Method for improving methanol utilization capability of pichia pastoris through over-expression of methanol utilization pathway gene

Abstract

The invention belongs to the technical field of gene engineering and fermentation engineering, and particularly relates to a method for improving the methanol utilization capacity of pichia pastoris through over-expression of a methanol utilization pathway gene. The method comprises the following steps: constructing a pichia pastoris strain for expressing Cas9 protein, constructing a gRNA plasmid of a pichia pastoris chromosome integrated gene, constructing a donor plasmid of the pichia pastoris chromosome integrated gene, constructing an overexpressed pichia pastoris strain and the like. According to the invention, a pichia pastoris strain for expressing Cas9 protein is constructed, and a methanol oxidase related gene and a linearized gRNA plasmid are integrated to a specific site on a pichia pastoris strain chromosome, so that the pichia pastoris engineering strain is constructed; the construction method disclosed by the invention can be used for quickly and conveniently constructing the pichia pastoris engineering bacteria with high methanol utilization performance, and can be applied to the fields of producing mycoprotein by utilizing the pichia pastoris through high-density fermentation by utilizing methanol and the like.

Description

Technical Field

[0001] The present invention belongs to the technical fields of genetic engineering and fermentation engineering, and particularly relates to a method for overexpressing genes in the methanol utilization pathway to improve the methanol utilization ability of Komagataella phaffii. Background Art

[0002] Sugar-based raw materials represented by glucose are currently the mainstream substrates for biological fermentation. However, the fermentation of sugar-based raw materials competes with food production, leading to a series of problems such as food resource shortages. As a non-food one-carbon (C1) raw material, methanol has the advantages of rich sources, low cost, and high energy compared to glucose, and is considered an extremely attractive fermentation substrate. The current global annual production of methanol exceeds 100 million tons, mainly prepared from fossil fuels such as coal, petroleum, and natural gas. In recent years, methanol has also been prepared from renewable resources such as biogas and biomass. With the expansion of methanol production raw materials and the gradual maturity of the process, the use of methanol as a fermentation substrate has attracted increasing attention.

[0003] Methylotrophic bacteria are microorganisms that can use methanol as a carbon source and energy source. Komagataella phaffii is one of the representative eukaryotic methylotrophic bacteria, which has significant advantages in methanol-induced high-protein expression and the production of important chemicals using methanol. The commercial production of various drugs and enzyme preparations has been achieved using recombinant Komagataella phaffii. Compared with prokaryotic methylotrophic bacteria, Komagataella phaffii can tolerate high concentrations of methanol, and high-density fermentation is relatively easy to achieve, and a variety of fermentation strategies have been basically established. At the same time, based on synthetic biology enabling technologies, CRISPR gene editing tools for Komagataella phaffii have been developed, facilitating its genetic modification. Therefore, further development of methanol-utilizing Komagataella phaffii has great potential.

[0004] When Komagataella phaffii utilizes methanol, alcohol oxidase (AOX) first oxidizes methanol to formaldehyde, and oxygen is converted to hydrogen peroxide in this process. Hydrogen peroxide is then converted back to oxygen and water under the action of catalase. Formaldehyde and xylulose 5-phosphate react under the catalysis of dihydroxyacetone synthase (DAS) to generate glyceraldehyde 3-phosphate and dihydroxyacetone, and then enter the central glycolysis pathway. Another part of the formaldehyde reacts with glutathione and is finally converted to CO 2 .

[0005] After methanol enters Pichia pastoris cells, it is oxidized by methanol oxidases AOX1 and AOX2 to form formaldehyde, which then reacts with xylulose 5-phosphate under the action of DAS to produce glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone (DHA). Therefore, overexpressing the above genes by chromosomal integration can improve methanol utilization efficiency, reduce intracellular formaldehyde content, and increase cell biomass.

[0006] Based on this, the present invention overexpresses the important genes in the methanol-to-dihydroxyacetone pathway: methanol oxidases AOX1 and AOX2, and dihydroxyacetone synthase DAS, and tests the effects of the obtained strains on methanol utilization ability and cell biomass, in order to find a method to improve the methanol utilization ability of Pichia pastoris. Summary of the Invention

[0007] The purpose of this application is to provide a method for improving the methanol utilization ability of Pichia pastoris by overexpressing genes in the methanol utilization pathway. By integrating methanol oxidase-related genes into specific loci on the chromosome of Pichia pastoris strains for overexpression, the methanol utilization ability of Pichia pastoris can be improved.

[0008] To achieve the above technical objectives, the present invention adopts the following technical solutions:

[0009] The present invention provides a method for improving the methanol utilization ability of Pichia pastoris by overexpressing genes in the methanol utilization pathway. By constructing a Pichia pastoris strain expressing Cas9 protein, and integrating methanol oxidase-related genes and linearized gRNA plasmids into specific loci on the chromosome of Pichia pastoris strains for overexpression, thereby improving the methanol utilization ability of Pichia pastoris.

[0010] The method for improving the methanol utilization ability of Pichia pastoris by overexpressing genes in the methanol utilization pathway of the present invention strengthens the methanol oxidation pathway.

[0011] The strengthening of the methanol oxidation pathway is achieved by strengthening methanol oxidase-related genes, and the methanol oxidase-related genes include one or more of AOX1 alcohol oxidase, AOX2 alcohol oxidase, and DAS1 dihydroxyacetone phosphate synthase.

[0012] The gene strengthening is to integrate the genes to be strengthened into the chromosome, and this process is regulated by the GAP promoter.

[0013] The gene integration is achieved by the CRISPR-Cas9 method.

[0014] The method for improving the methanol utilization ability of Pichia pastoris by overexpressing genes in the methanol utilization pathway includes the following steps:

[0015] 1) Construction of a Pichia pastoris strain expressing Cas9 protein

[0016] Prepare competent cells of Pichia pastoris GS115, activate and culture Escherichia coli containing the expression plasmid pGAP-Cas9, extract the plasmid, linearize the plasmid, then introduce the linearized plasmid into the competent cells of Pichia pastoris GS115, coat it on the screening medium, identify the genotype of the grown transformants, and obtain the target strain, named Pichia pastoris GS115-Cas9 in the present invention;

[0017] 2) Construction of the gRNA plasmid for chromosomal integration of Pichia pastoris

[0018] Linearize the pHZP-sgRNA plasmid, recover the gel fragment for standby; construct the gRNA plasmid targeting the chromosomal integration site of Pichia pastoris;

[0019] 3) Construction of the donor plasmid for chromosomal integration of Pichia pastoris

[0020] Select the integration site on the chromosome of Pichia pastoris, construct and linearize the integration backbone plasmid, and ligate the methanol oxidase-related gene to the integration backbone plasmid to obtain the target gene integration plasmid;

[0021] 4) Construction of the overexpressing Pichia pastoris strain

[0022] Prepare competent cells of Pichia pastoris GS115-Cas9, co-transform the gRNA plasmid constructed in step 2) and the target gene integration plasmid constructed in step 3) into the competent cells of Pichia pastoris GS115-Cas9, culture, screen, and verify to obtain the Pichia pastoris engineering bacteria capable of improving methanol utilization ability.

[0023] Furthermore, the primer pair used for genotype identification in step 1) is cas9-verify-f1 and cas9-verify-r1.

[0024] Specifically, the sequence of cas9-verify-f1 is: CTACAAAGGAGGTCCTGGAC; the sequence of cas9-verify-r1 is: GGCTGCTGTTGAAGGTCTAG.

[0025] Furthermore, in step 2), the chromosomal integration sites of Pichia pastoris targeted include the I-1 site, the II-6 site, and the II-10 site.

[0026] Specifically, the gRNA plasmid backbone sequence targeting the I-1 site of the Pichia pastoris chromosome is:

[0027] I-1 gRNA sequence: TATCTGAAGTATTTACTGGG;

[0028] The primer pair used is:

[0029] I-1 gRNA-f: ACGC TATCTGAAGTATTTACTGGG;

[0030] I-1 gRNA-r: AAAC CCCAGTAAATACTTCAGATA.

[0031] Specifically, the gRNA plasmid backbone sequence targeting the Pichia pastoris chromosome II-6 locus is:

[0032] II-6 gRNA sequence: CAACTCGAATTATAGTGGCG;

[0033] The primer pair used is:

[0034] II-6 gRNA-f: ACGC CAACTCGAATTATAGTGGCG;

[0035] II-6 gRNA-r: AAAC CGCCACTATAATTCGAGTTG.

[0036] Specifically, the gRNA plasmid backbone sequence targeting the Pichia pastoris chromosome II-10 locus is:

[0037] II-10 gRNA sequence: AATTACTTCGGGAATAATGG;

[0038] The primer pair used is:

[0039] II-10 gRNA-f: ACGC AATTACTTCGGGAATAATGG;

[0040] II-10 gRNA-r: AAAC CCATTATTCCCGAAGTAATT.

[0041] Furthermore, in step 2), when constructing the gRNA plasmid targeting the Pichia pastoris chromosome integration site, the gRNA backbone sequence is annealed to form a double-stranded sequence, and then the gRNA backbone is ligated in vitro with the pHZP-sgRNA plasmid fragment after enzyme digestion and transformed into Escherichia coli competent cells, and cultured on a screening medium to obtain transformants. The plasmid is extracted to obtain the gRNA plasmid targeting the Pichia pastoris chromosome integration site.

[0042] Furthermore, in step 3), when constructing the integration backbone plasmid, using the Pichia pastoris GS115 genome as a template, the upstream homologous arm and the downstream homologous arm of the integration site are amplified using a primer pair, and the upstream and downstream homologous arms are ligated by overlap PCR (overlapping PCR). After double enzyme digestion, it is ligated to the pUC19 plasmid, and verified by colony PCR to obtain it.

[0043] Further, in step 3), the integration sites include I-1 site, II-6 site, and II-10 site.

[0044] Further, in step 3), the constructed integration backbone plasmids include pI-1int, pII-6int, and pII-10int.

[0045] Specifically, the primer pair for amplifying the upstream homologous arm of the I-1 site is I-1uparm-f1 / I-1uparm-r1, and the primer pair for amplifying the downstream homologous arm of the I-1 site is I-1downarm-f1 / I-1downarm-r1;

[0046] The primer pair for amplifying the upstream homologous arm of the II-6 site is II-6uparm-f1 / II-6uparm-r1, and the primer pair for amplifying the downstream homologous arm of the II-6 site is II-6downarm-f1 / II-6downarm-r1;

[0047] The primer pair for amplifying the upstream homologous arm of the II-10 site is II-10uparm-f1 / II-10uparm-r1, and the primer pair for amplifying the downstream homologous arm of the II-10 site is II-10downarm-f1 / II-10downarm-r1.

[0048] Further, in step 3), when ligating the methanol oxidase-related gene to the integration backbone plasmid, using the Pichia pastoris GS115 genome as a template, using primer pairs to amplify the GAP promoter, using primer pairs to amplify the methanol oxidase-related gene, using primer pairs to amplify the terminator of the methanol oxidase-related gene, and performing double digestion and ligation to the integration backbone plasmid respectively.

[0049] Specifically, the methanol oxidase-related gene includes one or more of AOX1 alcohol oxidase, AOX2 alcohol oxidase, and DAS1 dihydroxyacetone phosphate synthase.

[0050] Specifically, the primer pairs for amplifying the GAP promoter are GAPp-f1 / GAPp-AOX1-r1, GAPp-f1 / GAPp-AOX2-r1, or GAPp-f1 / GAPp-DAS1-r1.

[0051] Specifically, the primer pairs for amplifying the methanol oxidase-related gene are AOX1-f1 / AOX1-r1 (sequences as shown in SEQ ID NO.1 and SEQ ID NO.2), AOX2-f1 / AOX2-r1 (sequences as shown in SEQ ID NO.3 and SEQ ID NO.4), or DAS1-f1 / DAS1-r1 (sequences as shown in SEQ ID NO.5 and SEQ ID NO.6).

[0052] Specifically, the primer pairs for amplifying the terminator of the methanol oxidase-related gene are AOX1t-AOX1-f1 / AOX1t-r1, AOX1t-AOX2-f1 / AOX1t-r1, or AOX1t-DAS1-f1 / AOX1t-r1.

[0053] Further, in step 4), when constructing the engineered bacteria, the gRNA plasmid constructed in step 2) and the target gene integration plasmid constructed in step 3) are digested with restriction enzymes, and then co-transformed into GS115-Cas9 Pichia pastoris competent cells, cultured, screened using a selection medium, and verified by colony PCR.

[0054] Further, based on a general inventive concept, the Pichia pastoris engineered bacteria obtained by the above method of the present invention have the performance of improving methanol utilization rate.

[0055] Specifically, the Pichia pastoris engineered bacteria can improve the methanol utilization ability of Pichia pastoris by overexpressing methanol oxidase-related genes (including AOX1 alcohol oxidase, AOX2 alcohol oxidase, and DAS1 dihydroxyacetone phosphate synthase) alone or in combination.

[0056] Specifically, the Pichia pastoris engineered bacteria include engineered bacteria GS115-AOX1, engineered bacteria GS115-AOX2, engineered bacteria GS115-DAS1, engineered bacteria GS115-AOX1 / AOX2, engineered bacteria GS115-AOX1 / DAS1, engineered bacteria GS115-AOX2 / DAS1, and engineered bacteria GS115-AOX1 / AOX2 / DAS1.

[0057] Further, based on a general inventive concept, the present invention also provides the application of the constructed Pichia pastoris engineered bacteria in improving methanol utilization rate.

[0058] Specifically, the Pichia pastoris engineered bacteria have good methanol tolerance performance.

[0059] Specifically, the Pichia pastoris engineered bacteria can significantly improve the methanol utilization ability.

[0060] Specifically, the Pichia pastoris engineered bacteria can significantly improve the performance of methanol conversion to formaldehyde.

[0061] Compared with the prior art, the advantages of the present invention are:

[0062] 1. The present invention constructs a Pichia pastoris strain expressing Cas9 protein, and integrates the methanol oxidase-related gene and the linearized gRNA plasmid into specific loci on the chromosome of the Pichia pastoris strain, thereby constructing an engineered Pichia pastoris strain. The construction method of the present invention can quickly and conveniently construct an engineered Pichia pastoris strain with high methanol utilization performance, and has good industrial application value.

[0063] 2. The engineered Pichia pastoris strain constructed by the present invention has good methanol metabolism performance. By overexpressing the engineered strain, the methanol utilization ability of Pichia pastoris can be improved, and it can be applied to the production process of producing microbial protein by high-density fermentation of Pichia pastoris using methanol. Brief Description of the Drawings

[0064] Figure 1 It is the plasmid map of pGAP-Cas9 in the present invention;

[0065] Figure 2 It is the photo of GS115-Cas9 plate colonies in the present invention;

[0066] Figure 3 It is the electrophoresis diagram of pcr verification of gRNA plasmid in Example 1;

[0067] Figure 4 It is the electrophoresis diagram of enzyme digestion verification of overexpressed gene integration plasmid in Example 1;

[0068] Figure 5 It is the electrophoresis diagram of recombinant strain genotype verification in Example 1;

[0069] Figure 6 It is the methanol consumption test result diagram of the engineered strain at 6% methanol concentration in Example 1;

[0070] Figure 7 It is the intracellular formaldehyde content accumulation diagram of the engineered strain at 6% methanol concentration in Example 1;

[0071] Figure 8 It is the microbial protein content of the engineered strain at 6% methanol concentration in Example 1. Detailed Embodiments

[0072] The following examples will further illustrate the present invention in conjunction with the drawings. These examples are implemented on the premise of the technical solution of the present invention, and detailed implementation methods and processes are given, but the protection scope of the present invention is not limited to the following examples.

[0073] For the experimental methods without specific conditions noted in the following examples, they are usually carried out under conventional conditions. The raw materials, reagents, equipment, etc. used are all conventional commercially available products without special instructions.

[0074] Example 1: Method for constructing a Pichia pastoris strain with overexpression and improving the methanol utilization rate of Pichia pastoris using AOX1, AOX2, and DAS1 genes

[0075] 1. Construction of a Pichia pastoris strain expressing Cas9 protein

[0076] Inoculate the bacteria (Escherichia coli DH5α) containing the Cas9 expression plasmid pGAP-Cas9 (the plasmid pGAP-Cas9 was obtained by the method described in the reference Gao J, Xu J, Zuo Y, et al. Synthetic biology toolkit for marker-less integration of multigene pathways into Pichia pastoris via CRISPR / Cas9[J]. ACS Synthetic Biology, 2022, 11(2): 623-633) into 4 mL of LB-Amp liquid medium and culture overnight at 37 °C with 180 rpm. Extract the plasmid using the Axygen plasmid extraction kit. Linearize the obtained plasmid with the restriction endonuclease StuI, recover the linear fragment by gel electrophoresis, concentrate it to a volume of 20 μL, and prepare it multiple times to ensure that there is more than 5 μg of linearized plasmid fragment.

[0077] Use the Coolaber Pichia pastoris transformation kit to directly add the linearized fragment to the frozen GS115 Pichia pastoris competent cells to obtain the maximum conversion rate; quickly place it in a 37 °C water bath and incubate for 5 min, mixing the sample 1-2 times in the middle; take out the centrifuge tube, add 1.0 mL of Solution 1, mix thoroughly, and incubate in a 30 °C water bath for 1 h; centrifuge at 2000 g for 10 min at room temperature, remove the supernatant, and resuspend the cell pellet in 0.8 mL of Solution 2; centrifuge the sample, remove the supernatant, and gently resuspend the sample in 0.2 mL of Solution 2; spread all the transformation solutions on an SC-HIS auxotrophic plate (6.7 g / L of yeast nitrogen source without amino acids, 20 g / L of glucose, 1.92 g / L of amino acid nutritional supplement without histidine, add 1.5% agar powder for solid), and incubate at 30 °C for 2-3 days; perform genotype identification on the grown transformants;

[0078] Among them, the primer pair used is cas9-verify-f1 and cas9-verify-r1, and the target band is 923 bp; the obtained strain is named GS115-Cas9. The sequence of cas9-verify-f1 is: CTACAAAGGAGGTCCTGGAC; the sequence of cas9-verify-r1 is: GGCTGCTGTTGAAGGTCTAG.

[0079] The map of plasmid pGAP-Cas9 used in the present invention is as Figure 1 shown. It contains a human codon-optimized Cas9 expression gene, which is driven by the constitutive promoter GAP. There is an SV40 nuclear localization signal at each of the N-terminus and C-terminus, and the selection marker is histidine auxotrophy.

[0080] Figure 2 The picture shows the transformants obtained by coating the SC-HIS auxotrophic plate after linearizing this plasmid and transferring it into GS115 strain. Figure 2 It shows that the GS115-Cas9 strain has been successfully constructed.

[0081] 2. Construction of gRNA plasmid for integrating genes into the chromosome of Pichia pastoris

[0082] 2.1 Using the plasmid pHZP-sgRNA (the plasmid pHZP-sgRNA was obtained by the method in the reference Gao J, Xu J, Zuo Y, et al. Synthetic biology toolkit for marker-less integration of multigene pathways into Pichia pastoris via CRISPR / Cas9[J]. ACS Synthetic Biology, 2022, 11(2):623 - 633) as the backbone, digest it with the restriction enzyme Bsa1, and recover the gel fragment for standby.

[0083] 2.2 Construct the gRNA plasmid pI-1gRNA targeting the I-1 locus of the Pichia pastoris chromosome;

[0084] I-1gRNA sequence: TATCTGAAGTATTTACTGGG

[0085] The synthesized primer pair is:

[0086] I-1gRNA-f: ACGC TATCTGAAGTATTTACTGGG

[0087] I-1gRNA-r: AAAC CCCAGTAAATACTTCAGATA.

[0088] Anneal to form a double-stranded sequence by self-assembly. System: 35 μL of deionized water, 5 μL of T4 ligase buffer, 5 μL of primer I-1gRNA-f (20 μM), 5 μL of I-1gRNA-r (20 μM). Incubate at 95 °C for 5 min, decrease the temperature by 5 - 10 °C per minute, and incubate at 16 °C for 10 min. Dilute the annealed product 10-fold as a fragment. After digesting the gRNA backbone and the pHZP-sgRNA plasmid fragment with Bsa1, ligate them in vitro at 16 °C using the T4 ligase kit and chemically transform them into DH5α (ligate the self-assembled I-1gRNA sequence with the pHZP-sgRNA digested with Bsa1). Spread on an LB plate containing ampicillin antibiotic at a final concentration of 100 μg / mL and culture overnight at 30 °C until transformants appear. Randomly pick several transformants and perform colony PCR verification using primers PpgRNA-ver-f1 / I-1gRNA-r, with a length of 310 bp. Inoculate the transformants with correct colony PCR verification into an LB test tube containing 100 μg / mL ampicillin antibiotic, culture overnight at 30 °C and 220 rpm, and extract the plasmid. Send the plasmid for sequencing, with the sequencing primer being PpgRNA-ver-f1 (sequence: CCATTATTATCATGACATTAACC), and perform 1 reaction. Finally, name the plasmid pI-1gRNA.

[0089] 2.3 Construct the gRNA plasmid pII-6gRNA targeting the Pichia pastoris chromosome II-6 locus;

[0090] II-6gRNA sequence: CAACTCGAATTATAGTGGCG

[0091] The synthesized primer pair is:

[0092] II-6gRNA-f: ACGC CAACTCGAATTATAGTGGCG

[0093] II-6gRNA-r: AAAC CGCCACTATAATTCGAGTTG.

[0094] Similar to the construction method of the pI-1gRNA plasmid, the difference is that after annealing and self-assembling the II-6gRNA-f / II-6gRNA-r primers, ligate them with the backbone recovered by Bsa1 digestion and transform the Escherichia coli competent cells; the primers for colony PCR verification are PpgRNA-ver-f1 / II-6gRNA-r, and finally name the plasmid pII-6gRNA.

[0095] 2.4 Construct the gRNA plasmid pII-10gRNA targeting the Pichia pastoris chromosome II-10 locus;

[0096] II-10 gRNA sequence: AATTACTTCGGGAATAATGG

[0097] The synthetic primer pair is as follows:

[0098] II-10 gRNA-f: ACGC AATTACTTCGGGAATAATGG

[0099] II-10 gRNA-r: AAAC CCATTATTCCCGAAGTAATT.

[0100] Similar to the construction method of the pI-1 gRNA plasmid, the difference is that after annealing and self-assembling the II-10 gRNA-f / II-10 gRNA-r primers, they are ligated to the backbone recovered by Bsa1 digestion and transformed into Escherichia coli competent cells; the primers for colony PCR verification are PpgRNA-ver-f1 / II-10 gRNA-r, and the final plasmid is named pII-10 gRNA.

[0101] The results are as Figure 3 shown. Figure 3 Among them, lane 1 is the verification of the pI-1 gRNA plasmid using the PpgRNA-ver-f1 / I-1 gRNA-r primer pair, lane 2 is the verification of the pII-6 gRNA plasmid using the PpgRNA-ver-f1 / II-6 gRNA-r primer pair, and lane 3 is the verification of the pII-10 gRNA plasmid using the PpgRNA-ver-f1 / I-1 gRNA-r primer pair. Lane P is the positive control, and lane N is the blank (water) control.

[0102] 3. Construction of the donor plasmid for integrating genes into the chromosome of Pichia pastoris

[0103] The corresponding relationships among the target gene, integration site, gRNA plasmid, and donor plasmid are shown in Table 1.

[0104] Table 1

[0105]

[0106]

[0107] 3.1 Construction of the pI-1int integration backbone plasmid at the Chr_I-1 site

[0108] Using the genome of Pichia pastoris GS115 as a template, the 500 bp homologous arm upstream of I-1 was amplified using primer pair I-1uparm-f1 / I-1uparm-r1. The 500 bp homologous arm downstream of I-1 was amplified using primer pair I-1downarm-f1 / I-1downarm-r1. The upstream and downstream homologous arms were ligated by overlap PCR, and the primer pair was I-1uparm-f1 / I-1downarm-r1. After double digestion with SalI+HindIII, it was ligated into the pUC19 plasmid that was also digested with SalI+HindIII. Verification by colony PCR using primer pair int-ver-f1 / int-ver-r1 showed that the target band was 588 bp. The plasmid was extracted from the correct transformants of colony PCR, and verification by digestion with Not1 showed bands of 2682+1028 bp. The correct plasmid was named pI-1int.

[0109] 3.2 Construction of the integration backbone plasmid pII-6int at the Chr_II-6 locus

[0110] Using the genome of Pichia pastoris GS115 as a template, the 500 bp homologous arm upstream of II-6 was amplified using primer pair II-6uparm-f1 / II-6uparm-r1. The 500 bp homologous arm downstream of II-6 was amplified using primer pair II-6downarm-f1 / II-6downarm-r1. The upstream and downstream homologous arms were ligated by overlap PCR, and the primer pair was II-6uparm-f1 / II-6downarm-r1. After double digestion with SalI+HindIII, it was ligated into the pUC19 plasmid that was also digested with SalI+HindIII. Verification by colony PCR using int-ver-f1 / int-ver-r1 showed that the target band was 588 bp. The plasmid was extracted from the correct transformants of colony PCR, and verification by digestion with Not1 showed bands of 2682+1028 bp. The correct plasmid was named pII-6int.

[0111] 3.3 Construction of the integration backbone plasmid pII-10int at the Chr_II-10 locus

[0112] Using the genome of Pichia pastoris GS115 as a template, the 500-bp homologous arm upstream of II-10 was amplified using the primer pair II-10uparm-f1 / II-10uparm-r1. The 500-bp homologous arm downstream of II-10 was amplified using the primer pair II-10downarm-f1 / II-10downarm-r1. The upstream and downstream homologous arms were ligated by overlap PCR, and the primer pair was II-10uparm-f1 / II-10downarm-r1. After double digestion with SalI+HindIII, it was ligated into the pUC19 plasmid that was also digested with SalI+HindIII. The recombinant plasmid was verified by colony PCR using int-ver-f1 / int-ver-r1, and the target band was 588 bp. The plasmid of the correct colony PCR transformant was extracted and verified by digestion with Not1, and the bands were 2682+1028 bp. The correct plasmid was named pII-10int.

[0113] 3.4 Construction of AOX1 integration plasmid pI-1AOX1

[0114] Using the genome of Pichia pastoris GS115 as a template, the GAP promoter (506 bp) was amplified using the primer pair GAPp-f1 / GAPp-AOX1-r1. The AOX1 (CDS 2033 bp) was amplified using the primer pair AOX1-f1 / AOX1-r1 (sequences are shown in SEQ ID NO.1 and SEQ ID NO.2). The AOX1 terminator (275 bp) was amplified using the primer pair AOX1t-AOX1-f1 / AOX1t-r1. The above three fragments were ligated by overlap PCR, and the primer pair was GAPp-f1 / AOX1t-r1. After double digestion with MssI+SgsI, it was ligated into the pI-1int plasmid that was also digested with MssI+SgsI. The recombinant plasmid was verified by colony PCR using int-ver-f1 / 3'AOX1, and the target band was 3073 bp. The plasmid of the correct colony PCR transformant was extracted and verified by digestion with MssI+Sgs1, and the bands were 2722+3700 bp. The correct plasmid was named pI-1AOX1.

[0115] 3.5 Construction of AOX2 integration plasmid pII-6AOX2

[0116] Using the Pichia pastoris GS115 genome as a template, the GAP promoter (506 bp) was amplified using the primer pair GAPp-f1 / GAPp-AOX2-r1. The AOX2 (CDS 2033 bp) was amplified using the primer pair AOX2-f1 / AOX2-r1 (sequences are shown in SEQ ID NO.3 and SEQ ID NO.4). The AOX2 terminator (275 bp) was amplified using the primer pair AOX1t-AOX2-f1 / AOX1t-r1. The above three fragments were ligated by overlap PCR with the primer pair GAPp-f1 / AOX1t-r1. After double digestion with MssI+SgsI, it was ligated into the pII-10int plasmid that was also digested with MssI+SgsI. The primer int-ver-f1 / 3'AOX1 was used for bacterial P verification, and the target band was 3073 bp. The plasmid was extracted from the correct transformants of bacterial P and verified by digestion with MssI+SgsI, and the bands were 2722+3700 bp. The correct plasmid was named pII-10AOX2.

[0117] 3.6 Construction of the integration plasmid pII-10DAS1

[0118] Using the Pichia pastoris GS115 genome as a template, the GAP promoter (506 bp) was amplified using the primer pair GAPp-f1 / GAPp-DAS1-r1. The DAS1 (CDS 2165 bp) was amplified using the primer pair DAS1-f1 / DAS1-r1 (sequences are shown in SEQ ID NO.5 and SEQ ID NO.6). The AOX1 terminator (275 bp) was amplified using the primer pair AOX1t-DAS1-f1 / AOX1t-r1. The above three fragments were ligated by overlap PCR with the primer pair GAPp-f1 / AOX1t-r1. After double digestion with MssI+SgsI, it was ligated into the pII-10int plasmid that was also digested with MssI+SgsI. The primer int-ver-f1 / 3'AOX1 was used for bacterial P verification, and the target band was 3205 bp. The plasmid was extracted from the correct transformants of bacterial P and verified by digestion with MssI+SgsI, and the bands were 2854+3700 bp. The correct plasmid was named pII-10DAS1.

[0119] The results are as Figure 4 shown, Figure 4 In the figure, pI-1AOX1 (lane 1), pII-6AOX2 (lane 2), and pII-10DAS1 (lane 3) were respectively verified by double digestion with MssI+SgsI, and two bands were cut out, and the sizes were consistent with the expectations.

[0120] 4. Construction of overexpressing Pichia pastoris strains

[0121] 4.1 Construction of Pichia pastoris strains overexpressing the AOX1 gene

[0122] Prepare GS115-Cas9 Pichia pastoris competent cells, co-transform 500 ng of pI-1gRNA plasmid and 1000 ng of pI-1AOX1 plasmid recovered by NotI digestion into GS115-Cas9 cells, and screen on YPD-Zeo (add zeocin antibiotic with a final concentration of 200 μg / mL to the YPD medium; YPD medium formula: Yeast extract, 10 g / L; Tryptone, 20 g / L; Glucose, 20 g / L) plates. Verify the transformants grown using the I-1-intver-f1 / GAPp-GAP-r1 primer pair by PCR. The target band is approximately 1000 bp. The successfully integrated engineering strain is named GS115-AOX1 and stored at low temperature in glycerol.

[0123] 4.2 Construction of Pichia pastoris strains overexpressing the AOX2 gene

[0124] Prepare GS115-Cas9 Pichia pastoris competent cells, co-transform 500 ng of pII-6gRNA plasmid and 1000 ng of pII-6AOX2 plasmid recovered by NotI digestion into GS115-Cas9 cells, and screen on YPD-Zeo plates. Verify the transformants grown using the II-6-intver-f1 / GAPp-GAP-r1 primer pair by PCR. The target band is approximately 1000 bp. The successfully integrated engineering strain is named GS115-AOX2 and stored at low temperature in glycerol.

[0125] 4.3 Construction of Pichia pastoris strains overexpressing the DAS1 gene

[0126] Prepare GS115-Cas9 Pichia pastoris competent cells, co-transform 500 ng of pII-10gRNA plasmid and 1000 ng of pII-10DAS1 plasmid recovered by NotI digestion into GS115-Cas9 cells, and screen on YPD-Zeo plates. Verify the transformants grown using the II-10-intver-f1 / GAPp-GAP-r1 primer pair by PCR. The target band is approximately 1000 bp. The successfully integrated engineering strain is named GS115-DAS1 and stored at low temperature in glycerol.

[0127] 4.4 Construction of Pichia pastoris strains overexpressing the AOX1 / AOX2 genes

[0128] Prepare GS115-AOX1 Pichia pastoris competent cells. Transform 500 ng of pII-6gRNA plasmid and 1000 ng of pII-6AOX2 plasmid recovered by NotI digestion into GS115-AOX1 cells, and screen on YPD-Zeo plates. Verify the transformants grown using the primers II-6-intver-f1 / GAPp-GAP-r1 by colony PCR. The target band is approximately 1000 bp. The successfully integrated engineered strain is named GS115-AOX1 / AOX2 and stored at low temperature in glycerol.

[0129] 4.5 Construction of Pichia pastoris strains overexpressing AOX1 / DAS1 genes

[0130] Prepare GS115-AOX1 Pichia pastoris competent cells. Transform 500 ng of pII-6gRNA plasmid and 1000 ng of pII-10DAS1 plasmid recovered by NotI digestion into GS115-AOX1 cells, and screen on YPD-Zeo plates. Verify the transformants grown using the primers II-10-intver-f1 / GAPp-GAP-r1 by colony PCR. The target band is approximately 1000 bp. The successfully integrated engineered strain is named GS115-AOX1 / DAS1 and stored at low temperature in glycerol.

[0131] 4.6 Construction of Pichia pastoris strains overexpressing AOX2 / DAS1 genes

[0132] Prepare GS115-AOX2 Pichia pastoris competent cells. Transform 500 ng of pII-10gRNA plasmid and 1000 ng of pII-10DAS1 plasmid recovered by NotI digestion into GS115-AOX2 cells, and screen on YPD-Zeo plates. Verify the transformants grown using the primers II-10-intver-f1 / GAPp-GAP-r1 by colony PCR. The target band is approximately 1000 bp. The successfully integrated engineered strain is named GS115-AOX2 / DAS1 and stored at low temperature in glycerol.

[0133] 4.7 Construction of Pichia pastoris strains overexpressing AOX1 / AOX2 / DAS1 genes

[0134] Prepare the GS115-AOX1 / AOX2 Pichia pastoris competent cells. Transform 500 ng of the pII-10gRNA plasmid and 1000 ng of the pII-10DAS1 plasmid recovered by NotI digestion into the GS115-AOX1 / AOX2 cells, and screen on the YPD-Zeo plate. Verify the transformants using the II-10-intver-f1 / GAPp-GAP-r1 primer pair. The target band is approximately 1000 bp. Name the successfully integrated engineering strain GS115-AOX1 / AOX2 / DAS1 and store it at low temperature in glycerol.

[0135] The results are as Figure 5 shown. For the constructed strains GS115-AOX1 (lane 1), GS115-AOX2 (lane 2), GS115-DAS1 (lane 3), GS115-AOX1 / AOX2 (lane 4), GS115-AOX1 / DAS1 (lane 5), GS115-AOX2 / DAS1 (lane 6), and GS115-AOX1 / AOX2 / DAS1 (lane 7), verify the genotypes using the verification primers. It can be seen from Figure 5 this that the target gene is integrated into a specific position, the genotype verification is correct, and subsequent phenotypic verification can be carried out.

[0136] Some of the primers used in Example 1 are shown in Table 2.

[0137] Table 2

[0138]

[0139]

[0140] 5. Performance testing of the engineering strain

[0141] 5.1 Methanol consumption ability test of the engineering strain

[0142] Streak the various engineering strains stored in glycerol in step 4 onto YPD plates. After overnight recovery at 30 °C, transfer them to 3 mL YPD test tubes. After growing for 24 h, inoculate them into 25 mL of BMMY medium containing 6% (volume fraction) methanol concentration. Regularly take samples to measure the methanol concentration in the medium. The methanol concentration is measured by HPLC. The detection conditions are as follows: Shimadzu LC-2030C liquid chromatograph, Biorad HPX-87H liquid chromatography column. RID differential detector. Column temperature 65 °C, mobile phase 5 mM dilute sulfuric acid, flow rate 0.6 mL / min.

[0143] 5.2 Determination of intracellular formaldehyde content in the engineering strain

[0144] The various engineered strains preserved in glycerol in step 4 were streaked onto YPD plates, revived overnight at 30°C, and finally transferred to 3mL YPD test tubes. When grown to mid-logarithmic phase, the cells were centrifuged at 5000×g for 10min, and the bacterial cells were collected, washed three times, and resuspended in 1mL PBS buffer (pH=7.4). An equal volume of cell lysate was added, and then incubated at 37°C for 30min. After centrifugation, the supernatant was collected, and 50μL of the supernatant was added to an EP tube. Then 150μL of NASH reagent (5M ammonium acetate, 50mM acetylacetone, and 135mM acetic acid) was added. Keep on ice, then incubate at 37°C for 10 minutes, and read the absorbance at 414nm. The formaldehyde concentration is expressed as μM / OD.

[0145] 5.3 Determination of protein content in engineered strains

[0146] The various engineered strains preserved in glycerol in step 4 were streaked onto YPD plates, revived at 30°C overnight, and inoculated into Delft minimal medium with a methanol concentration of 6% (volume fraction) and an initial OD600 of 0.5. After growing to the mid-logarithmic growth period, 3 mL of the sample was taken, washed 3 times with sterile distilled water, and resuspended in 1 mL of sterile distilled water. Dry at 105°C until the cells are constant weight. The total nitrogen content was determined using a Kjeldahl nitrogen analyzer and converted to total protein content by multiplying by a coefficient of 6.25.

[0147] The performance test results are:

[0148] from Figure 6 It can be concluded that the methanol consumption capacity of the engineered strains was tested using BMMY medium with a methanol concentration of 6%. The methanol consumption capacity of the strains overexpressing AOX1 and AOX2 was comparable, both better than the control strain GS115. The effect of expressing DAS1 alone was not as good as that of overexpressing AOX1 alone or overexpressing AOX2 alone, but it was also better than the control strain. The methanol consumption capacity of the double overexpression strains GS115-AOX1 / AOX2, GS115-AOX1 / DAS1, and GS115-AOX2 / DAS1 was improved on the basis of the single overexpression strains, and the best phenotype was the triple overexpression strain GS115-AOX1 / AOX2 / DAS1. The above results show that overexpressing the AOX1 / AOX2 / DAS1 genes alone or in combination can improve the methanol utilization capacity of the strain.

[0149] Depend on Figure 7 It can be seen that overexpression of alcohol oxidase genes AOX1 or AOX2 alone or in combination can significantly increase intracellular formaldehyde content, and overexpression of dihydroxyacetone phosphate synthase DAS1 alone can quickly convert formaldehyde and greatly reduce intracellular formaldehyde content. Overexpression of the three genes further reduced intracellular formaldehyde content because the overall pathway from methanol to downstream glyceraldehyde 3phosphate and dihydroxyacetone phosphate was strengthened.

[0150] It can be obtained from Figure 8 that under the condition of 6% methanol concentration, the cell protein concentration of the tested recombinant Pichia pastoris strains was determined after 96 h. The cell protein concentrations of the strains overexpressing the AOX1, AOX2, and DAS1 genes alone or in combination were 0.56, 0.54, 0.52, 0.60, 0.63, 0.62, and 0.67 g / g DCW, respectively, which were significantly better than that of the control strain (0.50 g / g DCW).

Claims

1. A method for improving the methanol utilization ability of Pichia pastoris by overexpressing methanol utilization pathway genes, characterized in that: Enhanced methanol oxidation pathway.

2. The method according to claim 1, characterized in that The enhanced methanol oxidation pathway is achieved by enhancing methanol oxidase-related genes, and the methanol oxidase-related genes include AOX1 Alcohol oxidase, AOX2 Alcohol oxidase, DAS1 One or more of dihydroxyacetone phosphate synthase.

3. The method according to claim 2, characterized in that The gene enhancement is to integrate the gene to be enhanced into the chromosome, and this process is regulated by the GAP promoter.

4. The method according to claim 3, characterized in that The gene integration is achieved by the CRISPR-Cas9 method; the method comprises the following steps: 1) Construction of Pichia pastoris strain expressing Cas9 protein Prepare Pichia competent cells, activate and culture Escherichia coli containing the expression plasmid pGAP-Cas9, extract the plasmid, linearize the plasmid, introduce the linearized plasmid into Pichia competent cells, apply it to the screening medium, identify the genotype of the grown transformants, and obtain the target strain; 2) Construction of gRNA plasmid for integration of Pichia pastoris chromosome The pHZP-sgRNA plasmid was linearized and the fragments were recovered by gel for later use; the gRNA plasmid targeting the Pichia pastoris chromosome integration site was constructed; 3) Construction of gene donor plasmid for integration into Pichia pastoris chromosome Select the integration site on the chromosome of Pichia pastoris, construct and linearize the integration backbone plasmid, connect the methanol oxidase-related gene to the integration backbone plasmid, and obtain the target gene integration plasmid; 4) Construction of overexpression Pichia pastoris strain Prepare Pichia competent cells, transform the gRNA plasmid constructed in step 2) and the target gene integration plasmid constructed in step 3) into Pichia competent cells, culture, screen, and verify to obtain Pichia engineered bacteria that can improve methanol utilization ability.

5. The method according to claim 4, characterized in that In step 2), the targeted Pichia pastoris chromosome integration sites include site I-1, site II-6, and site II-10.

6. The method according to claim 4, characterized in that In step 2), when constructing the gRNA plasmid targeting the Pichia pastoris chromosome integration site, the gRNA backbone sequence is annealed to form a double-stranded sequence, and then the gRNA backbone is connected to the pHZP-sgRNA plasmid fragment after enzyme digestion in vitro and transformed into Escherichia coli competent cells, and cultured on a screening medium to obtain transformants, extract the plasmid, and obtain the gRNA plasmid targeting the Pichia pastoris chromosome integration site.

7. The method according to claim 4, characterized in that In step 3), when constructing the integration backbone plasmid, the Pichia pastoris genome is used as a template, and a primer pair is used to amplify the upstream homology arm and the downstream homology arm of the integration site. The upstream and downstream homology arms are overlapped by PCR and connected to the pUC19 plasmid after double restriction digestion. The plasmid is verified by bacterial P.

8. The method according to claim 4, characterized in that In step 3), methanol oxidase-related genes include AOX1 Alcohol oxidase, AOX2 Alcohol oxidase, DAS1 One or more of dihydroxyacetone phosphate synthase.

9. An engineered Pichia pastoris obtained by the method according to any one of claims 1 to 8.

10. Use of the Pichia pastoris engineered bacteria according to claim 9 in improving methanol utilization.

Images