown in SEQ ID NO.2, the nucleotide sequence corresponding to CsU3c is shown in SEQ ID NO.3, and the nucleotide sequence corresponding to CsU3d is shown in SEQ ID NO.4.
[0038] Tea tree CsU3a gene promoter nucleotide sequence: ACAAAAAATAGATATTTTCTTTCCTAGAATGGTTGTCGTTAGATCAGTAAATTTGCATATAAAGGAGCTTAATCTTGTTAGAGTTTAATACCATTTGTTATTAATTATCATACTTTTAATGATTTTTTTTTCAATAATCAAAACCCATTAAGATTAGATTCACTA GAAAACAACATGAAGCCCGACTTTAACAAATGCCATGTTGAATGCACATAATTACGAAATAAACCTTAAACATGCTAGCTGACAGACAAGTGAAACTTAGTCCCACATCGAAAAATTACGAAGCAACGCACATGTTTATGAACAACAGCGCAAGCAGTGAAGGAT.
[0039] Tea tree CsU3b gene promoter nucleotide sequence: ACAAAAAAATATTATTTTCCACCTAAAAAAACAAACTGGATTTTCATTCAATTTTTATTTACCAAAGGAAGCAGATCAACCATCTTTCACAAAATCTAAGGATTTAACGAACGGATTCTGGACCGGGATCCGATTTCATACTACAGTTCAGC TAAAAAATGATATTTATTTTCTTTCCTTGAATGGTTGTCGTTAGATCAGTAAAATTTGCATGTAAAGAGTTTAGCAAGTGAAACTTATCCCACATCAAAAAAATACGGAACGAAGAACATGTTTATATTCAACGGAGTGAGCAATTAGGAGC.
[0040] Tea tree CsU3c gene promoter nucleotide sequence: TTCTTCTTCGAGTCTAAACAACAGCCCAACAAAGCATATCAGAAAATTACAGAGTCAAAAGAGCATATCAATGCTATGAAAATTGCGAGGATCTTTAGAAGTGATTTTCTTTGCACACAAACAGATATTCCAAATCCACTTACAATTACAACTTCCCTAGTATCAA ATTCAGTATGGAAAACAGATGTGAAACAATTGAAGAAAACCAGACTAATAACAAAATATATAAATCCAAAACATCAATCTCTTTGAGAAACAAACAGCAAGTCCCACATCGAAACAATATGAGAAAAAAGAGGTGTATTTATTAGTCGAGAAGAGAAGCACAAGGT.
[0041] Tea tree CsU3d gene promoter nucleotide sequence: ACAGATTCCAAATCCACTTACAATTACAACTTCCCTAGTATAAAATTCAGTATGGAAAACAGAAGTGAAACAATTGTAGAAAATGAGACTAATAATAACGAAGTAAATAAATATCTTAGCTCCCAAAAATCAATCTGTAGGGAAGTTTTGCGTTGCTAACCCTGAA GAAACCCGTATGAATAAGCTCCGCCCAGTATCCAGAAACGACCCCCAAATACAAAAACATGTCGGAAGACGGACGGGAAGAAAAGAAAGACACAGAGAGTCCCACATCGAAACAACATGAGCAATGTGAGCTGTATTTATATAACTAGAAGAGGAAATAAAGGCATG.
[0042] Example 2: Detection of tea plant CsU3 gene promoter activity The specific operations are as follows: (1) Construction of tea plant CsU3 gene promoter activity detection vector: The four CsU3-pDONR221 plasmids obtained in Example 1 were ligated to the pMDC162 vector via LR reaction, transformed into Escherichia coli DH5α, and single clones were picked for sequencing to obtain four promoter activity detection vectors, CsU3a-pMDC162, CsU3b-pMDC162, CsU3c-pMDC162, and CsU3d-pMDC162.
[0043] (2) Verification of Agrobacterium transformation of tea plant CsU3 gene promoter: The four constructed CsU3 promoter activity detection vectors were transformed into Agrobacterium strain GV3101 respectively, and injected into tobacco for transient expression through Agrobacterium-mediated method. The tobacco used was grown for 20-30 days. After 3 days of culture, tobacco leaves were taken for GUS staining. After decolorization, the staining of the leaves was observed. The untransformed Agrobacterium strain GV3101 was used as a control. The results showed that all four cloned CsU3 promoters had transcriptional activity. The staining situation is shown in Figure 2. Figure 3 As shown in A. At the same time, the injected leaves were ground and protein was extracted to determine the GUS enzyme activity. The GUS enzyme activity driven by different promoters was compared to compare their transcriptional activity differences. The results are shown in Figure 3 As shown in B.
[0044] Example 3: Construction of tea plant CsU3a and CsU3b promoter gene editing recombinant vector The specific operations are as follows: (1) Construction of PUC19-Cas9 vector: Primers for amplifying Cas9p sequences were designed on the NEB Builder website. The primer sequences are as follows: Cas9p-F (SEQ ID NO. 13): GGGACGAGCTCGGTACCCGGGATCCCCTAAGAAGAAGCGGAAG; Cas9p-R (SEQ ID NO. 14): ATACGAACGAAAGCTCTGCAGCTACTTCTTTTTCTTAGCCTG.
[0045] Using the pYLCRISPR / Cas9Pubi-H plasmid as a template, PCR amplification was performed to obtain the Cas9p sequence. The pUC19-nLUC vector was digested with BamHI and PstI to remove the Linker+nLUC sequence, and the Cas9p sequence was connected to the vector by seamless cloning. The constructed vector is PUC19-Cas9, and the vector structure diagram is shown in the figure. Figure 4 As shown in A. Then, primers for amplifying the gRNA scaffold sequence were designed. The primer sequences are as follows: gRNA Scaffold+T-F2 (SEQ ID NO.15): AGATTGTACTGAGAGTGCACGCATGCCCTAGGACTAGTAGGCCTGTTTTAGAGCTAGAAATAGC; gRNA Scaffold+TR (SEQ ID NO.16): GTGCGGTATTTCACACCGCATATGACGCGTTCCTTTGCTGCC.
[0046] Using the pYLsgRNA-AtU3b plasmid as a template, the gRNA scaffold sequence was obtained by PCR amplification. The pUC19-Cas9 vector was digested with NdeI and connected to the gRNA scaffold sequence by seamless cloning. At the same time, SphI, AvrII, SpeI, and StuI restriction sites were introduced at the left end of the gRNA scaffold, and MluI and NdeI restriction sites were introduced at the right end of the gRNA scaffold. The constructed vector is pUC19-gRNA scaffold-terminator-35S-Cas9. The vector structure diagram is shown in the figure. Figure 4 As shown in B.
[0047] (2) Selection of target genes and design of target sites for tea tree gene editing: A theanine hydrolase gene CsPDX2.1 from tea plants was selected as the target gene, and a target site with a HindIII restriction site was designed on its CDS sequence. The target sequence is as follows: sgRNA-7 (SEQ ID NO. 17): ATTATGATACTCAGCAAGCTTGG (3308-3289, -).
[0048] (3) Construction of CsPDX2.1 gene editing vector: The CsU3a and CsU3b promoters, which have strong transcriptional activity in CsU3, were selected. The pUC19-gRNAscaffold-terminator-35S-Cas9 vector was linearized with SpeI. Primers were designed using the NEBuilder website (https: / / nebuilder.neb.com / #! / ) to amplify the CsU3a+sgRNA-7 and CsU3b+sgRNA-7 fragments using CsU3-pDONR221 as a template. The CsU3a+sgRNA-7 and CsU3b+sgRNA-7 fragments were ligated into the digested pUC19-gRNA scaffold-terminator-35S-Cas9 vector via seamless cloning. The primer sequences are as follows: CsU3a+sgRNA-7_fwd (SEQ ID NO.18): AGTGCACGCATGCCCTAGGACTAGTACAAAAAATAGATATTTTCTTTCCTAG; CsU3a+sgRNA-7_rev (SEQ ID NO.19): TCTAGCTCTAAAACAGGCCTAGCTTGCTGAGTATCATAATATCCTTCACTGCTTGCGCTG; CsU3b+sgRNA-7_fwd (SEQ ID NO.20): AGTGCACGCATGCCCTAGGACTAGTACAAAAAAATATTATTTTCCACCTAAAAAAAC; CsU3b+sgRNA-7_rev (SEQ ID NO. 21): TCTAGCTCTAAAACAGGCCTAGCTTGCTGAGTATCATAATGCTCCTAATTGCTCACTCCG.
[0049] The constructed vector is pUC19-CRISPR / Cas9P35S -CsU3a / CsU3b-T7-CsPDX2.1, the vector structure diagram is as follows Figure 4 As shown in C.
[0050] (4) CsPDX2.1 gene editing result detection: Protoplasts were extracted from the tea variety 'Longjing 43' according to the Arabidopsis protoplast extraction method, and the constructed pUC19-CRISPR / Cas9P was used to extract the protoplasts. 35S -CsU3a / CsU3b-T7-CsPDX2.1 vector was used to transform tea plant protoplasts. To detect gene editing, genomic DNA was extracted from protoplasts using the CTAB method. The genomic DNA was digested with HindIII to screen for positive results. Then, the fragments near the CsPDX2.1 target site were amplified using the screened protoplast genomic DNA as a template. High-throughput sequencing revealed base mutations and base deletions at the target site. The results are as follows: Figure 5 shown.
[0051] (5) Selection of target genes and target sites for tobacco gene editing: Select the effective target reported in the article to construct the gene editing vector. The target sequence is as follows: sgRNA (SEQ ID NO. 22): GCCGTTAATTTGAGAGTCCAAGG.
[0052] (6) Construction of NbPDS gene editing vector: Construction of gRNA expression cassette by Overlapping PCR: First-round PCR: This step aims to introduce the target sequence downstream of the CsU3 promoter and upstream of the sgRNA sequence. The combinations are: CsU3a+gRNA, CsU3b+gRNA. Primers U#-T# and gR-T# used in this step must be designed individually.
[0053] Reaction 1: Amplification of CsU3a / CsU3b+gRNA The template was the pYLsgRNA-CsU3 vector, and the reaction system was the Novage high-fidelity enzyme 2×Phanta Max MasterMix (Dye Plus) enzyme PCR amplification system.
[0054] Reaction 2: Amplification of gRNA + gRNA scaffold The template was the pYLsgRNA-AtU3b vector, and the reaction system was the Novage high-fidelity enzyme 2×Phanta Max MasterMix (Dye Plus) enzyme PCR amplification system.
[0055] Primers used to amplify CsU3+gRNA: UF (SEQ ID NO. 23): CTCCGTTTTACCTGTGGAATCG; CsU3a-R (SEQ ID NO. 24): TGGACTCTCAAATTAACGGATCCTTCACTGCTTG; CsU3b-R (SEQ ID NO. 25): TGGACTCTCAAATTAACGGGCTCCTAATTGCTCA; Primers used to amplify gRNA+gRNA scaffold: gRs-F (SEQ ID NO. 26): CCGTTAATTTGAGAGTCCAGTTTTAGAGCTAGAAAT; gRs-R (SEQ ID NO. 27): CGGAGGAAAATTCCATCCAC.
[0056] Second-round PCR: This step aims to construct the complete expression cassette containing the promoter, target, and sgRNA. Select appropriate primer pairs based on the number of targets and pre-mix the universal primer pairs into a working solution (10 µmol / L each). Then, dilute 1 µL of each product from reaction 1 and reaction 2 in the first-round PCR by 10-fold in 8 µL of ddH2O. For the second-round PCR, use a 20-50 µL reaction volume for each expression cassette (50 µL for one target; 30 µL for two to three targets; 20 µL for four or more targets).
[0057] The template was a mixture of diluted reaction 1 and reaction 2 products, and the reaction system was the Novagen 2×Phanta MaxMaster Mix (Dye Plus) enzyme PCR amplification system.
[0058] Primer pairs used for amplification of CsU3a+gRNA+gRNA scaffold and CsU3b+gRNA+gRNA scaffold: Pps-R (SEQ ID NO. 28): TTCAGAGGTCTCTACCGACTAGTCACGCGTATGGAATCGGCAGCAAA; Pgs-L (SEQ ID NO. 29): AGCGTGGGTCTCGCTCGACGCGTATCCATCCACTCCAAGC.
[0059] Clone the gRNA expression cassette into pYLCRISPR / Cas9P 35s -H on the carrier: This step uses the Golden Gate method based on BsaⅠ digestion and ligation to assemble the gRNA expression cassette into the pYLCRISPR / Cas9 vector using the "cut and ligate" method.
[0060] Prepare a 15 µL reaction: 1.5 µL of 10× rCutSmart Buffer; 1.5 µL of 10× T4 DNA ligase buffer; 60-80 ng of pYLCRISPR / Cas9 plasmid; 10-15 ng of purified mixed gRNA expression cassettes (approximately 10 ng for one target; 20-30 ng for two targets; 40-50 ng for three targets; and 60-70 ng for four targets; for more targets, increase the amount of each gRNA expression cassette appropriately, up to 15 ng per expression cassette, for a molar ratio of vector to each insert of 1:4-6); 10 units of BsaI-HF; 35 units of T4 DNA ligase; and make up to 15 µL with ddH2O. Perform the cleavage-ligation reaction using a variable temperature cycler (37°C for 5 min, 10°C for 5 min, and 20°C for 5 min); and finally incubate at 37°C for 5 min.
[0061] The constructed vector is pYLCRISPR / Cas9P 35s -H-CsU3a / CsU3b-sgRNA-NbPDS, the vector structure diagram is as follows Figure 6 shown.
[0062] (7) NbPDS gene editing detection: The constructed pYLCRISPR / Cas9P 35s -H-CsU3a / CsU3b-sgRNA-NbPDS vectors were transformed into Agrobacterium strain GV3101 and injected into tobacco for transient expression via Agrobacterium-mediated method. The tobacco used was grown for 20-30 days. After culturing for 2 days, tobacco leaves were taken, ground and genomic DNA was extracted. The genomic DNA was digested with MlyI to screen for positive results. Then, the selected tobacco genomic DNA was used as a template to amplify the fragment near the NbPDS target site, ligated to the Blunt-zero vector, and transformed into Escherichia coli strain DH5α. Single clones were selected for sequencing, and base mutations, base insertions, and base deletions were found at the target site. The results are as follows: Figure 7 shown.
[0063] As can be seen, the present invention has obtained the RNA polymerase III type promoter of the tea plant U3 snRNA gene - the tea plant endogenous U3 promoters CsU3a, CsU3b, CsU3c, and CsU3d. These promoters have been verified to have transcriptional activity and are capable of initiating sgRNA transcription. This also marks the first application of the tea plant endogenous CsU3 promoter to the CRISPR / Cas9 system. Therefore, the promoter described in the present invention can be applied to the tea plant gene editing system and the tobacco plant gene editing system, thereby achieving efficient and precise creation of new tea germplasm and variety improvement, as well as efficient editing of the tobacco genome.
[0064] Although the specific embodiments of the present invention are described above, those skilled in the art should understand that the specific embodiments described are merely illustrative and are not intended to limit the scope of the present invention. Those skilled in the art may make several improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be regarded as within the scope protected by the claims of the present invention.
Claims
1. Tea tree CsU3 gene promoter, characterized in that It includes promoters CsU3a, CsU3b, CsU3c and CsU3d, the nucleotide sequence of CsU3a is shown as SEQ ID NO.1, the nucleotide sequence of CsU3b is shown as SEQ ID NO.2, the nucleotide sequence of CsU3c is shown as SEQ ID NO.3, and the nucleotide sequence of CsU3d is shown as SEQ ID NO.
4.
2. Use of the tea plant CsU3 gene promoter as claimed in claim 1 in the field of plant molecular breeding technology, wherein the plant is tea plant or tobacco.
3. A tea tree gene editing vector, characterized in that: The vector contains the tea plant CsU3 gene promoters CsU3a and CsU3b as claimed in claim 1.
4. A tea tree gene editing vector as claimed in claim 3, characterized in that: The tea tree gene editing vector is pUC19-CRISPR / Cas9P 35S -CsU3a / CsU3b-T7-CsPDX2.
1.
5. A method for constructing the tea tree gene editing vector according to claim 4, characterized in that: The tea plant CsU3a and CsU3b gene promoters described in claim 1 drive gRNA expression.
6. A method for genome editing of tea plants, characterized in that: Introduce the tea tree gene editing vector described in claim 3 or 4 into tea tree protoplasts.
7. Application of the tea tree gene editing vector as described in claim 3 or 4 in the field of tea tree molecular breeding technology.
8. A tobacco gene editing vector, characterized in that: The vector contains the tea plant CsU3a and CsU3b gene promoters as claimed in claim 1.
9. A tobacco gene editing vector according to claim 8, characterized in that: The tobacco gene editing vector is a recombinant plasmid pYLCRISPR / Cas9P 35s -H-CsU3a / CsU3b-sgRNA-NbPDS.
10. A method for constructing the tobacco and tea tree gene editing vector according to claim 9, characterized in that: The tea plant CsU3a and CsU3b gene promoters described in claim 1 drive gRNA expression.
11. A method for genome editing in tobacco, characterized in that: It comprises transferring the tobacco gene editing vector described in claim 8 or 9 into tobacco.
12. Use of a tobacco gene editing vector as described in claim 8 or 9 in the field of tobacco molecular breeding technology.
Citation Information
Patent Citations
Low-temperature induction-type promoter of tea tree
CN104232642A
Tea tree caffeine synthetase gene promoter TCSP and application thereof
CN106676111A
Donor design strategy for crispr-cas9 genome editing
CN114072498A
Tea tree CsU6 gene promoter and cloning and application thereof
CN115960899A
Construct system and uses therefor
EP2215269A1
Cited By
CRISPR (clustered regularly interspaced short palindromic repeats) gene activation system and method for increasing theanine content in tea tree by using CRISPR gene activation system
CN121320442A
Coconut U3 promoter and application thereof
CN121874193A
Coconut u3 promoter and use thereof
CN121874193B
Oil palm U3 promoter and application thereof
CN122060741A
A U3 promoter for oil palm and its application
CN122060741B