Glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL as well as encoded product and application thereof

Abstract

The invention belongs to the field of gene engineering, and particularly relates to a glechoma longituba 4-coumaric acid-coenzyme A ligase gene Gl4CL as well as an encoded product and application thereof. The glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL is cloned, prepared and obtained from glechoma longituba medicinal plants for the first time, the nucleotide sequence of the gene is shown as SEQ ID NO.1, and the amino acid sequence of a product coded by the nucleotide sequence is shown as SEQ ID NO.2. The glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL is a key regulatory gene in a glechoma longituba flavonoid biosynthetic pathway, and the ligase can be applied to the process of preparing p-coumaryl coenzyme A by taking p-coumaric acid as a substrate, so that the biosynthesis of a flavonoid compound is further promoted. The invention can provide an effective method for meeting the huge market demand faced by the flavonoid compound.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and particularly relates to a 4-coumaric acid coenzyme A ligase gene Gl4CL of a caulis huoxuedan, and a product encoded by the gene and application thereof. Background Art

[0002] Glechoma longituba (Nakai) Kupr. is a perennial herbaceous plant of the genus Glechoma in the family Lamiaceae. Its dried above-ground parts are used as medicine and are called Glechoma longituba. Glechoma longituba is mainly distributed in damp places such as forest edges and streams. It has the effects of promoting dampness and relieving stranguria, clearing away heat and detoxifying, and dispersing blood stasis and reducing swelling. Glechoma longituba has multiple pharmacological effects such as diuresis and bile secretion, lipid-lowering and lithotripsy, and antibacterial and anti-inflammatory effects. It is often used to treat cholelithiasis, urolithiasis, urinary tract infection and other diseases.

[0003] The chemical components of the Herba scutellariae are diverse, including volatile oils, flavonoids, terpenes, phenolic acids, etc. Flavonoids are the main active ingredients in the Herba scutellariae, and 4-coumarate: CoA ligase (4CL) is a key enzyme in the flavonoid biosynthesis pathway, which can catalyze cinnamic acid, 4-coumaric acid, caffeic acid, ferulic acid, etc. to produce corresponding CoA esters, thereby allowing metabolism to flow to different branch pathways such as flavonoids, isoflavones, flavanones, anthocyanins, etc. However, the 4-coumarate: CoA ligase (Gl4CL) gene in the Herba scutellariae flavonoid biosynthesis pathway has not yet been isolated and identified. Summary of the invention

[0004] In view of the above problems, one of the objectives of the present invention is to propose a 4-coumarate-CoA ligase gene Gl4CL of Huoxuedan, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0005] The second purpose of the present invention is to provide a product encoded by the 4-coumarate coenzyme A ligase gene Gl4CL of the Radix Psoraleae, wherein the product includes amino acids, polypeptides or proteins.

[0006] Furthermore, the amino acid sequence of the product is shown in SEQ ID NO.2.

[0007] A third object of the present invention is to provide a recombinant expression vector containing the Glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL; further, the target gene in the recombinant expression vector is amplified by PCR using the cDNA of the Glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL as a template and SEQ ID No.5 and SEQ ID No.6 as primers. The sequence of the Glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL is inserted into the single BamHⅠ digestion site of the pET-30a expression vector, and the connection is transformed into Escherichia coli to obtain the recombinant expression vector.

[0008] A fourth object of the present invention is to provide a specific primer pair for constructing the recombinant expression vector; further, the nucleotide sequence of the upstream primer of the specific primer pair is as shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the specific primer pair is as shown in SEQ ID NO.6.

[0009] A fifth object of the present invention is to provide a recombinant engineering bacterium, which contains the Glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL or the recombinant expression vector.

[0010] A sixth object of the present invention is to provide a host cell containing the Glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL or the recombinant expression vector.

[0011] Further, the host cell includes BL21(DE3) cells.

[0012] A seventh object of the present invention is to provide the application of the Glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL, the recombinant expression vector, the recombinant engineering bacterium, or the host cell in the preparation of flavonoid compounds.

[0013] Further, the application is to synthesize the precursor substance p-coumaroyl coenzyme A in the flavonoid synthesis pathway using p-coumaric acid as a substrate; specifically, the Glechoma longituba p-coumaroyl coenzyme A gene Gl4CL can be transfected into cells and the Glechoma longituba p-coumaroyl coenzyme A can be used to promote the biosynthesis of flavonoid compounds.

[0014] Advantages of the present invention:

[0015] The present invention has cloned and prepared the Glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL from the medicinal plant Glechoma longituba for the first time. The Glechoma longituba p-coumaroyl coenzyme A gene Gl4CL is a key regulatory gene in the Glechoma longituba flavonoid biosynthesis pathway, and can be applied to prepare p-coumaroyl coenzyme A using p-coumaric acid as a substrate, and further prepare flavonoid components, which can provide an effective method to meet the huge market demand for flavonoid compounds.

[0016] Other features and advantages of the present invention will be set forth in the following description, and in part will be obvious from the description, or may be learned by practice of the present invention. The objectives and other advantages of the present invention may be realized and attained by the structure particularly pointed out in the specification, claims as well as the drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following briefly introduces the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0018] Figure 1 Shows the agarose gel electrophoresis pattern of Glechoma longituba coumaroyl-CoA gene Gl4CL in the embodiments of the present invention;

[0019] Figure 2 Shows the predicted analysis of the structural functional domain of Glechoma longituba coumaroyl-CoA Gl4CL in the embodiments of the present invention;

[0020] Figure 3 Shows the predicted analysis of the transmembrane domain of Glechoma longituba coumaroyl-CoA Gl4CL in the embodiments of the present invention;

[0021] Figure 4 Shows the predicted analysis of the secondary structure of Glechoma longituba coumaroyl-CoA Gl4CL in the embodiments of the present invention;

[0022] Figure 5 Shows the phylogenetic tree of Glechoma longituba coumaroyl-CoA Gl4CL in the embodiments of the present invention;

[0023] Figure 6 Shows the predicted analysis of the tertiary structure of Glechoma longituba coumaroyl-CoA Gl4CL in the embodiments of the present invention;

[0024] Figure 7 Shows the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE gel electrophoresis) pattern of the protein of Glechoma longituba coumaroyl-CoA Gl4CL in the embodiments of the present invention;

[0025] Figure 8 Shows the chromatogram of the reaction results of the pET-30a empty vector and Glechoma longituba coumaroyl-CoA Gl4CL catalyzing p-coumaric acid respectively in the embodiments of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0026] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Apparently, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0027] The technical means used in the embodiments are conventional means well-known to those skilled in the art, and the raw materials used are all commercially available products. Some of the raw materials are as follows:

[0028] Fast high-fidelity DNA polymerase FastPfu Fly DNA Polymerase, Quick Gel Extraction Kit, HiPure Plasmid MiniPrep Kit, Seamless Cloning and Assembly Kit Seamless Cloning and Assembly Kit, restriction endonuclease BamHI, protein purification Ni-NTA Resin, cloning competent cell Trans1-T1, expression competent cell BL21(DE3), protein molecular weight standard Blue II Protein Marker (14 - 120 kDa) was purchased from Beijing Tsingke Biotechnology Co., Ltd.

[0029] DNA Marker molecular weight standard (100 - 2000 bp), isopropyl-β-D-thiogalactoside (IPTG), SDS-PAGE denaturing acrylamide gel rapid preparation kit were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0030] Anhydrous magnesium chloride was purchased from Shanghai Merck Chemical Technology Co., Ltd.

[0031] 5-Adenosine triphosphate disodium hydrate (ATP), coenzyme A hydrate were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0032] Standard products p-coumaric acid, p-coumaroyl-CoA were purchased from Sichuan Jingcui Tiancheng Pharmaceutical Technology Co., Ltd.

[0033] Example 1

[0034] Cloning of Glechoma longituba 4-coumarate-CoA ligase gene Gl4CL:

[0035] Primers were designed based on the Gl4CL sequence in the transcriptome of Glechoma longituba, and PCR amplification was performed using the cDNA of Glechoma longituba as a template. The primer sequences are shown in Table 1:

[0036] Table 1

[0037] Primer Name Sequence Number Base Sequence (5’→3') Forward Primer SEQ ID NO.3 ATGTTGTCGGTGGCCTCCGCCGAAG Reverse Primer SEQ ID NO.4 TTAAGAGGTGGAGGAAGCTGCAAGT

[0038] The amplification system (50 μL) is as follows: FastPfu Fly DNA Polymerase 1 μL, FastPfu Fly Reaction Mix 25 μL, template cDNA 1 μL, 1 μL each of the upstream primer and the downstream primer, and 21 μL of sterile water.

[0039] Reaction conditions: pre-denaturation at 95 °C for 5 min, denaturation at 95 °C for 50 s, annealing at 55 ± 5 °C for 1 min, extension at 72 °C for 1 min. After 30 cycles, extend at 72 °C for 10 min and store at 4 °C.

[0040] The clone of the p -coumaroyl - CoA gene Gl4CL of Glechoma longituba was obtained according to the above amplification system and amplification conditions. The agarose gel electrophoresis of the p -coumaroyl - CoA gene Gl4CL of Glechoma longituba is as Figure 1 shown, Figure 1 where M represents Marker (the molecular weight standard of DNA Marker is 100 - 2000 bp). The size of the target gene Gl4CL fragment is about 1700 bp, which is in line with expectations. The target band was recovered using the EasyPure Quick Gel Extraction Kit, and the amplification product was ligated to the cloning vector pEASY - Blunt Zero and transformed into Escherichia coli Trans1 - T1 competent cells. Single colonies were selected for expanded culture and verified by colony PCR, and the positive bacterial solution was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0041] Bioinformatics analysis of the 4 - coumaric acid coenzyme A ligase gene Gl4CL of Glechoma longituba:

[0042] The length of the open reading frame (ORF) of the p -coumaroyl - CoA Gl4CL gene of Glechoma longituba obtained in the present invention is 1719 bp, and the sequence is shown in SEQ ID No.1. The ORF of the Gl4CL gene encodes 572 amino acids, as shown in SEQ ID No.2.

[0043] The Gl4CL gene sequence was retrieved for nucleotide homology in the Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBank CDS translation+PDB+Swissprot+Superdate+PIR databases using the BLAST program in the NCBI database. This gene has a high homology with 4CL in other species at the amino acid level.

[0044] The Gl4CL protein contains an active site, an AMP binding site, and a CoA binding site, has a conserved domain of PLN02246, and belongs to the 4CL gene family, as Figure 2 shown. Gl4CL has no transmembrane domain and belongs to an extracellular protein, as Figure 3 shown. The secondary structure of Glechoma longituba p-coumaroyl-CoA Gl4CL consists of α-helices, extended strands, and random coils, as Figure 4 shown. The Neighbor-joining phylogenetic tree of the Gl4CL amino acid sequence was constructed using the neighbor-joining method with MEGA6.0 software, as Figure 5 shown, showing that the amino acid sequence of Glechoma longituba p-coumaroyl-CoA Gl4CL has the closest genetic relationship with 4-coumarate:CoA ligase of Prunella vulgaris in the Lamiaceae family. Homology modeling of Gl4CL was performed using the crystal structure of the Populus tomentosa 4CL protein (PDBID: 3a9u.1.A) as a model, and the Gl4CL protein has 62.57% identity with the template protein. Figure 6 This is the monomer structure of Glechoma longituba p-coumaroyl-CoA Gl4CL protein.

[0045] Example 2

[0046] Construction of the recombinant expression vector system of the Glechoma longituba 4-coumaric acid coenzyme A ligase gene Gl4CL:

[0047] Using the cDNA of the Gl4CL gene as a template, the restriction endonuclease BamHI (hereinafter simply referred to as BamHI enzyme) was selected as the restriction site, and upstream and downstream primers with restriction sites were designed (as shown in Table 1), and a PCR amplification reaction was carried out. The underlined parts in the primers are the base sequences on the vector.

[0048] Table 2 Base sequences of specific upstream and downstream primers

[0049] Primer Name Sequence Name Base Sequence (5’-3’) Gl4CL_BamHI_F SEQ ID NO.5 AGGCCATGGCTGATATCGGAATGTTGTCGGTGGCCTCCGCCGAAG Gl4CL_BamHI_R SEQ ID NO.6 CGACGGAGCTCGAATTCGGATTAAGAGGTGGAGGAAGCTGCAAGT

[0050] The Gl4CL gene of Glechoma longituba 4-coumaric acid coenzyme A ligase and the pET30a vector were digested with BamHI, and agarose gel electrophoresis was performed. The bands after digestion were recovered by cutting the gel using the Quick Gel Extraction Kit. The target fragment recovered by cutting the gel and the prokaryotic expression vector pET30a were ligated at 50 °C for 30 min using the Seamless Cloning and Assembly Kit. The ligation product was transformed into the Escherichia coli cloning competent cell Trans1-T1, and single colonies were picked for colony PCR detection. The positive bacterial liquid with correct sequencing was cultured on a large scale and extracted using the plasmid extraction kit Seamless Cloning and Assembly Kit to obtain the constructed recombinant expression vector pET30a-Gl4CL.

[0051] Example 3

[0052] Induced expression of genetically engineered bacteria and protein purification:

[0053] The recombinant expression vector pET30a-Gl4CL was transformed into the expression competent cell BL21(DE3), and the transformed cells were spread on LB solid medium containing 50 mg / L kanamycin to screen for positive clones. Positive single colonies were selected and inoculated into LB liquid medium containing 50 mg / L kanamycin and cultured overnight; then the culture solution was cultured on a large scale at a ratio of 1:100. When the OD of the bacterial liquid 600 reached between 0.4 and 0.6, IPTG (isopropyl-β-D-thiogalactoside) with a final concentration of 0.8 mM was added, and slow induction was carried out on a shaker at 16 °C for 12 h. The pET30a empty vector was treated in the same way as a blank control.

[0054] The bacterial liquid of induced expression was centrifuged at 4 °C and 5000×g for 10 min, the supernatant was discarded, 5 mL of PBS was added for washing three times, centrifuged at 5000×g for 10 min, the supernatant was discarded, and it was immediately placed on ice for cooling. The cells were resuspended in 5 mL of PBS and sonicated on ice. After sonication, centrifuged at 4 °C and 10000×g for 15 min, and 50 μL of the supernatant was taken for 10% SDS-PAGE electrophoresis analysis (the SDS-PAGE gel used for analysis was prepared using the SDS-PAGE denaturing acrylamide gel rapid preparation kit). The results are as Figure 7 shown. The recombinant expression vector pET30a-Gl4CL after induction expressed soluble protein, and the protein band was located at 75 kDa to 100 kDa, and the size was consistent with the molecular weight of the Gl4CL protein (Blue II Protein Marker (14 - 120 kDa) is used as the protein molecular weight standard).

[0055] Absorb 1 mL of Gl4CL protein supernatant and mix it with 500 μL of the washed protein purification Ni - NTA Resin, and incubate with shaking in an ice bath for 2 h. After incubation, centrifuge at 4°C and 500×g for 5 min, discard the supernatant, then add 1 mL of His Buffer to wash away the miscellaneous proteins, and repeat 3 times. Add 200 μL of imidazole buffer with different concentrations (20 mM, 100 mM, 300 mM, 500 mM) in sequence to elute the protein by gradient. Centrifuge at 4°C and 500×g for 5 min, collect the supernatant to obtain the purified Gl4CL protein. The Gl4CL protein was analyzed by 10% SDS - PAGE electrophoresis, and the results are as Figure 7 shown. Among them, M is Protein Marker, lane 1 is the pET - 30a empty vector, lane 2 is the whole bacterial solution containing unpurified Gl4CL protein after induction, lane 3 is the supernatant of the purified Gl4CL protein after induction, and lanes 4 - 7 are the purified Gl4CL proteins eluted with 20 mM, 100 mM, 300 mM, and 500 mM imidazole solutions respectively (the arrow position is the target protein). It can be seen that the Gl4CL protein can be efficiently eluted by 100 mM, 300 mM, and 500 mM imidazole solutions, and the amount of purified Gl4CL protein eluted with 300 mM imidazole solution is the largest and the purification effect is the best.

[0056] Example 4

[0057] In vitro enzyme function verification:

[0058] 1. Using p - coumaric acid as the substrate and the pET - 30a empty vector protein as the negative control, the in vitro function of the purified Gl4CL protein was identified. The 500 μL enzyme - catalyzed reaction system includes 115 μL of 1 M Tris - HCl buffer (pH = 7.5), 150 μL of 17 mM MgCl 2 2, 125 μL of 20 mM ATP, 5 μL of 30 mM CoA, 5 μL of 20 mM p - coumaric acid, and 100 μL of enzyme solution (supernatant of the purified Gl4CL protein). Incubate in a 30°C water bath for 1 h, and terminate the reaction in a 100°C metal bath for 10 min. Centrifuge at 12000×g for 10 min, filter the supernatant through a 0.22 μm microporous filter membrane, and detect the production of the product by UPLC.

[0059] 2. Using p - coumaroyl - CoA as the standard product, the production of enzymatic products was detected by UPLC. The UPLC analysis was completed by an Agilent 1290 ultra - performance liquid chromatograph, and the chromatographic column was ACQUITY UPLC BEH C18 (2.1×100 mm, 1.7 μm). A gradient elution was performed using 0.1% phosphoric acid in water (phase A) and acetonitrile (phase B) as the mobile phase. The elution program was as follows: 0 - 5 min, 5% - 10% B; 5 - 10 min, 10% - 15% B; 10 - 15 min, 15% - 25% B; 15 - 18 min, 25% - 75% B; 18 - 21 min, 75% - 95% B; 21 - 27 min, 95% B. The flow rate was 0.2 mL / min, the detection wavelength was 333 nm, the column temperature was 30 °C, and the injection volume was 5 μL.

[0060] 3. As Figure 8 shown, compared with the pET30a empty vector protein, the purified Gl4CL protein catalyzed the p - coumaric acid substrate to show a new chromatographic peak at 13.512 min, which was consistent with the elution time (13.719 min) of the standard product p - coumaroyl - CoA. Therefore, it can be determined that the protein expressed and purified by the pET30a - Gl4CL recombinant expression vector has the function of 4 - coumaric acid coenzyme A ligase.

[0061] In summary, in the present invention, the coding gene (Gl4CL) of coumaric acid coenzyme A ligase was cloned from Glechoma longituba, and then the Gl4CL gene was ligated onto a prokaryotic expression vector through genetic engineering technology. The Gl4CL protein was highly expressed in host cells, which can promote the synthesis of p - coumaroyl - CoA, an important precursor in the flavonoid synthesis pathway. Using the gene and technology provided by the present invention, p - coumaroyl - CoA can be synthesized in large quantities in vitro, and the content of flavonoid compounds such as naringenin in Glechoma longituba can also be increased through genetic engineering technology.

[0062] SEQ ID NO.1 and SEQ ID NO.2 mentioned in Example 1 are as follows:

[0063] SEQ ID NO.1:

[0064]

[0065] SEQ ID NO.2:

[0066] MLSVASAEAQNPELSSHALQPQPQPQTQSCEQTDHIFVSKLPSIPISNHLPLHTYCFENFSQYPDRPCLLVGSDGKSYSFAETHLLCRRVAAGLSNLGIRKGDVVMALLQNCAEFVFTFMGASMIGAVITTANPFCTSKEIFKQFHASKSKMIVTQSMYVDKLRDTGDDSLVLGEDFYVVTIDAAPEKCLHFSALSEADESAAPDVEISPDDAVALPFSSGTTGLPKGVILTHKSLITSIAQQVDGENPNLYLKADDVVLCVLPLFHIYSLNSVLLCSLRAGAGVLLMQKFEIGALLELIQLHRVSVAAVVPPLVLALAKNPLVDNFDLSSIRMVLSGAAPLGKELEAALLSRLPQAVFGQGYGMTEAGPVLSMSPSFAKVALPTKSGSCGNVVRNAELKVVDPETGCSLPRNQPGEICIRGPQIMKGYLNDAEATARTVDVDGWLHTGDIGYVDEDDDVFIVDRVKELIKFKGFQVPPAELEALLISHSQISDAAVVPQKDEAAGEVPVAFVVPANGSELTEEAVKEFISKQVVFYKRLHKVYFVHAIPKSPSGKILRKDLRAKLAASSTS

[0067] Although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A 4-coumarate coenzyme A ligase gene G14CL of Huoxuedan, characterized in that: The nucleotide sequence of the gene Gl4CL is shown in SEQ ID NO.

1.

2. A product encoded by the 4-coumarate coenzyme A ligase gene G14CL of the Huoxuedan according to claim 1, characterized in that: The products include amino acids, polypeptides or proteins.

3. The product encoded by the 4-coumarate coenzyme A ligase gene G14CL of Huoxuedan according to claim 2, characterized in that: The amino acid sequence of the product is shown in SEQ ID NO.

2.

4. A recombinant expression vector, characterized in that: The invention contains the 4-coumaric acid coenzyme A ligase gene Gl4CL of claim 1, and the expression vector is pET-30a.

5. A specific primer pair, characterized in that: Used to construct the recombinant expression vector according to claim 4, the nucleotide sequence of the upstream primer of the specific primer pair is shown as SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the specific primer pair is shown as SEQ ID NO.

6.

6. A recombinant engineered bacterium, characterized in that: Contains the 4-coumarate coenzyme A ligase gene Gl4CL of Huoxuedan as claimed in claim 1 or contains the recombinant expression vector as claimed in claim 4.

7. A host cell, characterized in that Contains the 4-coumarate coenzyme A ligase gene Gl4CL of claim 1 or contains the recombinant expression vector of claim 4.

8. The host cell according to claim 7, characterized in that The host cells include BL21 (DE3) cells.

9. Use of the 4-coumarate-CoA ligase gene G14CL of claim 1, the recombinant expression vector of claim 4, the recombinant engineered bacteria of claim 6, or the host cell of claim 7 in preparing p-coumaryl-CoA, a precursor substance in the flavonoid synthesis pathway.

10. The use according to claim 9, characterized in that: The application is to use p-coumaric acid as a substrate to synthesize p-coumaryl coenzyme A, a precursor substance in the synthesis pathway of flavonoids.

Images