Application of Brachypodium distachyon BdSTAR1 protein and its coding gene in regulating plant seed grain length

By studying the BdSTAR1 protein of the 2-spike schizophrenia and its encoding gene, the gap in ABC family proteins in the regulation of seed length was solved, and the seed length was regulated through genetic engineering was realized, and a method to regulate seed particle type was provided, which had important agricultural application value.

CN120060349BActive Publication Date: 2025-07-18SHANDONG AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510525256.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-25
Publication Date
2025-07-18
Estimated Expiration
2045-04-25

AI Technical Summary

Technical Problem

The functional research of ABC family proteins in the prior art is relatively limited, especially the research of the ABCH subfamily in plants has not yet been thorough, and there are no relevant reports on its regulating plant seed particle length.

Method used

By studying the BdSTAR1 protein of the 2-spike schizophrenia and its encoding gene, it was found that it was related to plant seed particle length. The seed particle length was regulated by overexpression or knockout of the gene, and genetic engineering methods were used to achieve the regulation of seed particle length in plants.

Benefits of technology

Effective regulation of plant seed particle length is achieved. Overexpression of the BdSTAR1 gene increases seed particle length, and knocking out or silencing the BdSTAR1 gene shortens the seed particle length, providing a method to regulate seed particle type in agricultural production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060349B_ABST
    Figure CN120060349B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of the Brachypodium distachyon BdSTAR1 protein and its encoding gene in regulating the grain length of plant seeds, belonging to the technical field of plant genetic engineering. The present invention for the first time discovers that the Brachypodium distachyon BdSTAR1 gene is related to the grain length of plant seeds, and overexpression of the Brachypodium distachyon BdSTAR1 gene can increase the grain length of plant seeds; knocking out or silencing the Brachypodium distachyon BdSTAR1 gene can shorten the grain length of plant seeds. Therefore, by regulating the Brachypodium distachyon BdSTAR1 gene, corresponding plant varieties can be cultivated according to the requirements for the grain shape of plant seeds, which has important application value in agricultural production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and specifically relates to the application of BdSTAR1 protein of Brachypodium distachyon and its coding gene in regulating the grain length of plant seeds. Background Art

[0002] Brachypodium distachyon ( Brachypodium distachyon ), has the smallest genome among the known gramineous plants so far, only 272 Mbp. Brachypodium distachyon is closely related to wheat, and the similarity between their genomes is more than 95%. Moreover, as a weed, Brachypodium distachyon has the advantages of small plant type, easy cultivation, short life cycle, self-pollination, and easy genetic transformation. Therefore, Brachypodium distachyon is an ideal new model material for studying wheat and rice crops.

[0003] ABC transporters, also known as ATP-binding cassette transporters (ABC), are named because they contain an adenosine triphosphate (ATP) binding cassette, and can achieve the transmembrane transport of substrates inside and outside the cell depending on the energy generated by ATP hydrolysis. They are currently the class of proteins with the largest number and the most functions known. Currently, 130 and 128 gene family members have been successfully identified in Arabidopsis thaliana and rice respectively. However, there are few reports on its related family members. In addition, there are also reports on ABC family members in species such as wheat, corn, and tomato, but the transport substrates and functions of most members are still unclear.

[0004] According to the international nomenclature system, plant ABC proteins are divided into eight subfamilies: ABCA-ABCG and ABCI. At present, no protein of the ABCH subfamily has been found in plants, and the ABCI family is a special type of fungus. Among the ABC families, more research has been done on the four subfamilies ABCA, ABCB, ABCC, and ABCG.

[0005] The ABCA subfamily includes the full molecule protein AOH and the half molecule protein ATH. At present, only 12 subfamily members of ABCA have been identified in Arabidopsis thaliana, and it is speculated that they play a certain role in the lipid transport of plants. In addition, some ABCA family proteins have also been identified in species such as cucumber and tomato, and they may be involved in the secretion activity of roots and have specific functions in flower organs respectively.

[0006] ABCB is the second largest subfamily of ABC family proteins, and currently 29 ABCB members have been found in Arabidopsis thaliana. Most of the identified ABCB members are mainly related to the transport and regulation of hormonal substances. In addition, studies in tomatoes have found that ABCB is also involved in ion and heavy metal transport. For example, SlABCB is highly expressed in roots, suggesting that it may be involved in ion and heavy metal transport in roots. In addition, ABC also has the functions of transporting alkaloids and maintaining iron homeostasis.

[0007] The functions of ABCC subfamily proteins include transporting metabolites (such as anthocyanins, phytic acid, folic acid, etc.). For example, ZmMRP3 in maize, VvABCCl in grapes, and AtABCC2 in Arabidopsis thaliana have all been proven to have the function of transporting anthocyanins in vacuoles. Another main function of the C subfamily is detoxification. In Arabidopsis thaliana, AtABCCl and AtABCC2 have been proven to be tolerant to arsenic, cadmium, and mercury.

[0008] The ABCG subfamily proteins are the largest subfamily among ABC family proteins and are also the type of subproteins with the most functions. It includes two types: full-molecule PDR proteins and half-molecule WBC proteins. Currently, ABCG subfamily proteins have been identified in many plants. For the functions they perform, they mainly include: transporting metabolites in plants, including lipids, alkenes, alkaloids, etc. Secondly, they mediate the transport of hormones such as ABA substances. For example, AtABCG25 and AtABCG31 both have the function of transporting abscisic acid (ABA). In addition, ABCG is involved in heavy metal stress / adverse stress responses and can improve the stress resistance of plants to abiotic stresses. Except for the relatively more reports on the four subfamilies of ABCA, ABCB, ABCC, and ABCG in the ABC family proteins, most of the members of the remaining subfamilies have not been identified or their functions have not been discovered.

[0009] In rice, Os STAR1 genes have been identified to be involved in regulating the aluminum toxicity tolerance pathway. Os STAR1 genes belong to the ABC transporter family, encode an NBD domain, and are closely related to At NAP3 in Arabidopsis thaliana. This gene is located in the vesicular granules of root cells, and its function of aluminum toxicity tolerance is through interaction with Os STAR2 to form a complex, which is located on the vesicle membrane of root cells. Os STAR2 genes also belong to the ABC family transporter family and encode a TMD domain. The complex formed by the two functions as an ABC transporter. The ABC transporter transports UDP-glucose, and UDP-glucose can be activated to form UDP-glc, which is used as a substrate for glycosyltransferases to synthesize various glycosides. Os STAR1 and Os STAR2The formed complex has an efflux transport activity for UDP-glc. For Os STAR1 and Os STAR2 The connection between the complex and aluminum tolerance needs to be further studied. There are currently two possibilities. One is that UDP-Glc may act as a chelating agent like organic acid anions, so it relieves aluminum toxicity by forming non-toxic complexes with aluminum; the other is OsSTAR1 / OsSTAR2 The complex transports UDP-Glc from the cytoplasm to vesicles. Then, UDP-Glc or the glycosides derived from it are released from the vesicles to the apoplast by exocytosis and used to modify the cell wall to mask aluminum-binding sites, thereby improving the aluminum tolerance of rice.

[0010] Currently, for STAR1 The research on the gene and its homologous genes in other species, including Arabidopsis thaliana, rice, and buckwheat, etc., only shows that the gene and its homologous genes can improve the aluminum tolerance of plants, and there is no relevant report on the impact on other agronomic traits. Summary of the Invention

[0011] In view of the above-mentioned prior art, the object of the present invention is to provide the application of Brachypodium distachyon BdSTAR1 protein and its encoding gene in regulating the grain length of plant seeds.

[0012] To achieve the above object, the present invention adopts the following technical solutions:

[0013] In the first aspect of the present invention, the application of Brachypodium distachyon BdSTAR1 protein in regulating the grain length of plant seeds; the Brachypodium distachyon BdSTAR1 protein is a protein shown in the following (A1) or (A2):

[0014] (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.3 in the sequence listing;

[0015] (A2) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0016] In the above application, the plant is Brachypodium distachyon, wheat, rice, and / or Arabidopsis thaliana.

[0017] In the second aspect of the present invention, the application of Brachypodium distachyon BdSTAR1 gene in the following (1) or (2):

[0018] (1) Regulating the grain length of plant seeds;

[0019] (2) Plant breeding;

[0020] The Brachypodium distachyon BdSTAR1 gene is a DNA molecule shown in the following i), ii), or iii):

[0021] i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1;

[0022] ii) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.2;

[0023] iii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO.3 other than i) or ii).

[0024] In the above application, the plant is Brachypodium distachyon, wheat, rice and / or Arabidopsis thaliana.

[0025] The present invention has found through research that: Brachypodium distachyon BdSTAR1 gene and its encoded protein are related to seed grain length. Overexpression of the Brachypodium distachyon BdSTAR1 gene can make the seed grain length longer; while knocking out or silencing the Brachypodium distachyon BdSTAR1 gene will make the seed grain length shorter. Therefore, taking the Brachypodium distachyon BdSTAR1 gene and its encoded protein as targets, the seed grain length trait can be regulated accordingly by regulating their expression; breeding corresponding varieties according to the requirements for plant seed grain shape.

[0026] In the third aspect of the present invention, there is provided the use of a recombinant expression vector or a genetically engineered bacterium containing the Brachypodium distachyon BdSTAR1 gene in the following (1) or (2):

[0027] (1) Regulating the seed grain length of plants;

[0028] (2) Plant breeding.

[0029] In the above application, the recombinant expression vector is an overexpression vector of the Brachypodium distachyon BdSTAR1 gene, or a knockout vector targeting the Brachypodium distachyon BdSTAR1 gene.

[0030] In the fourth aspect of the present invention, there is provided a method for regulating the seed grain length of plants, comprising the following steps:

[0031] Exogenously transfer the Brachypodium distachyon BdSTAR1 gene into a wild-type plant to overexpress the Brachypodium distachyon BdSTAR1 gene, and obtain a transgenic plant, the seed grain length of which is greater than that of the wild-type plant;

[0032] Or, knock out or silence the Brachypodium distachyon BdSTAR1 gene in a wild-type plant to obtain a mutant plant, the seed grain length of which is less than that of the wild-type plant.

[0033] In the above method, transferring the Brachypodium distachyon BdSTAR1 gene into wild-type plants includes: polyethylene glycol method, Agrobacterium-mediated method or gene gun bombardment method.

[0034] In the above method, the Brachypodium distachyon BdSTAR1 gene can be knocked out or silenced by genetic engineering means to inhibit the BdSTAR1 gene expression or reduce the activity of BdSTAR1 protein.

[0035] Advantages of the present invention:

[0036] The present invention discovers for the first time that the Brachypodium distachyon BdSTAR1 gene is related to the grain length of plant seeds. Overexpressing the Brachypodium distachyon BdSTAR1 gene can increase the grain length of plant seeds; knocking out or silencing the Brachypodium distachyon BdSTAR1 gene can shorten the grain length of plant seeds. Therefore, by regulating the Brachypodium distachyon BdSTAR1 gene, corresponding plant varieties can be cultivated according to the requirements of plant seed grain types, which has important application value in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 : bdstar1 Insertion site of mutant Ds (A) and bdstar1 transcription level of the BdSTAR1 gene in the mutant (B).

[0038] Figure 2 : Seed grain length phenotypes (A) and statistical data of grain length (B) of wild-type Brachypodium distachyon (WT) and bdstar1 the mutant.

[0039] Figure 3 : PCR amplification BdSTAR1 electrophoresis bands for gene detection.

[0040] Figure 4 : BdSTAR1 Results of tissue-specific expression analysis of the gene.

[0041] Figure 5 : A: BdSTAR1 PAM site of the gene B: BdSTAR1 Analysis of the expression level of the T0 generation positive seedlings of gene knockout, C: BdSTAR1 Statistics of the grain length of the T1 generation positive seedlings of gene knockout.

[0042] Figure 6 : A: BdSTAR1 Construction of the overexpression vector of the gene, B: BdSTAR1 Analysis of the expression level of the T0 generation positive seedlings of gene overexpression, C:BdSTAR1 Statistical analysis of the seed grain length of the T1 generation positive seedlings with gene overexpression.

[0043] Figure 7 : A: BdSTAR1 Construction of the vector for the gene complementation positive seedlings, B: BdSTAR1 Analysis of the expression level of the gene complementation T0 generation positive seedlings, C: BdSTAR1 Statistical analysis of the seed grain length of the gene T0 generation positive seedlings. Detailed implementation manners

[0044] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present application belongs.

[0045] The grain shape of plant seeds includes grain length, grain width, grain thickness, length / width ratio, etc. The grain shape of seeds is not only an important factor affecting yield traits but also an important indicator for measuring the appearance quality of products. For plants such as rice and wheat, the grain length of seeds particularly reflects their appearance quality. Therefore, it is necessary to study the genes that regulate the grain length of plant seeds.

[0046] The present invention utilizes a previously constructed Brachypodium distachyon mutant library to discover a Ds mutant with an element inserted into the intron of the Brachypodium distachyon BdSTAR1 gene bdstar1 . Observation of the seed phenotype of the bdstar1 mutant found that the seed grain length was significantly shorter than that of the wild type. It can be inferred therefrom that the BdSTAR1 gene may be related to the grain length of plant seeds.

[0047] Then, using the genomic database website EnsemblPlants to find the candidate gene BRADI_1g33777v3, which is named BdSTAR1 , BdSTAR1 The full length of the BdSTAR1 gene is 3482 bp, and its nucleotide sequence is shown in SEQ ID NO.1. The CDS sequence of the

[0048] gene is shown in SEQ ID NO.2; the amino acid sequence of the BdSTAR1 protein is shown in SEQ ID NO.3. BdSTAR1 To further study the function of the BdSTAR1 gene, the present invention respectively constructs knockout plants, overexpression plants and complementary BdSTAR1 gene plants of the BdSTAR1 gene. The results show that: after knocking out the BdSTAR1After the gene was introduced, the seed length increased by 5%-8% compared to the wild-type seeds under the same growth conditions; the complementary BdSTAR1 The seed length of the gene-complemented plants changed from a decrease of 18%-20% to a decrease of 8%-12% compared to the wild-type plants, and the phenotype of the shorter seed length of the mutant could be rescued to a certain extent.

[0049] In summary, BdSTAR1 The gene is involved in regulating the seed length of plants and can be applied in agricultural production.

[0050] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0051] The test materials not specifically described in the embodiments of the present invention are all conventional test materials in the art and can be obtained through commercial channels. For those not specified in the embodiments of the present invention regarding specific experimental conditions and methods, they are usually in accordance with conventional conditions, such as Molecular Cloning: A Laboratory Manual (Third Edition) edited by J. Sambrook et al., Science Press, 2002; Guide to Cell Experiment edited by D.L. Spector et al., Science Press, 2001; or in accordance with the conditions recommended by the manufacturer. Among them:

[0052] Callus induction medium: 4.74 g of MS medium (without agar and sucrose), 2.5 mL of 2,4-D (1 mg / mL), 30 g of sucrose, 0.5 g of 4-morpholineethanesulfonic acid, 0.5 g of acid-hydrolyzed casein, add ddH2O to 1 L.

[0053] First screening medium: 4.74 g of MS medium (without agar and sucrose), 2.5 mL of 2,4-D (1 mg / mL), 100 μL of 6-BA (1 mg / mL), 30 g of sucrose, 0.5 g of 4-morpholineethanesulfonic acid, 100 mg of inositol, 75 μL of CuSO4(8mg / L), add ddH2O to 1 L.

[0054] Second screening medium: 4.74 g of MS medium (without agar and sucrose), 2.5 mL of 2,4-D (1 mg / mL), 100 μL of 6-BA (1 mg / mL), 18 g of sucrose, 0.5 g of 4-morpholineethanesulfonic acid, 100 mg of inositol, 75 μL of CuSO4(8mg / L), add ddH2O to 1 L.

[0055] Differentiation medium: 4.74 g of MS medium (without agar and sucrose), 30 g of sucrose, 0.5 g of 4-morpholineethanesulfonic acid, 400 μL of KT (1 mg / mL), 500 mg of hydrolyzed casein, 100 mg of inositol, 400 μL of 6-BA (1 mg / mL), add ddH2O to 1 L.

[0056] Rooting medium: 4.74 g of MS medium (without agar and sucrose), 10 g of sucrose, 0.5 g of 4-morpholineethanesulfonic acid, 400 μL of NAA (1 mg / mL), add ddH2O to 1 L.

[0057] Example 1: bdstar1 Obtaining mutants and phenotypic detection

[0058] I. bdstar1 Obtaining mutants and BdSTAR1 gene expression level detection:

[0059] 1. Obtaining mutants:

[0060] Previously, the laboratory constructed a Brachypodium distachyon mutant library by AC / DS transposon tagging method (DOI: https: / / doi.org / 10.1104 / pp.18.00875). A mutant containing only DS element was screened from the constructed mutant library. Ds The insertion was in the intron of the BdSTAR1 gene of Brachypodium distachyon, so this mutant was named bdstar1 .

[0061] 2. BdSTAR1 Gene expression level detection:

[0062] Use TransZol of TransGen Biotech to extract bdstar1 RNA of the mutant and reverse transcribe to synthesize the first strand of cDNA. For the region before the Ds insertion site (region 1), the region across the Ds region (region 2), and the region after the insertion site (region 3) of the bdstar1 mutant, as shown in Figure 1 A below, design relative fluorescence quantitative PCR primers for transcriptional level analysis. According to the requirements of qRT-PCR primer design, use Primer Premier 3.0 software to design specific primers. The primer pair sequences are as follows:

[0063] qRT-Bd-STAR1-F1: 5′-AGACAATGTACGATACGGGC-3′; (SEQ ID NO.4)

[0064] qRT-Bd-STAR1-R1: 5′-GAGCACTTCTGGGTCGTTG-3′; (SEQ ID NO.5)

[0065] qRT-Bd-STAR1-F2: 5′-CAGACAATGTACGATACGGGCCG-3′; (SEQ ID NO.6)

[0066] qRT-Bd-STAR1-R2: 5'-CAGGAGCACTTCTGGGTCGTTG-3'; (SEQ ID NO.7)

[0067] qRT-Bd-STAR1-F3: 5'-ACCCTCGCCAACGACCCAGAA-3'; (SEQ ID NO.8)

[0068] qRT-Bd-STAR1-R3: 5'-TTCACGCTGTGCGACACCATCA-3'. (SEQ ID NO.9)

[0069] Using a 96-well plate dedicated for qRT-PCR and a high light transmittance sealing film, qRT-PCR analysis was performed with an Icycler real-time PCR system, with 3 replicates for each sample. Using the cDNA obtained above as a template, a reaction system was established. The reaction system was referred to the instruction manual of SYBR Green Realtime PCR Master Mix (QPK-201). The reaction conditions were as follows: pre-denaturation at 95°C for 60 seconds; denaturation at 95°C for 10 seconds, annealing at 58 ± 5.0°C for 30 seconds, extension at 72°C for 15 seconds, with a total of 40 cycles repeated; incubation at 65°C for 30 seconds, melting curve from 65 - 95°C, reading once every 0.5°C, maintaining for 1 second.

[0070] Mix multiple samples and perform the first amplification to detect whether the primers are available. Verify the specificity of primer amplification according to the melting curve. A single peak is considered specific amplification. If there are two peaks, appropriately adjust the annealing temperature and primer dosage. Use the mixed template to serially dilute by 10-fold concentration, a total of 4 times, and construct a relative standard curve with 5 concentrations of samples to verify the amplification efficiency of all primers and whether there is a linear amplification relationship for the target sequence within this concentration range. Using BdUBC18 as an internal reference, adjust the concentration of each template so that the difference in Ct values of the internal reference is less than 2. For each gene amplification, the internal reference is amplified simultaneously, and the Ct value is read under default conditions, with 3 replicates for each sample.

[0071] The results are as Figure 1 shown in B of BdSTAR1 where the gene transcription level was significantly reduced, indicating that bdstar1 the mutant caused BdSTAR1 gene silencing expression. And because Ds the expression level of the inserted segment (region 2) was severely down-regulated, it also indicated that Ds the transposon existed at this location, which was the mutation position.

[0072] II. bdstar1 Phenotype detection of mutants:

[0073] Using wild - type Brachypodium distachyon as a control, observe bdstar1 the phenotypes of mutant Brachypodium distachyon plants and count the length of ten seeds of the plants.

[0074] Results Figure 2 As shown bdstar1 the seeds of mutant Brachypodium distachyon plants are significantly shorter than those of the wild - type in seed grain length, indicating BdSTAR1 that after the gene function is deleted by mutation, it can significantly shorten the grain length of Brachypodium distachyon plant seeds.

[0075] Example 2: BdSTAR1 Cloning of the gene

[0076] Use TransZol from TransGen Biotech to extract bdstar1 the RNA of the mutant, reverse - transcribe to synthesize the first strand of cDNA, and use it as the cDNA template.

[0077] According to the CDS sequence of the Brachypodium distachyon BdSTAR1 gene, design BdSTAR1 a gene primer pair, and its sequence is (5’ - 3’):

[0078] Forward primer: 5′ - ATGGGCTCAGCATCAGATGACA - 3′; (SEQ ID NO.10)

[0079] Reverse primer: 5′ - TCAGCTGAGCTCCAGGAAGC - 3′. (SEQ ID NO.11)

[0080] Use 2×Phanta Max MasterMix for PCR amplification. The reaction system is: Mix 25μL, forward primer 2μL, reverse primer 2μL, cDNA template 1μL, and make up to 50μL with water.

[0081] The PCR reaction conditions are: pre - denaturation at 95℃ for 5 minutes; denaturation at 95℃ for 15 seconds, annealing at 58℃ for 15 seconds, extension at 72℃ for 2 minutes, repeat 35 cycles in total; post - extension at 72℃ for 5 minutes; keep at 15℃.

[0082] After the reaction is completed, perform agarose gel electrophoresis. After detecting the target band ( Figure 3 ), cut the gel and perform gel extraction. The gel extraction method is carried out according to the CW Biotech Agarose Gel DNA Extraction Kit. Sequence the amplified target band, and its nucleotide sequence is as shown in SEQ ID NO.2. It shows that the present invention has successfully cloned the BdSTAR1 gene.

[0083] Example 3: BdSTAR1 Analysis of tissue - specific expression of the gene

[0084] For the aerial part (1-Ov) and roots (1-R) of wild-type Brachypodium distachyon at the one-leaf stage; the first leaf (2-1L), the leaf sheath of the first leaf (2-1Sh), the first internode (2-1St), the second leaf (2-2L), the second internode (2-2St), the leaf sheath of the second leaf (2-2Sh), the emerging part (2-3Ou) and the enclosed part (2-3I) of the third leaf at the three-leaf stage; the fourth leaf (3-4L), the leaf sheath of the fourth leaf (3-4Sh), the emerging part (3-5Ou) and the enclosed part (3-5I) of the fifth leaf at the five-leaf stage; the young spike part (S), the fifth leaf (S-5L), the sixth leaf (S-6L), and the seventh leaf (S-7L) at the young spike stage of the plant. Samples were taken from different parts, RNA was extracted, and cDNA was synthesized by reverse transcription.

[0085] Use BdSTAR1 gene primer pairs for qRT-PCR analysis BdSTAR1 of tissue expression patterns:

[0086] Forward primer: 5′-ACCCTCGCCAACGACCCAGAA-3′; (SEQ ID NO.12)

[0087] Reverse primer: 5′-TTCACGCTGTGCGACACCATCA-3′. (SEQ ID NO.13)

[0088] Using a 96-well plate dedicated for qRT-PCR and a high light transmittance sealing film, qRT-PCR analysis was performed using an Icycler real-time PCR system. Each sample was repeated 3 times. Total RNA of the plant at the one-leaf stage was extracted and reverse transcribed to obtain cDNA, which was used as a template to establish a reaction system. The reaction system was referred to the SYBR Green Realtime PCR Master Mix (QPK-201) instruction manual. The reaction conditions were as follows: pre-denaturation at 95°C for 60 seconds; denaturation at 95°C for 10 seconds, annealing at 58±5.0°C for 30 seconds, extension at 72°C for 15 seconds, and a total of 50 - 60 cycles were repeated; incubation at 65°C for 20 seconds, melting curve from 65 - 95°C, reading once every 0.5°C and maintaining for 1 second. Using BdUBC18 as an internal reference, each sample was repeated three times.

[0089] The results are as Figure 4 shown, the BdSTAR1 gene of Brachypodium distachyon was expressed in all parts at all stages of Brachypodium distachyon, and the highest expression levels were observed in the young and un-emerged parts at the five-leaf stage.

[0090] Example 4: Construction of the genetic transformation vector of Brachypodium distachyon

[0091] 1. BdSTAR1 Construction of Gene Knockout Vector

[0092] (1) Input the BdSTAR1 nucleotide sequence into the online website CRISPR-P v2.0 for knockout target design to obtain the target target, as shown in Figure 5 A below. Design primers according to the target sequence, and amplify three fragments of U6 (nucleotide sequence as shown in SEQ ID NO.14), SG1 (nucleotide sequence as shown in SEQ ID NO.15), and SG2 (nucleotide sequence as shown in SEQ ID NO.16) respectively. The primer sequences are as follows:

[0093] U6-Forward Primer: 5′-CGATGGTACCGTGATGCTTGTAACTTTGTA-3′; (SEQ ID NO.17)

[0094] U6-Reverse Primer: 5′-ACACGCCCATGACCACCCCGCGTGCACCAGCCGGGAATCGAA-3′. (SEQ IDNO.18)

[0095] SG1-Forward Primer: 5′-CACGCGGGGTGGTCATGGGCGTGTTTTAGAGCTAGAAATAGC-3′; (SEQ IDNO.19)

[0096] SG1-Reverse Primer: 5′-ACCGACCTCGCCGTCGACCACGTGCACCAGCCGGGAATCGAA-3′. (SEQ IDNO.20)

[0097] SG2-Forward Primer: 5′-CACGTGGTCGACGGCGAGGTCGGTTTTAGAGCTAGAAATAGC-3′; (SEQ IDNO.21)

[0098] SG2-Reverse Primer: 5′-GCTAACTAGTCTCGAGCGGCCGCCAGTGTG-3′; (SEQ ID NO.22)

[0099] (2) Use 2×phanta Max Master Mix high-fidelity enzyme for amplification. The reaction system is: 25 μL of 2×phantaMax Master Mix high-fidelity enzyme, 2 μL of deoxyribonucleic acid (dNTP), 1 μL of forward primer, 1 μL of reverse primer, and make up to 50 μL with water.

[0100] The PCR reaction conditions are: pre-denaturation at 95°C for 5 minutes;

[0101] Denature at 95°C for 15 seconds, anneal at 58°C for 15 seconds, extend at 72°C for 2 minutes, for a total of 40 cycles;

[0102] Extend for 5 minutes after 72°C;

[0103] Incubate at 15°C.

[0104] After the reaction, perform agarose gel electrophoresis, take a small amount of the amplified product for identification. After detecting the target band, digest the amplified fragment with Spe1 and Kpn1 restriction endonucleases on the vector, react at 37°C for two hours. After the reaction, perform agarose gel electrophoresis, cut the gel and perform gel extraction. The gel extraction method is carried out according to the BioSune agarose gel DNA extraction kit from Taiwan, China.

[0105] (3)Digestion of the knockout vector: Extract the CRISPR knockout vector plasmid DNA using the BioSune high-purity plasmid mini extraction kit from Taiwan, China, and digest the vector with Spe1 and Kpn1 restriction endonucleases, react at 37°C for two hours. After the reaction, perform agarose gel electrophoresis, cut the gel and perform gel extraction. The gel extraction method is carried out according to the BioSune agarose gel DNA extraction kit from Taiwan, China.

[0106] Perform T4 ligation on the gene amplification gel extraction product and the vector digestion gel extraction product. The reaction system is as follows: 1 μL of 10× reaction buffer, 1 μL of T4 ligase, and make up the gel extraction product to 10 μL. React overnight at 16°C.

[0107] (4)Take 5 μL of the above ligation product and ligate it with the cloning vector. Transform the ligation product into Escherichia coli DH5α strain using the heat shock method and grow overnight on an LB plate containing SPE resistance. Pick a single white colony and streak it on an LB plate, perform colony PCR, and select the positive colony to grow overnight at 37°C in an LB liquid medium.

[0108] (5)Extraction of plasmid DNA: Extract plasmid DNA using the BioSune high-purity plasmid mini extraction kit from Taiwan, China, and verify it by sequencing by BioSune Biotechnology (Shanghai) Co., Ltd. to successfully construct BdSTAR1 the gene knockout vector.

[0109] 2、 BdSTAR1 Construction of the gene overexpression vector

[0110] (1) BdSTAR1 Gene cloning: Use TransZol from TransGen Biotech to extract wild-type BdSTAR1 RNA, reverse transcribe to synthesize the first strand of cDNA, and use it as the cDNA template.

[0111] According to Brachypodium distachyon BdSTAR1The following primer pairs were designed based on the CDS sequence of the gene, and their sequences are (5'-3'):

[0112] Forward primer: 5′-gtgttacttctgcag gagctc ATGGGCTCAGCATCAGATGACA-3′; (SEQ ID NO.23)

[0113] Reverse primer: 5′-tctagaggatccccg ggtacc TCAGCTGAGCTCCAGGAAGC-3′; (SEQ ID NO.24)

[0114] Among them, the underlined parts are restriction enzyme sites. The restriction enzyme site of the forward primer is Sac1, and the restriction enzyme site of the reverse primer is Kpn1.

[0115] PCR amplification was carried out using 2×Phanta Max MasterMix. The reaction system was: Mix 25 μL, forward primer 2 μL, reverse primer 2 μL, cDNA template 1 μL, and water was added to make up to 50 μL.

[0116] The PCR reaction conditions were: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 2 minutes, and this was repeated 40 cycles; final extension at 72°C for 5 minutes; incubation at 15°C.

[0117] After the reaction, agarose gel electrophoresis was performed. After detecting the target band, the gel was cut and gel extraction was carried out. The gel extraction method was carried out according to the BioSune Agarose Gel DNA Extraction Kit from Taiwan, China. Sequencing of the amplified target band showed that the gene containing the correct restriction enzyme sites had been successfully cloned. BdSTAR1 gene.

[0118] (2) Digestion of pPZP211 vector: The plasmid DNA of the pPZP211 vector containing the UBI promoter was extracted using the BioSune High Purity Plasmid Mini Extraction Kit from Taiwan, China, and the vector was digested with Sac1 and Kpn1 restriction endonucleases. The reaction was carried out at 37°C for two hours. After the reaction, agarose gel electrophoresis was performed, the gel was cut and gel extraction was carried out. The gel extraction method was carried out according to the BioSune Agarose Gel DNA Extraction Kit from Taiwan, China.

[0119] (3) Homologous recombination: The gel extraction product of the digested vector and the gene amplification product were subjected to homologous recombination. The reaction system was as follows: homologous recombination enzyme 5 μL, gel extraction product of the digested vector 1 μL, gene amplification product 1 μL, and water was added to make up the total volume to 10 μL. The reaction was carried out at 50°C for 10 minutes.

[0120] (4) Take 5 μL of the above ligation product and ligate it with the pPZP211 cloning vector. The operation steps are carried out according to the pPZP211 vector instruction manual. Then, the ligation product is transformed into Escherichia coli DH5α strain by heat shock method and grown overnight on an LB plate containing SPE resistance. Pick a single white colony and streak it on an LB plate for colony PCR. Select the positive colony and culture it overnight at 37 °C in an LB liquid medium.

[0121] (5) Extraction of plasmid DNA: Use the high-purity plasmid mini extraction kit from Sangon Biotech (Taiwan, China) to extract the plasmid DNA of the positive colony. After sequencing verification by Sangon Biotech (Shanghai) Co., Ltd., as Figure 6 shown in A below, the BdSTAR1 gene overexpression vector was successfully constructed.

[0122] 3. BdSTAR1 Construction of the complementary vector of the

[0123] (1) BdSTAR1 Cloning of the BdSTAR1 gene and its 3000 bp sequences upstream and downstream: Use the CTAB method to extract the DNA of wild-type Brachypodium distachyon as the template; design the following primer pairs 1 - primer pair 3 to amplify the BdSATR1 gene and 3000 bp sequences upstream and downstream of this gene as the BdSTAR1 promoter and terminator of the BdSTAR1 gene. The nucleotide sequence of 3000 bp upstream of the

[0124] gene is shown in SEQ ID NO.25, gagctc and the nucleotide sequence of 3000 bp downstream of the

[0125] gene is shown in SEQ ID NO.26.

[0126] Primer pair 1 - upstream primer: 5′-catgattacgaattc

[0127] TTACTGTTTGCTTGATTATGTGGCG-3′; (SEQ ID NO.27)

[0128] Primer pair 3 - Forward primer: 5′-gctATTTCTCTCGCTATTCCCTTGTGG-3′; (SEQ ID NO.31)

[0129] Primer pair 3 - Reverse primer: tctagaggatccccg ggtacc AATAAGGTACGAAGCTTCTCTCCTCC-3′. (SEQ ID NO.32)

[0130] Among them, the underlined parts are restriction enzyme sites. The restriction enzyme site of the forward primer is Sac1, and the restriction enzyme site of the reverse primer is Kpn1.

[0131] Use 2×Phanta Max MasterMix for PCR amplification. The reaction system is as follows: Mix 25 μL, forward primer 2 μL, reverse primer 2 μL, DNA template 1 μL, and make up to 50 μL with water.

[0132] The PCR reaction conditions are: pre - denaturation at 95°C for 5 minutes; denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 2 minutes, repeat 40 cycles in total; post - extension at 72°C for 5 minutes; keep at 15°C for incubation.

[0133] After the reaction, perform agarose gel electrophoresis, cut the gel and perform gel extraction. The gel extraction method is carried out according to the BioSune Agarose Gel DNA Extraction Kit from Taiwan, China.

[0134] (2) Digestion of pPZP211 vector: Use the BioSune High - Purity Plasmid Mini - Extraction Kit from Taiwan, China to extract the pPZP211 empty vector plasmid DNA, and use Sac1 and Kpn1 restriction endonucleases to double - digest the vector. React at 37°C for two hours. After the reaction, perform agarose gel electrophoresis, cut the gel and perform gel extraction. The gel extraction method is carried out according to the BioSune Agarose Gel DNA Extraction Kit from Taiwan, China.

[0135] (3) Homologous recombination: Perform homologous recombination on the gel - extracted product of the digested vector and the gene amplification product. The reaction system is as follows: homologous recombination enzyme 5 μL, gel - extracted product of the digested vector 1 μL, each gene amplification product 1 μL, make up the volume to 10 μL with water. React at 50°C for 10 minutes.

[0136] (4) Take 5 μL of the above - mentioned ligation product and ligate it with the pPZP211 cloning vector. The operation steps are carried out according to the pPZP211 vector instruction manual. Then, the ligation product is transformed into Escherichia coli DH5α strain by heat shock method and grown overnight on the LB plate containing SPE. Pick a single white colony and streak it on the LB plate, perform colony PCR, and select the positive colony to grow overnight in the LB liquid medium.

[0137] (5) Extraction of plasmid DNA: The plasmid DNA was extracted using the high-purity plasmid mini-extraction kit from Shengong, Taiwan, China, and verified by sequencing at Shengong Bioengineering (Shanghai) Co., Ltd. As shown in Figure 7 A, the complementary vector of the BdSTAR1 gene was successfully constructed.

[0138] Example 5: Genetic transformation of Brachypodium distachyon

[0139] 1. Induction of callus

[0140] (1) Wild-type Brachypodium distachyon (WT) and bdstar1 mutants that were about 1 month old and growing normally were selected, the lemma and palea were removed, and young and fresh seeds were selected.

[0141] (2) The collected seeds were placed in a laminar flow hood, disinfected with 25% NaClO disinfectant diluted with Tween for 5 min, and finally washed 3 times with sterile deionized water.

[0142] (3) The stereomicroscope was adjusted to be clear, the epidermis was torn with clean and sterile forceps, and the white, young, pointed immature embryos (preferably 0.3 - 0.7 mm) were taken out and gently placed on the surface of the callus induction medium.

[0143] (4) Incubated in an incubator at 28 °C in the dark for about 25 days, observed at any time, and the buds were removed.

[0144] (5) In order to make the utilization efficiency of the callus higher, yellowish-bright and relatively hard callus was selected, divided into small pieces of 1 - 2 mm in size, and then cultured for about 15 days and observed in time.

[0145] 2. Infection of Brachypodium distachyon

[0146] (1) The knockout vector, overexpression vector, and complementary vector of the BdSTAR1 gene constructed in Example 4 were respectively transformed into the Agrobacterium tumefaciens strain EHA105; the transformed Agrobacterium tumefaciens strain was poured into a shaking tube containing 10 ml of YEP, and then 10 μL of antibiotics and rifampicin were added, and cultured at 200 rpm and 28 °C for 24 h; after the culture was completed, centrifuged at 4 °C and 4000 rmp for 20 min, and the supernatant was discarded.

[0147] (2) The Agrobacterium suspension was added to the shaking tube from which the supernatant had been discarded, and the OD 600 value of the bacterial solution was diluted to 0.7 - 1.3.

[0148] (3) The Agrobacterium bacterial solution transformed with the BdSTAR1 gene knockout vector and overexpression vector was added to a beaker containing the callus of wild-type Brachypodium distachyon (WT), and the Agrobacterium transformed with the BdSTAR1The Agrobacterium suspension of the complementary vector of the gene was added to a beaker containing bdstar1 the callus of the mutant; and the callus was completely submerged in the suspension. The beaker was shaken manually for 1 minute and then left standing for 3 minutes, and this step was repeated three times. After that, the waste liquid was removed and the residual suspension was blotted off;

[0149] (4)The callus was transferred to a sterile glass dish with filter paper and blown to an appropriate dryness;

[0150] (5)The callus was further infected in the dark incubator at 28 °C for 3 days;

[0151] 3. Screening of Brachypodium distachyon

[0152] (1)The callus that had been infected in the dark for 3 days was transferred to the first screening medium. The bright yellow and healthy callus had a good infection effect, so callus with sufficient yellow color and hardness was preferably selected and screened in the dark incubator at 28 °C for 10 - 12 days;

[0153] (2)After the first screening, the healthy callus was selected and transferred to the second screening medium, and screened in the dark incubator at 28 °C for 14 days.

[0154] 4. Differentiation of Brachypodium distachyon

[0155] (1)After the second screening, the newly healthy callus was selected and transferred to the differentiation medium, and cultured continuously under the conditions of extra-long day (18 h light / 6 h dark) and 28 °C;

[0156] (2)Observe irregularly whether tender green buds grow out;

[0157] (3)The grown seedlings continued to grow for about 1 week. Then, the callus blocks at the bottom were removed as much as possible on the workbench, and the tender buds were pressed into the rooting medium, and cultured continuously under the conditions of extra-long day (18 h light / 6 h dark) and 28 °C.

[0158] 5. Transplanting of Brachypodium distachyon after rooting

[0159] (1)The tissue culture seedlings with roots about 3 - 5 cm long were taken out, the miscellaneous buds were removed, and the remaining parts were rinsed with deionized water;

[0160] (2)The nutrient soil and vermiculite were mixed in a volume ratio of 1:1 and filled into the same flowerpots, and then fully moistened with water. Subsequently, the roots of the seedlings were carefully transplanted into the flowerpots with forceps;

[0161] (3)After transplanting the seedlings, they were covered with plastic wrap and planted in weak light or darkness for 3 days. Then, the plastic wrap was removed and they were transferred to the greenhouse for normal cultivation. Observe the growth status of the seedlings regularly to ensure the normal growth of the plants until inoculation and seed harvesting.

[0162] Through the above genetic transformation operations, using BdSTAR1 the knockout vector of the BdSATR1 gene to knockout the BdSATR1 gene of wild-type Brachypodium distachyon (WT), the positive knockout seedlings of Brachypodium distachyon BdSTAR1 were obtained; using the overexpression vector of the BdSATR1 gene to transform wild-type Brachypodium distachyon (WT), the positive overexpression seedlings of Brachypodium distachyon bdstar1 were obtained; and the positive complementary seedlings of Brachypodium distachyon BdSTAR1 obtained after transforming the complementary vector of the BdSATR1 gene into the

[0163] Example 6: Identification of transgenic positive seedlings of Brachypodium distachyon BdSTAR1 and statistics of grain length

[0164] 1. Identification of T0 generation of positive knockout seedlings of Brachypodium distachyon BdSATR1 and statistics of grain length of T1 generation

[0165] Take samples of the transgenic seedlings obtained by tissue culture after transferring the knockout vector of the BdSTAR1 gene in Example 5, extract the RNA of the transgenic seedlings using TransZol of TransGen Biotech, and reverse transcribe it into cDNA. Use the BdSTAR1 gene primer pair to perform qRT-PCR analysis on the expression level of BdSTAR1 in the transgenic seedlings. The results are shown in B of Figure 5 . The expression level of BdSTAR1 in the transgenic seedlings decreased, indicating that the positive knockout seedlings of BdSATR1 were obtained. Harvest the seeds of the positive seedlings of T0 generation, continue to sow the T1 generation, and randomly select T1 generation lines for grain length statistics. The results are shown in C of Figure 5 , indicating that knocking out the BdSTAR1 gene shortens the seed grain length.

[0166] 2. Identification of T0 generation of positive overexpression seedlings of Brachypodium distachyon BdSATR1 and statistics of grain length of T1 generation

[0167] Take samples of the transgenic seedlings obtained by tissue culture after transferring the overexpression vector of the BdSTAR1 gene in Example 5, extract the RNA of the transgenic seedlings using TransZol of TransGen Biotech, and reverse transcribe it into cDNA. Use the BdSTAR1 gene primer pair to perform qRT-PCR analysis on the expression level of BdSTAR1 in the transgenic seedlings. The results are shown in B of Figure 6 . The expression level of BdSTAR1 in the transgenic seedlings increased, indicating that the positive overexpression seedlings of BdSATR1 were obtained. Harvest the seeds of the positive seedlings of T0 generation, continue to sow the T1 generation, and randomly select T1 generation lines for grain length statistics. The results are shown in Figure 6As shown in C, it indicates that overexpression BdSTAR1 of the gene makes the seed grain length longer.

[0168] 3. Brachypodium distachyon BdSATR1 Identification of the T0 generation of complementary positive seedlings and statistics of the grain length of the T0 generation

[0169] Take the transgenic seedlings obtained by tissue culture after transferring the BdSTAR1 complementary vector of the gene in Example 5, extract the RNA of the transgenic seedlings using TransZol of TransGen Biotech, and reverse transcribe it into cDNA. Use BdSTAR1 the gene primer pair to perform qRT-PCR to analyze the BdSTAR1 expression level in the transgenic seedlings. The results are as Figure 7 shown in B. There is no significant difference in the BdSTAR1 expression level between the transgenic seedlings and the wild type, indicating that BdSATR1 complementary positive seedlings are obtained. Harvest the seeds of the T0 generation positive seedlings, randomly select T0 generation lines for grain length statistics. The results are as Figure 7 shown in C, indicating that in the mutant background, complementing the BdSTAR1 gene can rescue the phenomenon of shortened seed grain length to a certain extent.

[0170] In summary, using transgenic technology, plants with knocked-out, overexpressed, and complementary Bd STAR1 genes are obtained. By observing the seed grain length phenotype, the results show that the Bd STAR1 gene is involved in regulating the process of plant seed grain length development. When this gene is overexpressed, the plant seed grain length becomes longer, and the seed grain length of the transgenic plants increases by about 5% - 8% compared with the wild type (the average increase is 6.5% ± 1.5%, n = 30). After knocking out the BdSTAR1 gene, the seed grain length is reduced by about 10% - 12% compared with the wild type under the same growth conditions (the average reduction is 11% ± 1%, n = 30). Complementing this gene in the mutant background can rescue the phenotype of shortened grain length, and the grain length of the obtained positive plants changes from a reduction of about 18% - 20% to 8% - 12% compared with the wild type plants (the average reduction is 10% ± 2%, n = 30).

[0171] The above are only the preferred embodiments of the present application and are not used to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Application of Brachypodium distachyon BdSTAR1 protein in regulating plant seed grain length; the Brachypodium distachyon BdSTAR1 protein is a protein shown in the following (A1) or (A2): (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.3 in the sequence listing; (A2) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

2. The application according to claim 1, characterized in that The plant is Brachypodium distachyon, wheat, rice and / or Arabidopsis thaliana.

3. Brachypodium distachyon BdSTAR1 Use of the gene in the following (1) or (2): (1) Regulating plant seed grain length; (2) Plant breeding; The Brachypodium distachyon BdSTAR1 gene is a DNA molecule as shown in the following i), ii), or iii): i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; ii) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.2; iii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO.3 other than i) or ii).

4. The application according to claim 3, characterized in that, The plant is Brachypodium distachyon, wheat, rice and / or Arabidopsis thaliana.

5. Recombinant expression vector or genetically engineered bacterium containing Brachypodium distachyon BdSTAR1 Use of the recombinant expression vector or genetically engineered bacterium in the following (1) or (2): (1) Regulating plant seed grain length; (2) Plant breeding; The Brachypodium distachyon BdSTAR1 gene is a DNA molecule as shown in any of the following i), ii), or iii): i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; ii) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.2; iii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO.3 other than i) or ii).

6. The application according to claim 5, wherein The recombinant expression vector is a overexpression vector of Brachypodium distachyon BdSTAR1 gene.

7. A method for regulating the grain length of plant seeds, characterized in that, It includes the following steps: Transfer the Brachypodium distachyon BdSTAR1 gene into wild-type plants exogenously to overexpress the Brachypodium distachyon BdSTAR1 gene and obtain transgenic plants, and the seed grain length of the transgenic plants is greater than that of the wild-type plants; The Brachypodium distachyon BdSTAR1 gene is a DNA molecule as shown in any of the following i), ii), or iii): i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; ii) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.2; iii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO.3 other than i) or ii).

8. The method according to claim 7, wherein Transferring the Brachypodium distachyon BdSTAR1 The methods for exogenous transfer of genes into wild-type plants include: polyethylene glycol method, Agrobacterium-mediated method or gene gun bombardment method.

Citation Information

Patent Citations

  • Gene for controlling rice fertility, encoded protein and application thereof

    CN102634522A

  • Application of plasma membrane aluminum resistance gene of bacillus subtilis in culturing of aluminum-tolerant arabidopsis thaliana

    CN105543246A