Glechoma longituba chalcone synthase gene GlCHS as well as encoded product and application thereof

Abstract

The invention discloses a glechoma longituba chalcone synthase gene GlCHS as well as an encoded product and application thereof, and belongs to the field of gene engineering. The chalcone synthase gene GlCHS is cloned from glechoma longituba, the nucleotide sequence of the gene is as shown in SEQ ID No. 1, and the amino acid sequence of a gene coding product is as shown in SEQ ID No. 2. The glechoma longituba chalcone synthase is heterologously expressed in host cells, and the synthase has the function of catalyzing to generate naringenin by taking p-coumaroyl coenzyme A and malonyl coenzyme A as substrates. By utilizing the gene engineering technology, the content of naringenin in glechoma longituba can be increased, and naringenin can be synthesized in vitro in a medicinal plant.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and particularly relates to a Glechoma longituba chalcone synthase gene GlCHS, its encoded product and applications. Background Art

[0002] Glechoma longituba (Nakai) Kupr. is a perennial herb of the genus Glechoma in the family Lamiaceae. The 2020 edition of the Chinese Pharmacopoeia stipulates that the dried above-ground parts of Glechoma longituba are used as medicine and called Lysimachiae Herba, which has the effects of promoting diuresis and relieving stranguria, clearing heat and detoxifying, and dispersing stasis and detumescence. As a commonly used traditional Chinese medicine, Lysimachiae Herba has various pharmacological effects such as diuretic and cholagogic, lipid-lowering, litholytic, anti-inflammatory, and antibacterial. Its whole herb or stems and leaves are used to treat symptoms such as heat strangury, stone strangury, damp-heat jaundice, sores and carbuncles, and traumatic injuries. Clinically, compound preparations containing Lysimachiae Herba are mostly used, such as Paishi Keli, Jinqian Dantong Keli, Niaoganning Keli, Qingre Lidan Keli, Huoluo Zhitong Pills, Tianqi Dieda Fengshi Ointment, etc., for the treatment of various diseases such as cholelithiasis, urolithiasis, urinary tract infection, gout, arthritis, etc. caused by damp-heat.

[0003] The whole plant of Glechoma longituba is rich in secondary metabolites, including flavonoids, phenolic acids, terpenoids, lignins and other compounds. Flavonoid compounds are an important class of secondary metabolites in Glechoma longituba, with high economic value and medical value. The biosynthesis of flavonoid substances originates from the phenylpropanoid biosynthesis pathway. Phenylalanine is catalyzed by phenylalanine ammonia-lyase (PAL), cinnamic 4-hydroxylase (C4H), and p-coumaryl-CoA ligase (4CL) to generate p-coumaryl-CoA, and then enters the flavonoid biosynthesis pathway. P-coumaryl-CoA is catalyzed by chalcone synthase (CHS) to generate naringenin chalcone, and then catalyzed by chalcone isomerase (CHI) to generate naringenin. Naringenin is the precursor substance of various flavonoid compounds. Chalcone synthase is the first key rate-limiting enzyme in the plant flavonoid biosynthesis pathway, and its function and activity are closely related to the synthesis and accumulation of various flavonoid compounds. However, the chalcone synthase gene in the flavonoid biosynthesis pathway of Glechoma longituba has not been isolated and identified yet. Summary of the Invention

[0004] In view of the above problems, one of the objectives of the present invention is to provide a Glechoma longituba chalcone synthase gene GlCHS, and the nucleotide sequence of the gene GlCHS is shown in SEQ ID NO.1.

[0005] The second object of the present invention is to provide a product encoded by the Glechoma hederacea chalcone synthase gene GlCHS, and the product includes amino acids, polypeptides or proteins.

[0006] Furthermore, the amino acid sequence of the product is as shown in SEQ ID NO.2.

[0007] The third object of the present invention is to provide a recombinant expression vector containing the Glechoma hederacea chalcone synthase gene GlCHS; furthermore, the target gene in the recombinant expression vector is amplified by PCR using the cDNA of the Glechoma hederacea chalcone synthase gene GlCHS as a template and SEQ ID No.5 and SEQ ID No.6 as primers. The gene GlCHS is inserted into the single BamHⅠ digestion site of the pET-30a expression vector, and then ligated and transformed into Escherichia coli to obtain the recombinant expression vector (pET-30a-GlCHS).

[0008] The fourth object of the present invention is to provide a specific primer pair for constructing the recombinant expression vector; furthermore, the nucleotide sequence of the upstream primer of the specific primer pair is as shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the specific primer pair is as shown in SEQ ID NO.6.

[0009] The fifth object of the present invention is to provide a recombinant engineering bacterium, which contains the Glechoma hederacea chalcone synthase gene GlCHS or the recombinant expression vector.

[0010] The sixth object of the present invention is to provide a host cell containing the Glechoma hederacea chalcone synthase gene GlCHS or the recombinant expression vector.

[0011] Furthermore, the host cell includes BL21(DE3) cells.

[0012] The seventh object of the present invention is to provide the application of the Glechoma hederacea chalcone synthase gene GlCHS, the recombinant expression vector, the recombinant engineering bacterium, or the host cell in the preparation of flavonoid compounds.

[0013] Furthermore, the application is the application in the preparation of naringenin using p-coumaroyl-CoA and malonyl-CoA as substrates.

[0014] The beneficial effects of the present invention:

[0015] The present invention has for the first time cloned and prepared the Glechoma hederacea chalcone synthase gene GlCHS from the medicinal plant Glechoma hederacea, and this gene can be applied to prepare naringenin using p-coumaroyl-CoA and malonyl-CoA as substrates. The gene provided by the present invention can increase the content of flavonoid components in Glechoma hederacea through genetic engineering technology. This technology can be used to subsequently produce a large amount of flavonoid compounds in vitro of medicinal plants through genetic engineering technology, providing an effective method to meet the huge market demand for flavonoid compounds.

[0016] Other features and advantages of the present invention will be set forth in the following description, and in part will be obvious from the description, or may be learned by practice of the present invention. The objectives and other advantages of the present invention may be realized and attained by the structure particularly pointed out in the specification, claims as well as the drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or in the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0018] Figure 1 Shows the agarose gel electrophoresis pattern of the Glechoma hederacea chalcone synthase gene GlCHS in the embodiments of the present invention;

[0019] Figure 2 Shows the predicted analysis of the structural and functional domains of the Glechoma hederacea chalcone synthase GlCHS in the embodiments of the present invention;

[0020] Figure 3 Shows the predicted analysis of the transmembrane domains of the Glechoma hederacea chalcone synthase GlCHS in the embodiments of the present invention;

[0021] Figure 4 Shows the predicted analysis of the homodimer structure of the Glechoma hederacea chalcone synthase GlCHS in the embodiments of the present invention;

[0022] Figure 5 Shows the predicted analysis of the monomer structure of the Glechoma hederacea chalcone synthase GlCHS protein in the embodiments of the present invention;

[0023] Figure 6 Shows the phylogenetic tree of the Glechoma hederacea chalcone synthase GlCHS in the embodiments of the present invention;

[0024] Figure 7 Shows the SDS-polyacrylamide gel electrophoresis pattern of the Glechoma hederacea chalcone synthase GlCHS protein in the embodiments of the present invention;

[0025] Figure 8 The chromatograms showing the results of the reactions catalyzed by the pET-30a empty vector and Glechoma longituba chalcone synthase GlCHS on p-coumaroyl coenzyme A and malonyl coenzyme A respectively in the embodiments of the present invention are presented. Detailed implementation manners

[0026] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0027] The technical means used in the embodiments are conventional means well-known to those skilled in the art, and the raw materials used are all commercially available products. Some of the raw materials are as follows:

[0028] Fast high-fidelity DNA polymerase FastPfu Fly DNA Polymerase, Quick Gel Extraction Kit, HiPure Plasmid MiniPrep Kit, Seamless Cloning and Assembly Kit Seamless Cloning and Assembly Kit, restriction endonucleases BamHI, protein purification Ni-NTA Resin, cloning competent cells Trans1-T1, expression competent cells BL21(DE3), protein molecular weight standard Blue II Protein Marker (14 - 120 kDa) was purchased from Beijing Tsingke Biotechnology Co., Ltd.

[0029] DNA Marker molecular weight standard (100 - 2000 bp), isopropyl-β-D-thiogalactoside (IPTG), SDS-PAGE denaturing acrylamide gel rapid preparation kit were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0030] Potassium dihydrogen phosphate and dipotassium hydrogen phosphate were purchased from Shanghai Yuanye Bio-Technology Co., Ltd.

[0031] Lithium salt of malonyl coenzyme A was purchased from Shanghai Merck Chemical Technology Co., Ltd.

[0032] Standard p-coumaroyl coenzyme A (p-Coumaroyl-CoA) and naringenin were purchased from Sichuan Jingcui Tiancheng Pharmaceutical Technology Co., Ltd.

[0033] All other reagents are imported or domestic analytical pure reagents.

[0034] Example 1

[0035] Cloning of Glechoma hederacea chalcone synthase gene GlCHS:

[0036] Primers were designed based on the GlCHS sequence in the Glechoma hederacea transcriptome, and PCR amplification was performed using Glechoma hederacea cDNA as a template. The primer sequences are shown in Table 1:

[0037] Table 1

[0038] Primer Name Sequence Number Base Sequence (5’→3') Forward Primer SEQ ID NO.3 ATGGTGACCGTGGAGGAAATCCGCC Reverse Primer SEQ ID NO.4 TCAATTAATGTGCGGCACACTGTGC

[0039] The amplification system is as follows: FastPfu Fly DNA Polymerase FastPfu Fly DNAPolymerase 1 μL, FastPfu Fly Reaction Mix 25 μL, template cDNA 1 μL, 1 μL each of upstream and downstream primers, and 21 μL of sterile water.

[0040] Reaction conditions: Pre-denaturation at 95 °C for 5 min, denaturation at 95 °C for 50 s, annealing at 55 ± 5 °C for 1 min, extension at 72 °C for 1 min. After 30 cycles, extend at 72 °C for 10 min and store at 4 °C.

[0041] The clone (amplification product) of Glechoma hederacea chalcone synthase gene GlCHS was obtained according to the above amplification system and amplification conditions. The agarose gel electrophoresis of Glechoma hederacea chalcone synthase gene GlCHS is as Figure 1 shown, Figure 1 where M represents Marker (i.e., DNA Marker, molecular weight standard (100 - 2000 bp)). It can be seen that the size of the target gene GlCHS fragment is approximately 1100 bp, which is consistent with the number of bases in the GlCHS gene sequence.

[0042] Bioinformatics analysis of Glechoma hederacea chalcone synthase gene GlCHS:

[0043] The length of the open reading frame (ORF) of the Glechoma longituba chalcone synthase gene GlCHS obtained is 1176 bp. The detailed sequence is shown in SEQ ID No.1, and this sequence encodes 391 amino acids, as shown in SE Q ID No.2. The sequence of the Glechoma longituba chalcone synthase gene GlCHS was subjected to nucleotide homology search in the Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBa nk+CDStranslation+PDB+Swissprot+Superdate+PIR databases using the BLAST program in the NCBI database. This gene has a high homology with CHS in other species at the amino acid level. GlCHS has no transmembrane domain and belongs to an extracellular protein, as Figure 2 shown.

[0044] The GlCHS protein contains an active site, a product binding site, and a malony-CoA binding site, and belongs to the chalcone synthase superfamily, as Figure 3 shown.

[0045] Homology modeling of GlCHS was performed using the crystal structure of the Arabidopsis thaliana CHS protein (PDB ID: 6dxb.1.A) as a model. GlCHS has 85.49% identity with the template protein sequence. The GlCHS protein model is a homodimer structure, as Figure 4 shown, and the monomer structure is as Figure 5 shown.

[0046] The Neighbor-joining phylogenetic tree of the GlCHS amino acid sequence was constructed using the Neighbor-joining method with MEGA6.0 software, as Figure 6 shown, showing that the Glechoma longituba GlCHS amino acid sequence and the chalcone synthase amino acid sequence of Agastache rugosa in the Lamiaceae family are located at the same branch point and have the closest genetic relationship.

[0047] Example 2

[0048] Construction of the recombinant expression vector system of the Glechoma longituba chalcone synthase gene GlCHS:

[0049] Using the nucleotide sequence of the cloned Glechoma longituba chalcone synthase gene GlCHS as a template, the restriction endonuclease Using BamHI (hereinafter simply referred to as BamHI enzyme) as the restriction site, upstream and downstream primers with restriction sites were designed (as shown in Table 2), and a PCR amplification reaction was carried out. The underlined parts in the primers are the base sequences on the vector.

[0050] Table 2 Base sequences of specific upstream and downstream primers

[0051] Primer Name Sequence Number Base Sequence (5’-3’) GlCHS_BamHI_F SEQ ID NO.5 AGGCCATGGCTGATATCGGAATGGTGACCGTGGAGGAAATCCGCC GlCHS_BamHI_R SEQ ID NO.6 CGACGGAGCTCGAATTCGGATCAATTAATGTGCGGCACACTGTGC

[0052] The Glechoma hederacea chalcone synthase gene GlCHS and the pET30a vector were digested with BamHI enzyme, and agarose gel electrophoresis was carried out. The bands after digestion were recovered by cutting the gel with the Quick Gel Extraction Kit. The recovered target fragment and the prokaryotic expression vector pET30a were ligated with the Seamless Cloning and Assembly Kit at 50 °C for 30 min. The ligation product was transformed into the Escherichia coli cloning competent cell Trans1-T1, and single colonies were picked for colony PCR detection. The positive bacterial solution with correct sequencing was amplified, and the plasmid was extracted with the HiPure Plasmid MiniPrep Kit, and the constructed recombinant expression vector pET30a-GlCHS was obtained. The recombinant expression vector pET30a-GlCHS was transformed into the expression competent cell BL21(DE3), and the transformed cells were spread on LB solid medium containing 50 mg / L kanamycin to screen for positive clones. Positive single colonies were selected and inoculated into LB liquid medium containing 50 mg / L kanamycin and cultured overnight; then the culture solution was amplified at a ratio of 1:100. When the OD of the bacterial solution reached between 0.4 and 0.6, IPTG (isopropyl-β-D-thiogalactoside) with a final concentration of 0.8 mM was added, and slow induction was carried out in a shaker at 16 °C for 12 h. The pET30a empty vector was treated in the same way as a blank control.

[0053] Example 3

[0054] Induced expression and protein purification of genetically engineered bacteria:

[0055] The recombinant expression vector pET30a-GlCHS was transformed into the expression competent cell BL21(DE3), and the transformed cells were spread on LB solid medium containing 50 mg / L kanamycin to screen for positive clones. Positive single colonies were selected and inoculated into LB liquid medium containing 50 mg / L kanamycin and cultured overnight; then the culture solution was amplified at a ratio of 1:100. When the OD of the bacterial solution reached between 0.4 and 0.6, IPTG (isopropyl-β-D-thiogalactoside) with a final concentration of 0.8 mM was added, and slow induction was carried out in a shaker at 16 °C for 12 h. The pET30a empty vector was treated in the same way as a blank control. 600 When it reached between 0.4 and 0.6, IPTG (isopropyl-β-D-thiogalactoside) with a final concentration of 0.8 mM was added, and slow induction was carried out in a shaker at 16 °C for 12 h. The pET30a empty vector was treated in the same way as a blank control.

[0056] The induced bacterial solution was centrifuged at 4°C and 5000×g for 10 min, the supernatant was discarded, 5 mL of PBS was added for washing three times, then centrifuged at 5000×g for 10 min, the supernatant was discarded, and it was immediately placed on ice for cooling. 5 mL of PBS was added to resuspend the bacteria, and ultrasonic disruption was performed on ice. After ultrasonic disruption, it was centrifuged at 4°C and 10000×g for 15 min, and 50 μL of the supernatant was taken for 10% SDS-PAGE electrophoresis analysis (the SDS-PAGE gel used for analysis was prepared using a SDS-PAGE denaturing acrylamide gel rapid preparation kit). The results of the electrophoresis analysis are as Figure 7 shown. The recombinant expression vector pET30a-GlCHS expressed soluble protein after induction, and the band was approximately at 45 kDa, which was consistent with the molecular weight of the GlCHS protein (Blue II Protein Marker (14 - 120 kDa) was selected as the protein molecular weight standard).

[0057] 1 mL of the protein supernatant was aspirated and mixed with 500 μL of the washed protein purification Ni-NTA Resin, and incubated with shaking in an ice bath for 2 h. After incubation, it was centrifuged at 4°C and 500×g for 5 min, and the supernatant was discarded. 200 μL of imidazole buffer solutions with different concentrations (20 mM, 100 mM, 200 mM, 300 mM, 500 mM) were added successively to elute the protein by gradient. It was centrifuged at 4°C and 500×g for 5 min, and the supernatant was collected to obtain the purified protein. The purified protein was analyzed by 10% SDS-PAGE electrophoresis, and the results are as Figure 7 shown, where M is Protein Marker, lane 1 is the pET-30a empty vector, lane 2 is the whole bacterial solution containing GlCHS protein after induction, lane 3 is the GlCHS protein supernatant, and lanes 4 - 8 are GlCHS protein samples eluted with 20 mM, 100 mM, 200 mM, 300 mM, and 500 mM imidazole solutions respectively. The position of the arrow is the target protein. The GlCHS recombinant protein can be efficiently eluted by 200 mM, 300 mM, and 500 mM imidazole solutions, and the amount of the purified protein (GlCHS purified protein) eluted with 300 mM imidazole solution is the largest and the purification effect is the best.

[0058] Example 4

[0059] In vitro enzyme function verification:

[0060] 1. Using p-coumaroyl coenzyme A as the substrate and the pET-30a empty vector protein as the negative control, the in vitro function of the GlCHS purified protein was identified. The 500 μL enzymatic reaction system included 360 μL of 0.1 M potassium phosphate buffer (0.05 mol / L K 2 HPO 4: 0.05 mol / L KH 2 PO 4 = 94:6, pH = 8.0), 20 μL of 230 μM malonyl-CoA lithium salt, 20 μL of 280 μM p-coumaroyl-CoA, and 100 μL of enzyme solution (purified protein supernatant). Incubate in a 30 °C water bath for 1 h, add 250 μL of ethyl acetate to terminate the reaction and extract the reaction products (extract 3 times repeatedly). After drying the solvent with nitrogen, dissolve it in 100 μL of mass spectrometry-grade methanol, filter it through a 0.22 μm microporous filter membrane, and set aside.

[0061] 2. Using naringenin as the standard, detect the generation of the enzymatic product by UPLC. The UPLC analysis was completed by an Agilent 1290 ultra-high performance liquid chromatograph, and the chromatographic column was ACQUITY UPLC BEH C18 (2.1×100 mm, 1.7 μm). Gradient elution was performed with 0.1% phosphoric acid water (phase A) and acetonitrile (phase B) as the mobile phase. The flow rate was 0.1 mL / min, the detection wavelength was 290 nm, the column temperature was 30 °C, and the injection volume was 5 μL.

[0062] The elution program was as follows: 0 - 3 min, 20% - 22.5% B; 3 - 8 min, 22.5% - 25% B; 8 - 10 min, 25% - 75% B; 10 - 12 min, 75% - 85% B; 12 - 18 min, 85% - 88% B; 18 - 20 min, 90% B.

[0063] 3. Since CHS can catalyze the formation of naringenin chalcone from p-coumaroyl-CoA and malonyl-CoA in vitro. Naringenin chalcone is unstable in aqueous solution and can slowly cyclize spontaneously into naringenin. Therefore, in this example, the activity of the GlCHS purified protein was determined by detecting the presence or absence of naringenin in the enzymatic system. Detect the catalytic product under the above conditions, and the results are as Figure 8 shown. Compared with the pET30a empty vector protein, the GlCHS purified protein catalyzed the p-coumaroyl-CoA substrate to show a new chromatographic peak at 13.495 min, which coincided with the peak time (13.549 min) of the standard naringenin. Therefore, it can be determined that pET30a-GlCHS has the function of chalcone synthase.

[0064] As can be seen from the above examples, the present invention cloned the coding gene (GlCHS) of chalcone synthase from Glechoma longituba, and by transferring the GlCHS gene into a prokaryotic expression vector, the GlCHS purified protein highly expressed in host cells can promote the synthesis of the flavonoid compound naringenin. Using the gene and technology provided by the present invention, naringenin can be synthesized in large quantities in vitro, and the content of naringenin in Glechoma longituba can also be increased by genetic engineering technology.

[0065] The SEQ ID NO.1 and SEQ ID NO.2 mentioned in Example 1 are as follows:

[0066] SEQ ID NO.1:

[0067]

[0068] SEQ ID NO.2:

[0069] MVTVEEIRRAQRAEGPATVLAIGTAVPTNCVDQSAYPDYYFRITNSEHKTDLKEKFVRMCEKSMIKKRYMHLTEEYLKENPNITAYMAPSLDARQDIVVVEVPKLGKEAAQKAIKEWGQSKSKITHLVFCTTSGVDMPGADYQLTKLLGLRASVKRFMMYQQGCFAGGTVLRMAKDLAENNAGARVLVVCSEITAVTFRGPSESHLDSLVGQALFGDGAAAVIVGSDPVLGVERPLFQLVSAAQTILPDSDGAIDGHLREVGLTFHLLKDVPGLISKNIEKSLKEAFAPLGISDWNSVFWIAHPGGPAILDQVEAKLGLKPEKLRSTRHVLSEYGNMSSACVLFILDEMRKSSAKEGMTTTGEGLDWGVLFGFGPGLTVETVVLHSVPHIN

[0070] Although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A chalcone synthase gene GlCHS, characterized in that: The nucleotide sequence of the gene GlCHS is shown in SEQ ID NO.

1.

2. A product encoded by the chalcone synthase gene GlCHS of claim 1, characterized in that: The products include amino acids, polypeptides or proteins.

3. The product encoded by the chalcone synthase gene GlCHS of claim 2, characterized in that: The amino acid sequence of the product is shown in SEQ ID NO.

2.

4. A recombinant expression vector, characterized in that: The invention contains the chalcone synthase gene GlCHS of claim 1, and the expression vector is pET-30a.

5. A specific primer pair, characterized in that: Used to construct the recombinant expression vector according to claim 4, the nucleotide sequence of the upstream primer of the specific primer pair is shown as SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the specific primer pair is shown as SEQ ID NO.

6.

6. A recombinant engineered bacterium, characterized in that: Contains the chalcone synthase gene GlCHS of claim 1 or contains the recombinant expression vector of claim 4.

7. A host cell, characterized in that Contains the chalcone synthase gene GlCHS of claim 1 or contains the recombinant expression vector of claim 4.

8. The host cell according to claim 7, characterized in that The host cells include BL21 (DE3) cells.

9. Use of the chalcone synthase gene GlCHS of claim 1, the recombinant expression vector of claim 4, the recombinant engineered bacteria of claim 6, or the host cell of claim 7 in the preparation of flavonoid compounds.

10. The use according to claim 9, characterized in that: The application is the application in preparing naringenin by using p-coumaroyl-CoA and malonyl-CoA as substrates.

Images