A sugarcane fusarium pathogenicity related gene fsypta and its application and knockout method

By knocking out the pathogenicity-related gene FsyptA of Fusarium canis using homologous recombination, the problems of genomic complexity and low genetic transformation efficiency in sugarcane gene editing were solved, thereby reducing the pathogenicity of Fusarium canis and controlling the disease.

CN120060284BActive Publication Date: 2026-04-24GUANGXI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510219611.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-26
Publication Date
2026-04-24
Estimated Expiration
2045-02-26

AI Technical Summary

Technical Problem

Sugarcane gene editing technology suffers from problems such as complex genomes, low genetic transformation efficiency, non-specific gene knockout, and off-target effects, which affect sugarcane growth, development, and yield traits.

Method used

By designing a homologous recombination method for the pathogenicity-related gene FsyptA in Fusarium canis, and utilizing the fusion fragment of the left homologous arm sequence, the right homologous arm sequence, and the hygromycin resistance gene sequence, protoplast transformation was performed to knock out the FsyptA gene in Fusarium canis, thereby reducing its pathogenicity.

Benefits of technology

This study reduced the mycelial growth rate and sporulation of Fusarium canis, significantly weakened the pathogenicity of sugarcane top rot, and provided a target and method for the prevention and control of Fusarium canis diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060284B_ABST
    Figure CN120060284B_ABST
Patent Text Reader

Abstract

The present application relates to the field of agricultural product quality and safety and genetic engineering technology, in particular to a sugarcane fusarium pathogenicity related gene FsyptA and its application and knockout method. The present application provides a sugarcane fusarium pathogenicity related gene FsyptA, the nucleotide sequence of the sugarcane fusarium pathogenicity related gene FsyptA is shown as SEQ ID No. 1. The present application provides a new pathogenicity related gene FsyptA of fusarium causing sugarcane top rot, which can be used for disease control. The present application provides a regulatory target point related to sugarcane top rot pathogenesis, and the FsyptA gene can be used as a knockout target point for inhibiting sugarcane fungal diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of agricultural product quality and safety and genetic engineering technology, and in particular to a pathogenicity-related gene FsyptA of Fusarium oxysporum, its application, and a knockout method. Background Technology

[0002] Sugarcane, as an important economic crop, is a major source of raw materials for the global sugar and bioenergy industries. Its high yield, high sugar content, and stress resistance directly determine its economic value. In recent years, with the rapid development of gene-editing technology, scientists have begun to explore its application to the genetic improvement of sugarcane, aiming to increase yield, sugar content, and stress resistance through precise gene manipulation. However, the field of sugarcane gene editing still faces many technical challenges. First, sugarcane is a perennial crop with a complex and large genome, making it particularly difficult to accurately locate target genes and edit them effectively. Second, the genetic transformation efficiency of sugarcane is relatively low, and the growth cycle of regenerated plants is long, which limits the widespread application of gene-editing technology in sugarcane.

[0003] Furthermore, ensuring the specificity of gene knockout and avoiding off-target effects, as well as assessing the impact of gene knockout on sugarcane growth, development, and yield traits, are all pressing issues that need to be addressed. This invention utilizes advanced gene-editing tools such as homologous recombination to precisely knock out specific genes in sugarcane. By optimizing the design of gene-editing vectors, improving genetic transformation efficiency, and establishing an efficient gene-editing screening system, this invention aims to achieve efficient and specific knockout of target genes in sugarcane and to assess the impact of gene knockout on sugarcane growth, development, and pathogenicity. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides the pathogenicity-related gene FsyptA from Fusarium canaliculata, its application, and a knockout method. This invention obtains a genetically engineered knockout strain △FsyptA by knocking out the FsyptA gene from the Fusarium canaliculata genome. Compared to the wild-type strain, the genetically engineered strain exhibits reduced growth rate and microconidia production, resulting in decreased pathogenicity.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] This invention provides a pathogenicity-related gene FsyptA from Fusarium canis, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0007] This invention also provides the application of knocking out or silencing the pathogenicity-related gene FsyptA of Fusarium canis as described in the above-mentioned technical solutions in reducing the pathogenicity of Fusarium canis.

[0008] This invention also provides the application of knocking out or silencing the pathogenicity-related gene FsyptA of Fusarium canis described in the above-mentioned technical solutions in reducing the mycelial growth rate of Fusarium canis.

[0009] This invention also provides the application of knocking out or silencing the pathogenicity-related gene FsyptA of Fusarium canis described in the above-mentioned technical solutions in reducing the sporulation yield of Fusarium canis.

[0010] This invention also provides the application of the pathogenicity-related gene FsyptA of Fusarium canis described in the above technical solution as an inhibition target or knockout target in the prevention and control of sugarcane top rot caused by Fusarium canis.

[0011] This invention also provides a method for knocking out the pathogenicity-related gene FsyptA in Fusarium canis as described in the above-mentioned technical solution, comprising the following steps:

[0012] 1) The left homologous arm sequence, right homologous arm sequence, and hygromycin resistance gene sequence of the pathogenicity-related gene FsyptA of Fusarium canis were fused to obtain a fusion fragment;

[0013] The nucleotide sequence of the left homologous arm of the pathogenicity-related gene FsyptA of Fusarium canis is shown in SEQ ID No. 2, and the nucleotide sequence of the right homologous arm is shown in SEQ ID No. 3.

[0014] The nucleotide sequence of the hygromycin resistance gene sequence is shown in SEQ ID No. 4;

[0015] The nucleotide sequence of the fusion fragment is shown in SEQ ID No. 5;

[0016] 2) The fusion fragment obtained in step 1) is transformed into the protoplasts of Fusarium canaliculi using the protoplast transformation method, and the pathogenicity-related gene FsyptA in Fusarium canaliculi is knocked out.

[0017] Preferably, in step 1), the molar ratio of the left homologous arm sequence, the right homologous arm sequence, and the hygromycin resistance gene sequence of the Fusarium moniliforme pathogenicity-related gene FsyptA is 1:3:1.

[0018] Preferably, the total concentration of the left homologous arm sequence, the right homologous arm sequence, and the hygromycin resistance gene sequence in the fusion system of step 1) is 1000 ng / μL.

[0019] Preferably, the fusion method in step 1) includes PEG-mediated protoplast fusion.

[0020] Preferably, in step 2), the ratio of the mass of the fusion fragment to the volume of the protoplast solution during the protoplast transformation method is 2 μg: 125 μL.

[0021] The beneficial effects of this invention are:

[0022] 1. This invention provides a novel pathogenicity-related gene FsyptA of Fusarium wilt that causes sugarcane top rot, which can be used for disease control.

[0023] 2. This invention provides a regulatory target related to the pathogenesis of sugarcane top rot, and the FsyptA gene can be used as a knockout target to inhibit sugarcane fungal diseases. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0025] Figure 1 This diagram illustrates homologous recombination and primer positions.

[0026] Figure 2 Electrophoresis diagrams for identifying FsyptA knockout mutant strains: A is the yptA / OF and yptA / OR primers used to identify the presence of the target gene; B is the yptA / AF, p816 / R and yptA / BR, p625 / F primers used to identify whether homologous recombination has occurred.

[0027] Figure 3 Electrophoresis image for RT-PCR identification;

[0028] Figure 4 A shows the colony morphology of wild-type Fusarium canis strains CNO-1 and ΔFsyptA on PDA, MEA, and Czapek's medium; B shows the change in colony diameter of wild-type strains CNO-1 and ΔFsyptA after 5 days of growth on PDA.

[0029] Figure 5 The aerial hyphae of wild-type CNO-1(A) and ΔFsyptA(B) were observed under a microscope.

[0030] Figure 6 Hydrophobicity test of wild-type CNO-1 and ΔFsyptA;

[0031] Figure 7 This is a live inoculation experiment of sugarcane. A is the front of the leaf, B is the back of the leaf, and from left to right are WT, ΔFsyptA, and CK. Detailed Implementation

[0032] This invention provides a pathogenicity-related gene FsyptA from Fusarium spp., the nucleotide sequence of which is shown in SEQ ID No. 1, as follows:

[0033] ATGTCGTCGCTCGAAGCCAAGATCGTCGTCCTCGGCGCCCAGGGCGTTGGGAAGACGTCTCTGGTTATGAGATACTGCAAGGGCGCATTCAACCCGGCTCAGATCACTTCTACCGTCGGTGCCAGCTTTCTCACAAAGCGCGTCGTTGACTCTGACTCCGATACCGTTGTGCGCCTTCAGATATGGGATACAGGTCGGTTTTGATAAGGAGCCAAACAAGTTTATATTCGCTTATGTACTGACGCCAACTCGCAGCCGGCCAAGAACGCTTTCGTTCCATCTCACGCCTGTACTACCGTGGTGCAAACGCCTGCATTCTCTGCTACAGCATCACAGACGCACAGTCATTCGCCGACATGGGTGTATGGCTCATGGAACTTCGACGAAACCTCCCTCACGATGTCGTTCTTCACGTAGTCGGTACAAAAGCCGACATTGTCGCCCGCGATCCCTCAGCCCGCCAGGTCCCATTCGAACGTTGTATCGCATACGTCGCTGAGAACCTCGCCCCAGGCATGGGCAGCACGCCGCCTCCAACCGCAACCCCTTACCACATACCGACGCCTATGTCAGGTGGCCAGGCAATGTCCCCTCCATCTATGGAGCCTCGGAGCCCCAGCTCGAAGCGAAGCTCTGGTTTCTGGGCACAGGAAGTTGGCTGGGATGCTTGTCATGAAATCAGCGCCGAAACAGGAGAGGGTGTCGAGGAAGTCTTTCGTGTTGTCACACGGAAGCTTGTTGAGCAGAACCGCAAGATGCAGCAGGCCCTTCTAATGGCCACAGCCATACCTGGTACGCCAGGTTACGAAGCCGGCATGGACGGAGGCTATTTTGCAGGTGCAGACGCACGAGGGAGTT TCCGAGTAGGCCGCGATCGTCGAAGTTGGCTCTTCTCGCCAGGTTTCTCGCCCGCCGTCACGGTCGAGCAGGCGGGAACCCAGGAGCAGACACAAGCAGACGGTTGGGATCGAAAAGAGCGCAAGAAGTGCTGTTGA。

[0034] This invention also provides the application of knocking out or silencing the pathogenicity-related gene FsyptA of Fusarium canis as described in the above-mentioned technical solutions in reducing the pathogenicity of Fusarium canis.

[0035] This invention also provides the application of knocking out or silencing the pathogenicity-related gene FsyptA of Fusarium canis described in the above-mentioned technical solutions in reducing the mycelial growth rate of Fusarium canis.

[0036] This invention also provides the application of knocking out or silencing the pathogenicity-related gene FsyptA of Fusarium canis described in the above-mentioned technical solutions in reducing the sporulation yield of Fusarium canis.

[0037] This invention also provides the application of the pathogenicity-related gene FsyptA of Fusarium canis described in the above technical solution as an inhibition target or knockout target in the prevention and control of sugarcane top rot caused by Fusarium canis.

[0038] This invention also provides a method for knocking out the pathogenicity-related gene FsyptA in Fusarium canis as described in the above-mentioned technical solution, comprising the following steps:

[0039] 1) The left homologous arm sequence, right homologous arm sequence, and hygromycin resistance gene sequence of the pathogenicity-related gene FsyptA of Fusarium canis were fused to obtain a fusion fragment;

[0040] The nucleotide sequence of the left homologous arm of the pathogenicity-related gene FsyptA of Fusarium canis is shown in SEQ ID No. 2, and the nucleotide sequence of the right homologous arm is shown in SEQ ID No. 3.

[0041] The nucleotide sequence of the hygromycin resistance gene sequence is shown in SEQ ID No. 4;

[0042] The nucleotide sequence of the fusion fragment is shown in SEQ ID No. 5;

[0043] 2) The fusion fragment obtained in step 1) is transformed into the protoplasts of Fusarium canaliculi using the protoplast transformation method, and the pathogenicity-related gene FsyptA in Fusarium canaliculi is knocked out.

[0044] In this invention, the left and right homologous arm sequences of the Fusarium spp. pathogenicity-related gene FsyptA and the hygromycin resistance gene sequence are fused to obtain a fusion fragment; the nucleotide sequence of the left homologous arm sequence of the Fusarium spp. pathogenicity-related gene FsyptA is shown in SEQ ID No. 2, the nucleotide sequence of the right homologous arm sequence is shown in SEQ ID No. 3; the nucleotide sequence of the hygromycin resistance gene sequence is shown in SEQ ID No. 4; and the nucleotide sequence of the fusion fragment is shown in SEQ ID No. 5.

[0045] SEQ ID No. 2:

[0046] GATGGAAATGACGTAGAGGATGTCTTTCTAGAGGATCCCCGGGTACGATTATTGGTGATGGTCGCGTC;

[0047] SEQ ID No. 3:

[0048] ATATCATCTTCTGTCGACCTGCAGGTTTTCTTGATTGCCGATACGAAACTAGCGTAGTCGAATGAAGGCGTA;

[0049] SEQ ID No.4:

[0050] CGGTACCCGGGGATCCTCTAGCCTGCAGGTCGACAGAAGA;

[0051] SEQ ID No. 5:

[0052] GATGGAAATGACGTAGAGGATGTCTTTCTAGAGGATCCCCGGGTACGATTATTGGTGATGGTCGCGTCCGGTACCCGGGGATCCTCTAGCCTGCAGGTCGACAGAAGAATATCATCTTCTGTCGACCTGCAGGTTTTCTTGATTGCCGATACGAAACTAGCGTAGTCGAATGAAGGCGTA.

[0053] In this invention, the molar ratio of the left homologous arm sequence, the right homologous arm sequence, and the hygromycin resistance gene sequence of the *Fusarium solani* pathogenicity-related gene *FsyptA* is preferably 1:3:1. In this invention, the total concentration of the left homologous arm sequence, the right homologous arm sequence, and the hygromycin resistance gene sequence in the fusion system is preferably 1000 ng / μL. In this invention, the fusion method preferably includes PEG-mediated protoplast fusion.

[0054] This invention transforms the obtained fusion fragment into protoplasts of *Fusarium canis* using a protoplast transformation method, thereby knocking out the pathogenicity-related gene *FsyptA* in *Fusarium canis*. In this invention, the preferred mass ratio of the fusion fragment to the protoplast solution during the protoplast transformation method is 2 μg:125 μL. This invention does not impose any special limitations on other conditions of the protoplast transformation method; conventional methods are acceptable. In this invention, the preferred concentration of protoplasts in the protoplast solution is 1 × 10⁻⁶. 7 / ml. This invention does not specifically limit the preparation method of the *Fusarium spp.* protoplasts; those skilled in the art can use conventional methods.

[0055] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0056] Example 1

[0057] Construction of the yptA knockout mutant strain (ΔFsyptA):

[0058] 1. Homologous recombination

[0059] (1) Extraction of genomic DNA from wild-type Fusarium canis CNO-1: After shaking wild-type strain CNO-1 with PDW for two days, mycelia were collected and genomic DNA was extracted using the SDS method.

[0060] Using total DNA from wild-type strain CNO-1 as a template, primers were designed based on the location of the target gene (FsyptA gene, SEQ ID No. 1) on the chromosome. A method involving knocking out the target gene fragment and protoplast transformation mediated by polyethylene glycol (PEG) was employed. Figure 1 The knockout mutant ΔFsyptA was obtained.

[0061] (2) First round of PCR: The target gene and its upstream and downstream 1000bp sequences were cloned using primers yptA / AF and yptA / BR. Then, the left and right 1000bp sequences were cloned using yptA / AF, yptA / AR, yptA / BF, and yptA / BR. The vector containing the hygromycin gene fragment was transformed into E. coli, and the plasmid was extracted using the Tiangen plasmid mini-prep kit. The hygromycin resistance gene HYG (SEQ ID No. 4) (Hyg / F and Hyg / R) was then cloned. The PCR products were purified using the Tiangen universal DNA purification and recovery kit.

[0062] The nucleotide sequence of the upstream sequence of the FsyptA gene is shown in SEQ ID No. 6:

[0063] GATGGAAATGACGTAGAGGATGTCTTTCTAGAGGATCCCCGGGTACGATTATTGGTGATGGTCGCGTC;

[0064] The nucleotide sequence of the downstream sequence of the FsyptA gene is shown in SEQ ID No. 7:

[0065] ATATCATCTTCTGTCGACCTGCAGGTTTTCTTGATTGCCGATACGAAACTAGCGTAGTCGAATGAAGGCGTA.

[0066] (3) Second round PCR: The volume to be added was calculated based on the molar mass ratio of left arm: hygromycin fragment: right arm = 1:3:1, and the final DNA concentration in the fusion system was 1000 ng·μL. -1 The fusion conditions were: 95℃ for 3 min; 95℃ for 15 s, 56℃ for 2 min, 72℃ for 1 min 10 s, 72℃ for 5 min, repeated 15 times, resulting in a fusion fragment of approximately 4145 bp (SEQ ID No. 5).

[0067] The fusion PCR product was diluted 2-fold and used as a nested PCR template. After amplification, the PCR product was subjected to 1% agarose gel electrophoresis. The fusion fragment was extracted and recovered by cutting the gel at the molecular weight position and concentrated to 10 μL. The concentration of the fusion fragment was not less than 2 μg and was used for protoplast transformation.

[0068] Primers used for cloning homologous recombination fragments

[0069] Primer name Sequence(5’-3’) yptA / AF SEQ ID No.8:GATGGAAATGACGTAGAGGATG yptA / AR SEQ ID No.:9:TCTTTCTAGAGGATCCCCGGGTACGATTATTGGTGATGGTCGCGTC yptA / BF SEQ ID No.10:ATATCATCTTCTGTCGACCTGCAGGTTTTCTTGATTGCCGATACGAAACTA yptA / BR SEQ ID No.11:GCGTAGTCGAATGAAGGCGTA yptA / OF SEQ ID No.12:TCCATCTCACGCCTGTACTACCG yptA / OR SEQ ID No.13:TGACAAGCATCCCAGCCAACTTC Hyg / F SEQ ID No.14:CGGTACCCGGGGATCCTCTA Hyg / R SEQ ID No.15:GCCTGCAGGTCGACAGAAGA P816 / R SEQ ID No.16:ATGGCTGTGTAGAAGTACTCGCC P625 / F SEQ ID No.17:CTGAATTCCCCAATGTCAAGCACT

[0070] 2. Preparation of protoplasts:

[0071] (1) The wild-type strain was cultured in a PDW at 28°C for two days. After collecting the bacterial cells, it was treated with 1.2 mol·L⁻¹. -1 Wash with KCl solution until clear. Place the obtained mycelia in an enzymatic digestion solution containing 0.5 g (0.05 g / mol) lysozyme and 0.1 g (0.01 g / mol) lysis enzyme at 28°C and 60 rpm for 3 h. Filter incompletely lysed mycelia through 6 layers of lens paper, then wash thoroughly with KCl solution. Centrifuge at 4°C and 4000 rpm for 10 minutes, discard the supernatant, wash again, centrifuge at 4°C and 4000 rpm for 5 minutes, discard the supernatant, resuspend the precipitated protoplasts in 500 μL of STC buffer, and add 250 μL of PTC solution.

[0072] 3. Transformation of protoplasts

[0073] Add 2 μg of the fusion fragment to 125 μL to achieve a concentration of 1×10⁻⁶.7 In a protoplast solution of 1 protoplast per ml, chill on ice for 30 minutes. Gently add 1 mL of PTC solution, mix well by pipetting, and incubate at 28°C. Centrifuge at 8000 rpm for 5 minutes at 4°C, discard the supernatant, add 500 μL of STC to resuspend the precipitate, centrifuge for 1 minute, and discard the supernatant. Add 510 μL of STC, mix gently by pipetting, and quickly add 15 mL of TB3 regeneration medium incubated at 48°C for 3 hours. Incubate for 16-18 hours. Introduce the cultured TB3 at 65°C with 100 μg / mL PTC solution. -1 Mix the hygromycin B PDA medium at a certain concentration, allow it to solidify, and incubate at 28°C. Observe the growth of transformants.

[0074] 4. Identification of positive transformants

[0075] Transfectants were transferred to 50 μg·mL⁻¹ -1 Resistance selection was performed on hygromycin B PDA plates. DNA was extracted from wild-type *Fusarium canis* CNO-1 and the selected transformants using the SDS-PAGE method. Three pairs of specific primers were used to identify positive transformants. Two primer pairs, yptA / AF, P816 / R and yptA / BR, P625 / F, detected whether the target gene was knocked out and homologous recombination occurred; yptA / OF and yptA / OR were used to identify the presence of the target gene. The final electrophoresis image of the identified positive transformants is shown below. Figure 2 As shown, A represents the verification of yptA / OF and yptA / OR primers. △FsyptA lane has no band, and the fragment size of wild-type CNO-1 strain is approximately 377bp, consistent with the gene deletion result, indicating that the FsyptA gene deletion mutant was successfully constructed.

[0076] The strains that were successfully tested for homologous recombination were transferred to PDA plates for further subculture.

[0077] Table 2 Primers used for positive transformant identification

[0078] Primer name Sequence(5’-3’) yptA / AF GATGGAAATGACGTAGAGGATG yptA / BR GCGTAGTCGAATGAAGGCGTA yptA / OF TCCATCTCACGCCTGTACTACCG yptA / OR TGACAAGCATCCCAGCCAACTTC P816 / R ATGGCTGTGTAGAAGTACTCGCC P625 / F CTGAATTCCCCAATGTCAAGCACT

[0079] 5. RT-PCR verification of the FsyptA gene knockout strain

[0080] The gene deletion mutant was further validated by RT-PCR, and the feasibility of using 18sF / R as an internal reference gene to detect ΔFsVps54 and wild-type RNA was determined.

[0081] RT-PCR reaction system: Dilute cDNA 5-fold and take 1 μL, add 7 μL of 2×Rapid Taq Master Mix, and yptA / OF (2 μmol·L⁻¹). -1 ) and yptA / OR (2μmol·L -1Add 1 μL of each of the following ingredients to a final volume of 20 μL using sterile, enzyme-free water: 95℃ for 3 min, 95℃ for 15 s, 60℃ for 15 s, 72℃ for 30 s, 72℃ for 5 min, for a total of 35 cycles.

[0082] RT-PCR results as follows Figure 3 As shown, it is feasible to detect RNA in wild-type and mutant strains using 18sF / R primers. However, the fragment size detected in wild-type CNO-1 strain using yptA / OF and yptA / OR primers was 398bp, and there was no band in the ΔFsyptA lane. Therefore, the ΔFsyptA strain was negative, and the FsyptA gene was not expressed at the ΔFsyptA transcriptional level.

[0083] Example 2

[0084] Mycelial growth and conidia analysis of the genetically engineered Fusarium canis strain ΔFsyptA:

[0085] (1) Observation of colony growth rate and growth morphology

[0086] Strain morphology observation and growth rate determination: Mutant strains and wild-type strains were grown on PDA plates at 28℃ for 4 days. Holes were punched at the edge of the colonies using a 7mm punch, and the colony discs were inoculated upside down onto PDA, MEA, or Czapek's agar plates. The plates were then incubated in the dark at 28℃ for 5 days. Colony diameters were recorded daily using the cross-hatching method, and photographs were taken. Three replicates were set up for each strain. Results are as follows: Figure 4 What I saw Figure 4 The results showed that on PDA medium, the colony area of ​​the mutant strain after the target gene was knocked out was significantly smaller than that of the wild type, and its hyphae spread and grew less on the medium surface, indicating that hyphae growth was severely inhibited.

[0087] (2) Spore production statistics and conidiophore morphology observation: Wild-type strains and gene knockout mutant PDA plates cultured for 5 days were scraped with 10 mL of sterile water, filtered, and spores were collected. The spores were then counted using a hemocytometer to calculate the spore yield. The wild-type spore concentration was found to be 1.34 × 10⁻⁶. 7 CFU / mL, while the ΔFsyptA concentration was only 8.6 × 10⁻⁶. 6 CFU / mL. Carnation leaves cultured on CLA medium for 4 days were examined under a 40× optical microscope to observe the morphology of conidiophores. Results are shown below. Figure 5 Under an optical microscope, after 4 days of culture, the wild type showed mature and dense conidiophores on the aerial hyphae branches. Figure 5 (A), while ΔFsyptA hardly produces spores on its conidiophores. (See A) Figure 5 (B)

[0088] Example 3

[0089] Hydrophobicity test:

[0090] To determine whether the FsyptA gene affects cellular hydrophobicity, the test strain cultured on MM medium for 5 days was used. 30 μL of ddH2O, 0.2% gelatin, and 10% Tween 20 were respectively added to the surface of the colonies, and the colonies were observed after standing for 1 minute. Figure 6 It was clearly observed that there were no significant changes in wild-type cells and ΔFsyptA when ddH2O, 0.2% gelatin, and 10% Tween 20 were added. This may be because the deletion of the FsyptA gene has no significant effect on the integrity of the cell wall.

[0091] Example 4

[0092] Observation on the effects of FsyptA gene knockout mutant strains and wild-type strains on sugarcane disease.

[0093] Wild-type and mutant strains cultured in PDA for three days were made into 1×10 6 A conidial suspension at a concentration of / ml was sprayed onto one-month-old sugarcane. Live inoculation experiments on sugarcane showed that the wild-type strain was severely affected, with leaves exhibiting chlorosis and twisting, while the ΔFsyptA disease index was significantly lower than that of the wild-type strain, with milder, almost invisible symptoms. This indicates that the pathogenicity of the FsyptA gene knockout mutant strain on sugarcane is drastically reduced.

[0094] In summary, the FsyptA gene is a crucial pathogenic factor in Fusarium spp. infection of sugarcane, likely by inhibiting mycelial and spore growth, thereby significantly reducing the pathogenicity of Fusarium. Targeted regulation of the FsyptA gene can provide theoretical and technical support for controlling Fusarium diseases in sugarcane production.

[0095] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A gene related to the pathogenicity of Fusarium canis. FsyptA Its characteristics are, The gene related to the pathogenicity of Fusarium canis FsyptA The nucleotide sequence is shown in SEQ ID No.

1.

2. Knockout or silencing of the pathogenicity-related gene of Fusarium canis as described in claim 1 FsyptA Application in reducing the pathogenicity of Fusarium moniliforme in sugarcane.

3. Knockout or silencing of the pathogenicity-related gene of Fusarium canis as described in claim 1 FsyptA Application in reducing the growth rate of Fusarium moniliforme mycelium.

4. Knockout or silencing of the pathogenicity-related gene of Fusarium canis as described in claim 1 FsyptA Application in reducing sporulation of Fusarium moniliforme in sugarcane.

5. A method for knocking out the pathogenicity-related gene of Fusarium canis as described in claim 1 in Fusarium canis. FsyptA The method is characterized by, Includes the following steps: 1) The pathogenicity-related genes of Fusarium canis described above FsyptA The left homologous arm sequence, right homologous arm sequence, and hygromycin resistance gene sequence were fused to obtain a fusion fragment; The gene related to the pathogenicity of Fusarium canis FsyptA The nucleotide sequence of the left homologous arm is shown in SEQ ID No. 2, and the nucleotide sequence of the right homologous arm is shown in SEQ ID No. 3; The nucleotide sequence of the hygromycin resistance gene sequence is shown in SEQ ID No. 4; The nucleotide sequence of the fusion fragment is shown in SEQ ID No. 5; 2) The fusion fragment obtained in step 1) is transformed into Fusarium canaliculi protoplasts using a protoplast transformation method, thereby knocking out the pathogenicity-related genes in Fusarium canaliculi. FsyptA .

6. The knockout method according to claim 5, characterized in that, In step 1), the pathogenicity-related genes of Fusarium canis FsyptA The molar ratio of the left homologous arm sequence, the right homologous arm sequence, and the hygromycin resistance gene sequence is 1:3:

1.

7. The knockout method according to claim 5, characterized in that, In step 1), the pathogenicity-related genes of Fusarium canis FsyptA The total concentration of the left homologous arm sequence, right homologous arm sequence, and hygromycin resistance gene sequence was 1000 ng / µL.

8. The knockout method according to claim 5, characterized in that, The fusion method described in step 1) includes PEG-mediated protoplast fusion.

9. The knockout method according to claim 5, characterized in that, In step 2), the ratio of the mass of the fusion fragment to the volume of the protoplast solution is 2µg:125µL.

Citation Information

Patent Citations

  • FsCYP51 gene and application thereof

    CN113481219A

  • Virulence factor FSPL gene from sugarcane pokkah boeng disease and use thereof

    US20240099311A1