Method for improving recombinant secretory expression of aprotinin

By optimizing the codons of the fusion protein-encoding gene of the aprotinin encoding gene and the fusion protein-encoding gene of the PeIB signal peptide and the aprotinin, the problems of low yield and insufficient activity of recombinant aprotinin were solved, and efficient expression and enhanced enzyme activity were achieved, which was suitable for the needs of clinical dosage.

CN120060269APending Publication Date: 2025-05-30HANGZHOU HUNYI BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311636744.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-11-30
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

In the prior art, the yield of recombinant aprotinin is very low, and the mismatch of disulfide bonds leads to low protein activity, making it difficult to meet the clinical dosage requirements.

Method used

Codon optimization is performed by optimizing the codons of the aprotinin-encoding gene and the fusion protein-encoding gene of the PeIB signal peptide and the antibacterial peptide, so that the expression of recombinant proteins in the periplasmic space of E. coli is greatly increased and the enzyme activity is improved.

Benefits of technology

The efficient expression of recombinant aprotinin and the enhancement of enzyme activity have been achieved, with the expression amount reaching more than 90%, and the enzyme activity has been significantly improved. It is suitable for recombinant preparation of aprotinin or products containing aprotinin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060269A_ABST
    Figure CN120060269A_ABST
Patent Text Reader

Abstract

The invention discloses a method for improving recombinant secretory expression of aprotinin, which effectively promotes expression and secretion of recombinant protein to periplasmic space of escherichia coli by optimizing fusion protein coding gene of pelB signal peptide and antibacterial peptide, and improves the correct folding rate of target protein while improving the expression quantity so as to improve the enzymatic activity of the target protein. The method can be applied to recombinant preparation of aprotinin or aprotinin-containing products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to a method for improving the recombinant secretory expression of aprotinin. Background Art

[0002] Aprotinin (BPTI), also known as aprotinin, is a competitive, reversible serine protease inhibitor that forms stable complexes with serine proteases and blocks the enzyme's active site. Aprotinin has a broad substrate spectrum, inhibiting the activity of multiple serine proteases, such as chymotrypsin, trypsin, kallikrein, and plasmin. By inhibiting kallikrein and plasmin, aprotinin inhibits wound embolism and thus significantly reduces bleeding during and after surgery. Approved by the FDA in 1993, aprotinin is indicated for thoracic surgery and for the treatment of patients with coagulopathy who are at risk of severe bleeding.

[0003] Aprotinin is a single-chain basic polypeptide consisting of 58 residues comprising 16 amino acids. Its primary and secondary structures have been elucidated. The molecule has three pairs of disulfide bonds, forming a pear-shaped structure with a lysine active center located at its apex. Aprotinin is an important biochemical drug with extensive clinical use. Currently, commercially available aprotinin is primarily extracted from tissues such as bovine lung, resulting in complex production processes and high manufacturing costs. In particular, the discovery of several pathogens in animals in recent years may pose safety risks to the clinical use of tissue-derived aprotinin. Therefore, the use of genetically recombinant methods to produce aprotinin holds great promise.

[0004] Genetic engineering methods for producing aprotinin have been reported both domestically and internationally, but the results have been unsatisfactory. The primary challenge is the low yield of recombinant aprotinin. Cara Berman et al. produced active aprotinin using a secretory expression system, but the yield was extremely low, reaching only 75 μg per liter of culture medium. B. Nilsson and C. Berman-Marks et al. attempted to improve secretory expression by fusing various signal peptides, but without success. They believe that aprotinin folding and secretion are competing processes, with intracellular folding inhibiting secretion and leading to intracellular degradation of the majority of the expressed aprotinin product. Related research indicates that disulfide mispairing is a key factor in the low expression of multi-disulfide bond proteins when expressed intracellularly. Aprotinin contains three disulfide bonds and is typically expressed as inclusion bodies in recombinant E. coli. Disulfide mispairing is also highly likely to occur during in vitro renaturation, resulting in low activity of the resulting aprotinin product. Summary of the Invention

[0005] To address the above-mentioned issues, the present invention provides an optimized aprotinin-encoding gene and an optimized aprotinin-PeIB signal peptide fusion gene. Currently, the pelB signal peptide has been used to promote the secretory expression of recombinant proteins. However, studies have found that simple heterologous expression of aprotinin or a fusion protein of the pelB signal peptide and aprotinin results in very limited recombinant protein yields, often requiring molecular engineering to further enhance expression and improve the correct folding rate of the target protein, thereby increasing its enzymatic activity. To address the above-mentioned issues, the present invention does not perform codon optimization of the aprotinin-encoding gene and the gene encoding the fusion protein of the pelB signal peptide and aprotinin according to the conventional codon usage preference of Escherichia coli. Instead, it provides an optimized aprotinin-encoding gene and an optimized aprotinin-PeIB signal peptide fusion gene.

[0006] The sequence of the aprotinin encoding gene is shown in SEQ ID NO: 1.

[0007] The sequence of the aprotinin and PeIB signal peptide fusion gene is shown in SEQ ID NO.2.

[0008] The present invention also provides a recombinant expression vector or a recombinant bacterium containing the gene shown in SEQ ID NO: 1 or SEQ ID NO. 2.

[0009] In a preferred technical solution, the recombinant expression vector is one of plasmids pET28a, pET32a and pET39a; the recombinant bacteria is one of Escherichia coli BL21 (DE3), Rosetta (DE3), BSR (DE3) and Shuffle T7.

[0010] In a further preferred technical solution, the recombinant bacteria are obtained by transforming Escherichia coli with a recombinant expression plasmid.

[0011] The invention relates to the use of the recombinant expression vector or recombinant bacteria in the preparation of aprotinin or a product containing aprotinin.

[0012] Many factors affect the expression of exogenous genes, one of the most important being codon preference. Due to codon degeneracy, the same amino acid can be encoded by different codons, resulting in codon preferences across species. The present invention does not optimize the codons of the aprotinin-encoding gene and the gene encoding the fusion protein of the pelB signal peptide and aprotinin according to the conventional codon usage preference of E. coli. Furthermore, the codon optimization does not alter the encoded amino acids, i.e., the protein sequence, as shown in SEQ ID NO. 3 and SEQ ID NO. 4. This significantly increases the expression level of the recombinant protein in the periplasmic space of E. coli, and the enzymatic activity of the recombinant protein is also very high, making it suitable for the recombinant preparation of aprotinin or aprotinin-containing products.

[0013] Attachment Figure 1 SDS-PAGE gel electrophoresis verified the expression of the target protein after codon optimization: lane 1 is the precipitate sample after bacterial disruption, lane 2 is the supernatant sample after bacterial disruption, and the target protein is in the box. According to the grayscale ratio of the electrophoresis graph, the soluble expression of the target protein accounts for more than 90% of the total expression.

[0014] Attachment Figure 2 SDS-PAGE gel electrophoresis verified the expression of the target protein before codon optimization: lane 1 is the precipitate sample after bacterial disruption, lane 2 is the supernatant sample after bacterial disruption, and the target protein is in the box. According to the grayscale ratio of the electrophoresis graph, the target protein is mostly expressed intracellularly in the form of inclusion bodies. Example

[0015] Example 1 Construction, expression and detection of recombinant engineering bacteria

[0016] 1. Construction of recombinant plasmid

[0017] PCR amplification of the PeIB signal peptide sequence;

[0018] Design primers 5'→3' as follows:

[0019] PeIB-F:gcgcggcagccatATGAAATATTTACTA

[0020] PeIB-R: GAAATCTGGTCTCGCCATTGCCGGC

[0021] PCR amplification of BPTI sequence;

[0022] Design primers 5'→3' as follows:

[0023] BPTI-F:CCGGCAATGGCGAGACCAGATTTCTGTTTG

[0024] BPTI-R:gtgcggccgcaagcttAGCACCACCACA

[0025] Using steps (1) and (2) as templates, homology arms were designed to connect the PeIB signal peptide sequence and BPTI sequence via homologous recombination. The pET-28 plasmid was linearized by double digestion with restriction endonucleases NdeI and HindIII, and then purified and recovered. The PCR product and the linearized plasmid were ligated using a one-step cloning method to construct the recombinant plasmid pET-28a-PeIB-BPTI.

[0026] 2. Transformation and Expression of Recombinant Plasmid

[0027] Take 100 μL of thawed BL21(DE3) competent cells on ice, add the target plasmid, mix gently, and let it rest on ice for 30 minutes. Heat shock the cells in a 42°C water bath for 45-60 seconds, quickly transfer to an ice bath, and let it rest for 2 minutes. Add 700 μL of sterile liquid LB medium without antibiotics to a centrifuge tube, mix thoroughly, and resuspend the cells at 37°C, 200 rpm, for 60 minutes. Pipette the resuscitation solution and evenly spread it onto a plate of LB medium containing kanamycin resistance. Place the plate upside down in a 37°C incubator and incubate overnight.

[0028] Pick a single colony from the above LB agarose solid medium plate and inoculate it into 50 mL LB culture medium (containing 0.1 M of the corresponding antibiotic). Culture at 37°C and 200 rpm until OD 600 The value reaches 1.0-1.2;

[0029] Take 10 mL of the above bacterial solution and inoculate it into the basic culture medium, and culture it at 37℃ and 200 rpm until the OD 600 The value is 0.6-0.8. Prepare basic culture medium: (NH 4)2 SO4 7g, Na2HPO4 5.25g, KH2PO4 1.6g, (NH4)2-H-Citrate 0.5g, Glycerol 3.97mL, MgSO4·7H2O 0.25g, Micronutrients 1mL, each 1L of basic culture medium contains 0.1M of the corresponding antibiotics.

[0030] Cool the culture medium to below 22°C in an ice bath, add 0.5 mM IPTG to induce protein expression, and induce expression overnight at 22°C and 180 rpm. After 12-24 hours of induction, centrifuge at 6500 rpm at 4°C for 20 minutes and discard the culture medium.

[0031] Add cell lysis buffer at a ratio of 1 g cells to 10 mL buffer and stir manually until no lumps or flocculent precipitates are observed. Disrupt cells using a high-pressure disruptor at 800 Pa at 4°C until the lysate becomes clear. Centrifuge the disrupted mixture at 16,000 rpm / min at 4°C for 1 hour until cell debris has completely settled at the bottom of the tube. Collect the supernatant.

[0032] SDS-PAGE gel electrophoresis was used to verify the expression of the target protein. The expression results are shown in the attached Figure 1 Lane 1 is the precipitate sample after bacterial disruption, lane 2 is the supernatant sample after bacterial disruption, the target protein is in the box, and according to the grayscale ratio of the electrophoresis graph, the soluble expression of the target protein accounts for more than 90% of the total expression.

[0033] Example 2 Detection of the secretory expression of aprotinin

[0034] The supernatant was washed with Ni 2+ The BPTI enzyme solution was obtained by preliminary purification by affinity chromatography (Toyopearl AF-Chelate-650M, self-filled 1.25 cm×8 cm, total 15 mL) and fine purification by gel retardation chromatography (Hiload 16 / 200 Superdex 200 pg, GE Healthcare; 120 mL).

[0035] According to the method of the Chinese Pharmacopoeia 2005 edition, aprotinin is used to inhibit the hydrolysis of trypsin substrate (N-benzoyl-L-arginine ethyl ester, BAEE), and the activity is determined by the change in absorbance at 253nm. According to the method of determining trypsin inhibitor activity by Nagashima et al., the activity of trypsin inhibitor (aprotinin) can be defined as: using BAEE as substrate, the reaction solution is at pH 7.2, 25℃, the reaction volume is 3.0ml, and the optical path is 1cm. 253 nm, OD per minute 253 An increase of 0.001 in nm is one BAEE unit of trypsin, and the BAEE unit of trypsin inhibition per minute is one unit of aprotinin activity. The activity of the target protease before optimization was 207 BAEEU·ml -1 The protein expression level was 2.14 mg·L -1 After optimization, the expression activity of the target protein reached 1344BAEEU·ml -1 The protein expression level was 15.7 mg·L -1 Compared with intracellular expression, the expression level of the target protein is significantly improved, thereby achieving a significant improvement in the catalytic capacity per unit fermentation liquid.

[0036] Example 3 Verification of the effect of recombinant expression of non-optimized codon sequences

[0037] The optimized pro-aprotinin nucleotide sequence SEQ ID NO.5 is as follows:

[0038] AGACCAGATTTCTGTTTGGAACCACCTTATACTGGTCCTTGTAGAGCTAGAATTATTAGATATTTCTACAACGCTAAGGCTGGTTTGTGTCAAACTTTCGTTTATGGTGGTTGTAGAGCTAAGAGAAATAACTTCAAATCTGCTGAAGATTGTATGAGAACTTGTGGTGGTGCT

[0039] The optimized nucleotide sequence of the fusion protein of proprotinin and PeIB signal peptide, SEQ ID NO.6, is as follows:

[0040] ATGAAATATTTACTACCCACAGCAGCTGCGGGTCTGTTGCTGCTGGCTGCGCAGCCGGCAATGGCGAGACCAGATTTCTGTTTGGAACCACCTTATACTGGTCCTTGTAGAGCTAGAATTATTAGATATTTCTACAACGCTAAGGCTGGTTTGTGTCAAACTTTCGTTTATGGTGGTTGTAGAGCTAAGAGAAATAACTTCAAATCTGCTGAAGATTGTATGAGAACTTGTGGTGGTGCT

[0041] The optimized pro-aprotinin and PeIB signal peptide fusion protein nucleotide sequence was recombinantly expressed using the same method and steps as in Example 1. The expression of the target protein was verified by SDS-PAGE gel electrophoresis. The expression results are shown in the attached Figure 2 Lane 1 is the precipitate sample after bacterial disruption, lane 2 is the supernatant sample after bacterial disruption, the target protein is in the box. According to the grayscale ratio of the electrophoresis graph, the target protein is mostly expressed in the form of inclusion bodies in the cell.

Claims

1. An aprotinin-encoding gene, the sequence of which is shown in SEQ ID NO:

1.

2. A polynucleotide sequence having more than 90% sequence identity with the nucleotide sequence shown in claim 1 and encoding the same or similar polypeptide fragment.

3. A fusion gene of aprotinin and PeIB signal peptide, the sequence of which is shown in SEQ ID NO.

2.

4. A polypeptide fragment having more than 90% sequence identity with the amino acid sequence shown in claim 3 and having the same or similar polypeptide fragment function.

5. A recombinant expression vector or recombinant bacterium containing any one of the genes described in claims 1 to 4.

6. The recombinant expression vector or recombinant bacterium according to claim 5, characterized in that, the expression vector is one of plasmids pET28a, pET32a and pET39a; the recombinant bacterium is one of Escherichia coli BL21(DE3), Rosetta(DE3), BSR(DE3) and Shuffle T7.

7. The recombinant bacterium according to claim 6, characterized in that, the recombinant bacterium is obtained by transforming Escherichia coli with a recombinant expression plasmid.

8. Use of the aprotinin-encoding gene according to any one of claims 1-2 and the fusion gene of aprotinin and PeIB signal peptide according to any one of claims 3-4 in the preparation of aprotinin or a product containing aprotinin.

9. Use of the recombinant expression vector or recombinant bacterium according to any one of claims 5-7 in the preparation of aprotinin or a product containing aprotinin.