Application of Cassava Mosaic Virus AC4 in Inhibiting Degradation of mRNA Decay Substrates

Abstract

The present invention provides the use of the AC4 gene, etc., for increasing GFP expression and / or inhibiting the degradation of mRNA decay substrates using GFP as a reporter gene. The present invention has discovered that AC4 has mRNA decay inhibition function, inhibiting the degradation of nonsense-mediated mRNA decay substrates using GFP as a reporter gene, as well as the degradation of endogenous nonsense-mediated mRNA decay substrates in Arabidopsis thaliana, without affecting ARE-dependent turnover. It can increase the mRNA expression of AtUPF1, AtXRN4, AT1G0106020, RPS6, and others, while reducing the expression of AT1G72450 and AT2G400. It can cause dwarfing and / or leaf curling in Arabidopsis seedlings, enhance the pathogenicity of PVX, interact with MeUpf1 or AtUpf1, and improve yeast growth ability in nutrient-deficient culture media. The research results will lay the foundation for clarifying the function of AC4.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to application of cassava mosaic virus AC4 in inhibiting degradation of mRNA decay substrates. Background Art

[0002] mRNA decay, as a highly conserved self-protection mechanism, plays an important role in resisting viral invasion (Ge L, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, WangA, Zhou X, Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complexrestricts the infection of potyvirids in plants. Mol Plant. 2023,16(3):632-642.; Wu J, Zhang Y, Li F, Zhang X, Ye J, Wei T, Li Z, Tao X, Cui F, Wang X,Zhang L, Yan F, Li S, Liu Y, Li D, Zhou X, Li Y. Plant virology in the 21stcentury in China: Recent advances and future directions. J Integr Plant Biol.2023a, doi: 10.1111 / jipb.13580.). mRNA decay includes nonsense-mediated mRNA decay (NMD), Staufen1-mediated mRNA decay (SMD), and structure-mediated RNA decay (SRD). Upstream frameshift 1 (UPF1) is a key component of the three mRNA decay pathways (GeL, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X,Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complex restricts the infection of potyvirids in plants. Mol Plant. 2023,16(3):632-642.).Studies have found that NMD, SMD and SRD are all involved in antiviral defense (May JP, Simon AE. Targeting of viral RNAs byUpf1-mediated RNA decay pathways. Curr Opin Virol. 2021,47:1-8.;Ge L, Cao B,Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X, Li F.SUMOylation-modified Pelota-Hbs1 RNA surveillance complex restricts theinfection of potyvirids in plants. Mol Plant. 2023,16(3):632-642.). Among them, NMD plays an important regulatory role in the gene expression, growth and development and adversity defense response of organisms by rapidly degrading unstable and defective mRNAs to achieve quantitative regulation and quality monitoring of mRNA. Viruses are obligate parasites that have evolved to evade or tolerate various immune defense mechanisms of the host in the process of mutual game with the host to achieve infection. Exploring the various immune defense mechanisms by which different viruses evade or tolerate their hosts has become a research frontier and hotspot in this field (Sun H, Jing X, WangC, Wang P, Huang Z, Sun B, Li P, Li H, Zhang C. The Great Game between Plantsand Viruses: A Focus on Protein Homeostasis. Int J Mol Sci. 2023,24(16):12582.). The research results not only have important theoretical value, but also provide new technologies for the green prevention and control of viral diseases.

[0003] Cassava mosaic disease (CMD), caused by cassava mosaic geminiviruses (CMVs), poses a serious threat to the development of my country's cassava industry and food security. CMD was first reported in Hainan and Fujian, my country in 2018, and has since been reported in other growing areas (Wang et al., 2018). Therefore, basic research on virus-resistant breeding is urgently needed. Sri Lanka cassava mosaic virusSLCMV (Cassava Mosaic Virus) is a strain of cassava mosaic virus, classified as a member of the genus Begomovirus in the family Geminiviridae. It is a typical two-component single-stranded DNA virus, with a genome composed of two circular components: DNA-A and DNA-B. The positive-sense strand of the DNA-A component encodes two proteins, AV1 and AV2, while the antisense strand encodes four proteins, AC1, AC2, AC3, and AC4. The DNA-B component encodes BV1 and BC1 (Patil et al., 2009; Chen et al., 2019). Due to its extremely small genome, the majority of proteins it encodes are multifunctional. Studies have shown that AC4 is not only a symptom determinant of SLCMV but also a suppressor of viral silencing, inhibiting host post-transfection gene silencing and enhancing viral pathogenicity (Vanitharani et al., 2004; Chen et al., 2019). Whether AC4 has other functions has not yet been reported and remains to be investigated. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and provide an application of cassava mosaic virus AC4 in inhibiting the degradation of mRNA decay substrates. The present invention has found that AC4 inhibits the degradation of nonsense-mediated mRNA decay substrates using GFP as a reporter gene and endogenous nonsense-mediated mRNA decay (NMD) substrates of Arabidopsis thaliana, indicating that AC4 has the function of inhibiting mRNA decay and that the 1st to 18th bases are the key region for the interaction between AC4 and Upf1, a key gene in the Arabidopsis thaliana mRNA degradation signaling pathway.

[0005] The first aspect of the present invention is to provide the use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in increasing the expression level of GFP and / or inhibiting the degradation of an mRNA attenuation substrate using GFP as a reporter gene; wherein the nucleotide sequence of the AC4 gene is shown in SEQ ID NO: 1.

[0006] Among them, the 1st to 18th bases of AC4 are the key regions for AC4 to increase the expression of GFP and / or inhibit the degradation of mRNA attenuation substrates using GFP as a reporter gene.

[0007] The second aspect of the present invention is to provide the use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in inhibiting the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana without affecting ARE-dependent turnover; wherein the nucleotide sequence of the AC4 gene is shown in SEQ ID NO: 1.

[0008] Among them, the genes related to endogenous nonsense-mediated mRNA decay in Arabidopsis are AtUPF1, and / or AtPARN, and / or AtDCP2, and / or AtXRN4, and / or AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and the ARE-mediated degradation target genes are At1G72450 and / or At2G40000.

[0009] The third aspect of the present invention is to provide the use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in regulating the mRNA expression level of AtUPF1, and / or AtPARN, and / or AtDCP2, and / or AtXRN4, and / or AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400, wherein the nucleotide sequence of the AC4 gene is shown in SEQ ID NO: 1.

[0010] The AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacteria containing the AC4 gene coding region increases the mRNA expression levels of AtUPF1, AtPARN, AtDCP2, and AtXRN4.

[0011] Among them, the AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacteria containing the AC4 gene coding region increases the mRNA expression level of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570.

[0012] The AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacteria containing the AC4 gene coding region reduces the expression levels of AT1G72450 and AT2G400.

[0013] The fourth aspect of the present invention is to provide the use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in causing dwarfing and / or leaf curling of Arabidopsis seedlings.

[0014] The fifth aspect of the present invention is to provide the use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in enhancing the pathogenicity of PVX.

[0015] Among them, the 1st to 18th bases of AC4 are the key regions that enhance the pathogenicity of PVX.

[0016] The sixth aspect of the present invention is to provide the use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in interacting with MeUpf1 and / or AtUpf1; wherein, the nucleotide sequence of the AC4 gene is shown in SEQ ID NO: 1; the nucleotide sequence of the corresponding gene of MeUpf1 is shown in SEQ ID NO: 2; and the nucleotide sequence of the corresponding gene of AtUpf1 is shown in SEQ ID NO: 3.

[0017] Among them, AC4 interacts with MeUpf1 or AtUpf1 to enhance the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium containing the autoactivation inhibitor 3-AT.

[0018] Among them, the 1st to 18th bases of AC4 are the key regions for the interaction between AC4 and AtUpf1.

[0019] The present study found that AC4 has mRNA decay inhibition function, which can inhibit the degradation of nonsense-mediated mRNA decay substrates with GFP as the reporter gene and the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis without affecting ARE-dependent turnover, and can increase the expression of AtUPF1, AtPARN, AtDCP2, AtXRN4, AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G367 30. Increasing the mRNA expression levels of AT4G3900 and AT5G22570 and reducing the expression levels of AT1G72450 and AT2G400 can cause dwarfing and / or leaf curling of Arabidopsis seedlings and enhance the pathogenicity of PVX. There is an interaction between AC4 and MeUpf1, which can improve the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutritional deficiency medium containing the autoactivation inhibitor 3-AT. The research results will lay the foundation for clarifying the function of AC4. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1Schematic diagram of injection into Nicotiana benthamiana leaves. Reporter is the expression vector pG1300-PTC or pG1300; Vec is the empty vector p1300-Flag; AC4 is p1300-AC4-Flag; AC4 Δ1-18 p1300-AC4 Δ1-18 -Flag; p19 is the expression vector pZP-p19.

[0021] Figure 2 Different GFP reporter expression vectors pG1300-PTC or pG1300 were combined with empty vectors p1300-Flag or p1300-AC4-Flag or p1300-AC4 Δ1-18 -Flag and pZP-p19 were mixed in equal volumes and injected into Nicotiana benthamiana leaves. GFP expression was observed on day 5 after injection. Vec is the empty vector p1300-Flag; AC4 is p1300-AC4-Flag; AC4 Δ1-18 p1300-AC4 Δ1-18 -Flag.

[0022] Figure 3 Effects of AC4 overexpression on known NMD pathways. (a) Phenotypes of 4-week-old Arabidopsis seedlings. (b) RT-qPCR analysis of the effects of AC4 overexpression on the expression of key NMD pathway factors. (cf) RT-qPCR analysis of the effects of AC4 overexpression on the expression of known NMD target transcripts: (c) genes with premature termination codons (PTCs: AT1G01060, RPS6, and SMG7); (d) upstream open reading frame genes (uORFs: AT5G35490, AT5G64430, and ATG36730); (e) unknown NMD target genes (AT4G13900, AT5G22570); and (f) ARE target genes of AU-rich instability elements (AT1G72450, AT2G4000).

[0023] Figure 4 Results of the experiment on AC4 protein promoting PVX infection in Nicotiana benthamiana. (a) Wild-type Nicotiana benthamiana in injection buffer (Mock), viral vector PVX-AC4 Δ1-18 (PVX-AC4 Δ1-18 Phenotypes of PVX-AC4 (PVX-AC4) and PVX-AC4 at 7 days (dpa) and 12 days (dpa) after infection. (b) RT-qPCR analysis of PVX capsid protein (CP) mRNA levels in plants. (c) Western blotting analysis of viral CP protein in plants.

[0024] Figure 5Results of yeast interaction experiments. AD-AC4 + BD-MeUpf1, AD-AC4 + BD-AtUpf1, AD-AC4 Δ1-18 + BD-AtUpf1 represent pGADT7-AC4 + pGBKT7-MeUpf1, pGADT7-AC4 + pGBKT7-AtUpf1, and pGADT7-AC4, respectively. Δ1-18 Yeast cells co-transformed with pGBKT7-AtUpf1. SD-LW: SD / -Leu / -Trp medium; SD-LWHA+7.5mM 3AT: SD-LWHA / -Ade / -His / -Leu / -Trp medium + 7.5mM 3AT. DETAILED DESCRIPTION

[0025] The present invention will be further described below with reference to the accompanying drawings and in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not specified in the examples, the methods are based on those described in the literature in this field or on the product specifications. Where the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional products.

[0026] 1 Plant material

[0027] Wild-type Nicotiana benthamiana N. benthamiana and Arabidopsis thaliana A. thaliana .

[0028] 2 Experimental methods and results

[0029] 2.1 Construction of plant expression vectors

[0030] (1) pG1300-PTC vector

[0031] The plant expression vector p1300-PTC containing a premature termination codon was constructed as follows: using pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interactswith Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) as a template, the 438th base C of GFP in the vector was mutated to A by point mutation (shown in SEQ ID NO: 5), and the vector was named pG1300-PTC after sequencing and identification.

[0032] (2) p1300-AC4-GFP vector

[0033] With reference to the reported SLCMV sequence (GenBank: KT861468.1), the target fragment AC4-XbaI & BamHI (specific sequence is shown in Table 2) was artificially synthesized by Shanghai Sangon Biotechnology Co., Ltd. The synthesized fragment and the pG1300 vector were double-digested with XbaI and BamHI and then ligated. The ligation product was transformed into Escherichia coli, and the positive clone was confirmed by PCR and sequencing and named p1300-AC4-GFP.

[0034] (3) p1300-AC4 Δ1-18 -GFP vector

[0035] With reference to the reported SLCMV sequence (GenBank: KT861468.1), we commissioned Shanghai Sangon Biotechnology Co., Ltd. to artificially synthesize the target fragment AC4. Δ1-18 -SalII & BamHI (specific sequences are shown in Table 2). The synthetic fragment and pG1300 vector were double-digested with XbaI and BamHI and then ligated. The ligation product was transformed into E. coli. The positive clone was confirmed by PCR and sequencing and named p1300-AC4-AC4. Δ1-18 -GFP.

[0036] (4) p1300-AC4-Flag vector

[0037] With reference to the reported SLCMV sequence (GenBank: KT861468.1), the target fragment AC4-SpeI & KpnI (specific sequence is shown in Table 2) was artificially synthesized by Shanghai Sangon Biotechnology Co., Ltd. The synthetic fragment and pF1300 vector (Wu, K., Fu, Y., Ren, Y., Liu, L., Zhang, X., & Ruan, M. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing suppresses mRNA decay by interacting with Arabidopsis XRN4. The Plant journal : for cell and molecular biology , 116 (3), 744–755.) were double-digested with SpeI and KpnI and then ligated. The ligation products were transformed into Escherichia coli, and the positive clones were identified by PCR and sequencing and named p1300-AC4-Flag.

[0038] (5) p1300-AC4 Δ1-18 -Flag carrier

[0039] With reference to the reported SLCMV sequence (GenBank: KT861468.1), we commissioned Shanghai Sangon Biotechnology Co., Ltd. to artificially synthesize the target fragment AC4. Δ1-18 -SpeI & KpnI (specific sequences are shown in Table 2). The synthetic fragment and pG1300 vector were double-digested with SpeI & KpnI and then ligated. The ligation product was transformed into Escherichia coli. The positive clone was confirmed by PCR and sequencing and named p1300-AC4. Δ1-18 -Flag.

[0040] (6) AD-AC4 Δ1-18 carrier

[0041] With reference to the reported SLCMV sequence (GenBank: KT861468.1), we commissioned Shanghai Sangon Biotechnology Co., Ltd. to artificially synthesize the target fragment AC4. Δ1-18 -EcoR & BamHI (specific sequences are shown in Table 2), the synthetic fragment and the pGADT vector were double-digested with EcoR and BamHI and then ligated. The ligation product was transformed into Escherichia coli, and the positive clone was named AD-AC4 after being confirmed by PCR and sequencing. Δ1-18 .

[0042] (7) BD-MeUpf1 vector

[0043] MeUpf1 was amplified using cassava cDNA as a template using the primers MeUpf1-1F SfiI and MeUpf1-3813R BamHI (sequences shown in Table 1). The PCR amplification system consisted of 1 μL of each primer (10 μmol / L), 10 μL of 2* Magic Green Taq SuperMix, and ddH2O to 20 μL. The amplification program was a 94°C initial denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 60 s, annealing at 56°C for 30 s, and extension at 72°C for 90 s, followed by a final extension at 72°C for 10 min. The PCR product was double-digested with SfiI and BamHI and ligated with the large fragment of pGBKT recovered by the same double enzyme digestion. Positive clones were confirmed by PCR and sequencing and designated BD-MeUpf1.

[0044] (8) BD-AtUpf1 vector

[0045] AtUpf1 was amplified using Arabidopsis cDNA as a template using primers AtUpf1-1F SfiI and AtUpf1-3765R BamHI (sequence details are shown in Table 1). The PCR amplification system consisted of 1 μL of each primer (10 μmol / L), 10 μL of 2* Magic Green Taq SuperMix, and ddH2O to a total of 20 μL. The amplification program was a 94°C initial denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 60 s, annealing at 56°C for 30 s, and extension at 72°C for 90 s, followed by a final extension at 72°C for 10 min. The PCR product was double-digested with SfiI and BamHI and ligated with the large fragment of pGBKT recovered by the same double-digestion. Positive clones were confirmed by PCR and sequencing and designated BD-AtUpf1.

[0046] (9) Construction of PVX-AC4 vector

[0047] Based on the reported SLACMV AC4 sequence (GenBank: KT861468.1), we commissioned Shanghai Sangon Biotechnology Co., Ltd. to synthesize the target fragment AC4-SmaII (for the specific sequence, see Table 2) with restriction endonuclease SmaII sites flanking each end. Using seamless cloning, the target fragment AC4-SmaII was ligated into the pgR107 vector. After transformation of the ligation product into Escherichia coli, positive clones were identified by PCR and sequencing and correctly designated as PVX-AC4.

[0048] (10) PVX-AC4Δ 1-18 Vector construction

[0049] With reference to the reported SLACMV AC4 sequence (GenBank: KT861468.1), Shanghai Shenggong Biotechnology Co., Ltd. was commissioned to artificially synthesize the target fragment AC4Δ with restriction endonuclease SmaII site sequences added on both ends. 1-18 -SmaII (specific sequence see Table 2). Use seamless cloning technology to clone the target fragment AC4Δ 1-18 -SmaII was ligated with the pgR107 vector, and the ligation product was transformed into E. coli. The positive clone was identified by PCR and sequencing and was correctly named PVX-AC4Δ 1-18 .

[0050] Table 1 Primers used

[0051] Primer name sequence MeUpf1-1F SfiI ATGGATTCGGAGCAGAGCAAC MeUpf1-3813R BamHI TCAACCATTGTAGTGGATTTTC AtUpf1-1F SfiI ATGGATTCTCAACAGAGCGATCT AtUpf1-3765R BamHI TCAGCCATTGTAAGGATGTTTTG qNbActin-128F AAAGACCAGCTCATCCGTGG qNbActin-256R CCAGCAGCTTCCATTCCGAT qsGFP-306F GGACGACGGCAACTACAAGA qsGFP-519R TTCGATGTTGTGGCGGATCT

[0052] Note: Italic bold letters are enzyme cutting sites

[0053] Table 2 Target fragment sequences

[0054]

[0055] Note: Italic bold letters are enzyme cutting sites

[0056] 2.2 Detection of AC4’s mRNA degradation inhibitory function

[0057] 2.2.1 AC4 inhibits the degradation of mRNA substrates using GFP as a reporter gene

[0058] Single-chain green fluorescent protein expression vector pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 toenhance virus infection. Molecular plant pathology, 24(2), 154–166), pF1300 vector (Wu, K., Fu, Y., Ren, Y., Liu, L., Zhang, X., & Ruan, M. (2023). Turnipcrinkle virus-encoded suppressor of RNA silencing suppresses mRNA decay byinteracting with Arabidopsis XRN4. The Plant journal : for cell and molecular biology , 116 (3), 744–755.) and the expression vector pZP-p19 containing the silencing suppressor p19 that does not interfere with mRNA decay (Qu, F., Ren, T.,&Morris, TJ (2003). The coat protein of turnip crinklevirus suppresses posttranscriptional gene silencing at an early initiationstep. Journal of Virology , 77 (1), 511–522.) are all preserved in our laboratory.

[0059] (1) Transformation of recombinant plasmid into Agrobacterium (GV3101) competent cells

[0060] Refer to the instructions of GV3101 Chemically Competent Cell product and transfer the plant expression vectors pG1300, pG1300-PTC, p1300-AC4-Flag, p1300-AC4 Δ1-18-Flag and pZP-p19 were transformed into Agrobacterium GV3101 competent cells respectively. After transformation, the resuspended bacterial blocks were evenly spread on LB plates containing corresponding antibiotics. pG1300, pG1300-PTC, p1300-AC4-Flag, p1300-AC4 Δ1-18 -Flag on an LB plate containing Kan and Rif resistance, or pZP-p19 on an LB plate containing Spec and Rif resistance), invert the plate and incubate in a 28°C incubator for 72-90 hours. After 2-3 days, grow 2-3 mm Agrobacterium colonies, select individual colonies for PCR identification.

[0061] (2) Infiltration of wild-type Nicotiana benthamiana

[0062] The resuspended Agrobacterium containing the recombinant vector was mixed and injected into transgenic wild-type Nicotiana benthamiana leaves. The operation steps are as follows:

[0063] (a) Use a pipette tip to pick a single colony that has been identified as positive by colony PCR and transfer it to 5 ml of LB liquid medium containing the corresponding antibiotics. Place it in a constant temperature shaker at 28°C and 200 rpm for overnight culture.

[0064] (b) The bacterial solution was centrifuged at 7000 rpm for 15 min and the supernatant was discarded.

[0065] (c) Prepare injection buffer: Take 2 mL of 1 mol / L MgCl2, 2 mL of 1 mol / L MES, and 200 μL of 100 mg / mL AS, and finally make up to 200 mL with ultrapure water.

[0066] (d) Resuspend the bacterial pellet in 5 mL of injection buffer, vortex thoroughly to evenly distribute the pellet, measure the OD600 value of the bacterial pellet, and dilute the pellet to an OD600 of 0.5.

[0067] (e) After the diluted bacterial solution has been allowed to stand at room temperature for 2-3 h, mix it in equal volumes according to the desired mixing system (see Table 3 for specific combinations).

[0068] (f) Select wild-type Nicotiana benthamiana at the 5-7 leaf stage with good growth, and inject approximately 2 cm 2 The same reporter gene was expressed in the empty vector or AC4 or AC4 Δ1-18 Combinations such as Figure 1 The injections were made on the same leaf, and 10 leaves were injected. The injected Nicotiana benthamiana leaves were kept in the dark overnight and then cultured under normal conditions.

[0069] (g) Five days after injection, total RNA was extracted from tobacco plants according to the instructions for Tiangen's TRNzol Universal Total RNA Extraction Reagent. Then, the RNA sample was reverse transcribed using a two-step method according to the instructions for the reverse transcription kit. Real-time fluorescence quantitative PCR (qRT-PCR) was performed using the resulting cDNA sample as a template, qNbActin-128F and qNbActin-256R as internal reference primers, and qsGFP-306F and qsGFP-519R as GFP detection primers.

[0070] The results are as follows Figure 2 As shown, when AC4 was co-expressed with the GFP expression vector pG1300-PTC containing a premature stop codon, the GFP expression level increased, while there was no significant effect when it was co-expressed with the GFP expression vector pG1300 without a premature stop codon. This transient expression result showed that AC4 inhibited the degradation of the mRNA decay substrate with GFP as the reporter gene, indicating that SLCMV AC4 has the function of inhibiting host mRNA decay. Δ1-18 There was no significant difference in GFP expression between co-expression and empty vector co-expression, indicating that the 1st to 18th base pairs are very important for AC4 to inhibit host mRNA attenuation.

[0071] Table 3 Combinations of wild-type Nicotiana benthamiana injected with different plasmids by Agrobacterium

[0072]

[0073] To further confirm AC4's role in suppressing host mRNA decay, the expression vector p1300-AC4-GFP was transformed into wild-type Arabidopsis thaliana via the pollen tube pathway, generating transgenic plants overexpressing AC4-GFP, designated AC4oe. RNA was extracted from four-week-old seedlings of AC4oe, Col-0 (wild-type Col-0 served as a WT control), and upfi-5, a mutant with a partial loss of function in the key mRNA decay gene UPF1. Real-time quantitative PCR (RT-qPCR) was performed to investigate the effects of AC4 overexpression on the mRNA expression of NMD substrates and AU-rich instability elements (AREs) in transgenic plants.

[0074] The phenotype of 4-week-old Arabidopsis seedlings is as follows Figure 3 As shown in a, upf1-5 The mutant showed characteristic long leaves, while the AC4oe lines all exhibited dwarfism and leaf curling.

[0075] Using wild-type Col-0 as a control, RT-PCR was used to quantify the mRNA levels of four core NMD components (AtUPF1, AtPARN, AtDCP2, and AtXRN4) in AC4oe plants ( Kurosaki, T., Popp, MW, & Maquat, LE (2019). Quality and quantity control of gene expression by nonsense-mediated mRNA decay. Nature reviews. Molecular cell biology, 20(7), 406–420). RT-qPCR analysis showed that all four genes were significantly upregulated in AC4oe plants compared with WT ( Figure 3 b), indicating that SLCMVAC4 activates the mRNA degradation pathway at the transcriptional level.

[0076] RT-qPCR was used to detect and analyze eight known NMD target transcripts in three major categories (Wu, K., Fu, Y., Ren,Y., Liu, L., Zhang, X.,&Ruan, M. (2023). Turnip crinkle virus-encodedsuppressor of RNA silencing suppresses mRNA decay by interacting withArabidopsis XRN4. The Plant journal : for cell and molecular biology, 116(3),744–755.): (A) AT1G0106020 containing a premature stop codon (Gloggnitzer, J., Akimcheva, S.,Srinivasan, A., Kusenda, B., Riehs, N., Stampfl, H. et al. (2014) Nonsense-mediated mRNA decay modulates immune receptor levels to regulate plantantibacterial defense. Cell Host&Microbe, 16(3), 376–390.), RPS6(Garcia, D.,Garcia, S.&Voinnet, O. (2014) Nonsense-mediated decay serves as a generalviral restriction mechanism in plants. Cell Host&Microbe, 16(3), 391–402.) or SMG7 with long 3'UTR(Kerényi, Z., Mérai, Z., Hiripi, L., Benkovics, A., Gyula, P.,Lacomme, C. et al. (2008) Inter-kingdom conservation of mechanism of nonsense-mediated mRNA decay. The EMBO Journal, 27(11), 1585–1595.); (B) AT5G35490, AT5G64430, AT1G36730 with an open reading frame (uORF) upstream(Rayson, S., Arciga-Reyes, L.,Wootton, L., De Torres Zabala, M., Truman, W., Graham, N. et al. (2012) Arole for nonsense-mediated mRNA decay in plants: pathogen responses are induced in Arabidopsis thaliana NMD mutants. PLoS One, 7(2), e31917.) and (C) two mRNAs of AT4G3900 and AT5G22570 carrying unknown NMD cis-elements (Rayson, S., Arciga-Reyes,L., Wootton, L., De Torres Zabala, M., Truman, W., Graham, N. et al. (2012) Arole for nonsense-mediated mRNA decay in plants: pathogen responses are induced in Arabidopsis thaliana NMD mutants. PLoS One, 7(2), e31917.). RT-qPCR was used to detect and analyze two target transcripts (AT1G72450 and AT2G400) containing AU unstable elements (Gutierrez, RA, Ewing, RM, Cherry, JM & Green, PJ (2002) Identification of unstable transcripts in Arabidopsis by cDNA microarray analysis: rapid decay isassociated with a group of touch- and specific clock-controlled genes. Proceedings of the National Academy of Sciences of the United States of America, 99(17), 11513–11518.). The results are as follows. Figure 3As shown in Figure cf, compared with Col-0 plants, the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570 were significantly increased in AC4 overexpressing plants, which were >2-fold higher than those in the wild type, and even exceeded those in the wild type. upf1- 5 The levels of two Upf1-dependent / ARE-mediated degradation targets (At1G72450 and At2G40000) were significantly decreased in the mutant. upf1-5 AC4oe expression increased by 3.5-fold in α-actin-1 cells but decreased by 30% in α-actin-2 cells (p < 0.05, t-test). This suggests that AC4 can inhibit the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis without affecting ARE-dependent turnover, and functions as an mRNA decay suppressor.

[0077] 2.2.3 SLCMV AC4 enhances PVX pathogenicity through its N-terminal domain

[0078] To evaluate the effect of AC4 on pathogenicity, two PVX (potato virus X) recombinant viruses were constructed: PVX-AC4 (expressing the complete SLCMV AC4 protein) and PVX-AC4Δ 1-18 (expressing an AC4 mutant lacking nucleotides 1-18 at the N-terminus), and Mock is a control in which wild-type Nicotiana benthamiana was inoculated with buffer.

[0079] Plasmids PVX-AC4, PVX-AC4Δ1-18, and PVX-mAC4F were used to transform GV3101 competent cells. Twelve well-growing Nicotiana benthamiana plants were selected and marked. Agrobacterium containing the PVX-AC4, PVX-AC4Δ1-18, and PVX-mAC4F plasmids was expanded and centrifuged at 7000 rpm for 15 minutes. The mixed solution was adjusted to an OD of 0.5 with the resuspension buffer and allowed to stand at room temperature for 2 hours. The bacterial suspension was then injected into leaves using a 1 ml syringe with a removed needle. Symptoms of tobacco leaves were observed 7, 12, and 18 days after injection with PVX-AC4, PVX-AC4Δ1-18, PVX-mAC4F, and the resuspension buffer. RNA and protein were extracted and analyzed for quantitative PCR, Northern blot, and Western blot. PVX-CP expression was measured at the mRNA and protein levels.

[0080] The results are as follows Figure 4 As shown. 7 days after Agrobacterium infection (dpa), the plants infected with the two viruses showed no obvious phenotypic differences ( Figure 4By 12 days (dpa), PVX-AC4-infected plants showed systemic severe symptoms (leaf curling and plant dwarfing) compared with Mock ( Figure 4 aⅡ-Ⅲ in PVX-AC4 Δ1-18 Infected plants showed only mild mottled symptoms, which were significantly weaker than those of wild-type AC4 ( Figure 4 Quantitative analysis showed that the mRNA level of PVX capsid protein (CP) in PVX-AC4 plants was Δ1-8 4.2 times higher (p < 0.001; Figure 4 b). This indicates that intact AC4 significantly promotes viral gene expression. Western blotting confirmed that the viral CP protein in PVX-AC4-infected plants was significantly higher than that in the mutant ( Figure 4 c), further supporting the enhancing effect of AC4 on viral replication, and the N-terminal 1-18 amino acids of AC4 are the key structural domains that enhance viral pathogenicity. SLCMVAC4 enhances viral pathogenesis through its N-terminal myristoylation motif.

[0081] 2.2.4 Yeast two-hybrid analysis to identify the interaction between AC4 and MeUpf1 / AtUpf1

[0082] For ease of expression, during the co-transformation process, the "pGADT7" vector is abbreviated as "AD" and the "pGBKT7" vector is abbreviated as "BD". Yeast expression vectors pGADT7, pGBKT7 (BD-lam), AD-T (pGADT7-T), BD-53 (pGBKT7-53) and AD-AC4 (pGADT7-AC4) (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.), AD-AC4 Δ1-18 , BD-MeUpf1, and BD-AtUpf1 are all preserved in this laboratory.

[0083] Yeast vectors were co-transformed into competent yeast cells using different yeast expression vectors as described in Table 4. Single colonies identified as positive by PCR were picked and resuspended in 25 μL of sterile water to prepare a suspension. Sterile water was used to serially dilute the suspension to 10-fold, 100-fold, and 1000-fold. 2 μL of each suspension was inoculated into SD / -Leu / -Trp (SD-LW) nutrient-deficient medium, SD / -Leu / -Trp / -His / -Ade (SD-LWHA) nutrient-deficient medium, and SD-LWHA medium supplemented with 7.5 mM autoactivation inhibitor 3-AT. Yeast co-transformed with AD-T and BD-Lam and AD-T and BD-53 served as negative and positive controls, respectively. These yeast cells, along with the target plasmid-transformed yeast, were inoculated onto solid culture medium and cultured in an inverted incubator at 28°C for 3 days. Growth was observed and recorded to determine protein interactions.

[0084] Table 4 Pairing combinations of yeast bait plasmids and prey plasmids

[0085]

[0086] The results of yeast two-hybrid studies are as follows Figure 5 As shown in Figure 2, all co-transformed yeasts can grow normally in SD-LW deficiency medium, but only yeast positive control, co-transformed AD-AC4 and BD-MeUpf1, and co-transformed AD-AC4 and BD-AtUpf1 can grow normally in SD-LWHA deficiency medium supplemented with 7.5 mM 3-AT, while negative control and co-transformed AD-AC4 can grow normally. Δ1-18 Yeast cannot grow normally with BD-AtUpf1. The results showed that there are interactions between AD-AC4 and BD-MeUpf1, and AD-AC4 and BD-AtUpf1, indicating that the full-length AC4 interacts with both AtUPF1 and MeUpf1. Sequence alignment showed that there is 87% identity between MeUPF1 and AtUPF1. AC4 lacks the N-terminal myristoylation motif. Δ1-18 There was no interaction between the mutant and AtUpf1. This result indicates that bases 1 to 18 are the key region for the interaction between AC4 and Upf1, a key gene in the Arabidopsis mRNA degradation signaling pathway.

[0087] The above detailed description of the specific embodiments of the present invention is intended only as an example, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the practical embodiments are also within the scope of the present invention. Therefore, any equivalent changes and modifications made without departing from the spirit and scope of the present invention should be included within the scope of the present invention.

Claims

1. Use of the AC4 gene, or a protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in inhibiting the degradation of endogenous nonsense-mediated mRNA attenuation NMD substrates in Arabidopsis thaliana without affecting ARE-dependent turnover, characterized in that: The genes for endogenous nonsense-mediated mRNA decay in Arabidopsis are AtUPF1, AtPARN, AtDCP2, AtXRN4, AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900 and AT5G22570, and the target genes for ARE-mediated degradation are At1G72450 and At2G40000. The nucleotide sequence of the AC4 gene is shown in SEQ ID NO:

1. The AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region increases the mRNA expression levels of AtPARN, AtDCP2 and AtXRN4.

2. Use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in regulating the mRNA expression of AtUPF1, AtPARN, AtDCP2, AtXRN4, AT1G0106020, RPS6, SMG7AT5G35490, AT5G64430, AT1G36730, AT4G3900, AT5G22570, AT1G72450 and AT2G400; the nucleotide sequence of the AC4 gene is shown in SEQ ID As shown in NO:1; the regulation is to increase the mRNA expression levels of AtUPF1, AtPARN, AtDCP2, AtXRN4, AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, AT5G22570 and reduce the mRNA expression levels of AT1G72450 and AT2G400.

Images