Construction method and application of low birth weight related metabolism-related fatty liver disease animal model

Abstract

The invention relates to a construction method and application of a low birth weight related metabolism-related fatty liver disease animal model. The construction method comprises the following steps: (1) obtaining a conditionally knocked-out miR-379 / 410flox / + female mouse modified by miR-379 / 410; and (2) mating the female mouse obtained in the step (1) with an ALB-Cre < + / -> male mouse to obtain a liver-specific miR-379 / 410 cluster knockout miR-379 / 410LKO mouse, namely the metabolism-related fatty liver disease animal model. The invention discloses a key role of the miR-379 / 410 cluster in connecting embryonic development and MAFLD, and the animal model can be used for deeply researching the molecular mechanism of MAFLD and screening and evaluating novel therapeutic drugs.

Description

Technical Field

[0001] The present invention relates to the technical field of animal disease models, and particularly relates to a method for constructing an animal model of metabolic associated fatty liver disease related to low birth weight and its application. Background Art

[0002] Metabolic associated fatty liver disease (MAFLD) is a chronic progressive disease caused by overnutrition and insulin resistance in genetically susceptible individuals, and is also one of the main risk factors leading to liver cancer. In addition to known susceptibility genes such as PNPLA3 and TM6SF2, more and more evidence shows that environmental exposure in early embryonic development (paternal caffeine exposure or maternal metabolic syndrome) may increase the risk of individuals suffering from MAFLD through epigenetic mechanisms. As a special mode of gene expression regulation, imprinted genes do not follow Mendelian inheritance laws in their expression patterns, but are determined by parental origin. This unique expression pattern is determined by DNA methylation in the imprinting control region, and the methylation status of the imprinting control region is easily affected by the prenatal environment. Once established, imprinting will be maintained throughout an individual's life and have a long-term impact on the expression of imprinted genes. Therefore, modification of fetal imprinted genes by the prenatal environment may increase the risk of children developing metabolic diseases (such as MAFLD) in adulthood.

[0003] Epidemiological studies have fully shown a close association between low birth weight and MAFLD. However, there has always been a lack of a reliable animal model in the academic community to deeply study the potential mechanisms of this association, which has greatly restricted the research progress in related fields.

[0004] In summary, providing an MAFLD animal model related to low birth weight has become one of the urgent problems to be solved in the current field. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a method for constructing an animal model of metabolic associated fatty liver disease related to low birth weight and its application. By constructing a liver-specific miR-379 / 410 knockout mouse model, the birth weight of newborn mice is reduced, and adult mice show typical pathological features of MAFLD, which can be used to deeply study the molecular mechanism of MAFLD, screen and evaluate new therapeutic drugs.

[0006] To achieve this purpose, the present invention adopts the following technical solutions:

[0007] In the first aspect, the present invention provides a method for constructing an animal model of metabolic associated fatty liver disease related to low birth weight. The method for constructing the metabolic associated fatty liver disease animal model includes the following steps:

[0008] (1) Obtain conditional knockout of miR-379 / 410 modified by miR-379 / 410 flox / + Female mice;

[0009] (2) Mate the female mice obtained in step (1) with ALB-Cre + / - Male mice to obtain liver-specific miR-379 / 410 cluster knockout miR-379 / 410 LKO mice, which are the animal models of the metabolic associated fatty liver disease as described.

[0010] In the present invention, by constructing a liver-specific miR-379 / 410 knockout mouse model, the important role of the miR-379 / 410 cluster in the pathogenesis of MAFLD was revealed for the first time. The knockout of miR-379 / 410 leads to a decrease in the birth weight of neonatal mice, and typical pathological features of MAFLD appear in adult mice, including hepatic steatosis, insulin resistance, etc. The miR-379 / 410 cluster is an important molecular bridge connecting embryonic development and liver diseases in adulthood. The present invention provides a new perspective for deeply understanding the pathogenesis of MAFLD, helps to reveal the causal relationship between low birth weight and MAFLD, and provides new ideas for early diagnosis and treatment.

[0011] In the present invention, miR-379 / 410 is a maternally expressed imprinted gene, so female mice with the genotype of miR-379 / 410 flox / + need to be mated with male mice with the genotype of ALB-Cre + / - . Flox mice are transgenic mice with loxP sites inserted on both sides of the target gene. The loxP site provides a target for the action of Cre enzyme, and the loxP site itself does not affect the function of the target gene, and the target gene can be normally expressed. In the miR-379 / 410 flox / + mice provided in the present invention, loxP sites are inserted upstream and downstream of miR-379 / 410 on the maternally derived chromosome. Cre mice are transgenic mice carrying the Cre recombinase gene. Cre recombinase is a specific DNA recombinase that can recognize the loxP site on DNA and carry out recombination. ALB-Cre + / - mice are transgenic mice that specifically express Cre recombinase in the liver. The offspring mice produced after mating with miR-379 / 410 flox / + mice have the liver-specific miR-379 / 410 cluster knocked out.

[0012] Preferably, the method for preparing the miR-379 / 410 flox / + female mice includes the following steps:

[0013] (Ⅰ) Prepare sgRNA targeting the miR-379 / 410 gene cluster in mice, Cas9 protein, 5'-homologous arm donor plasmid, and 3'-homologous arm donor plasmid respectively;

[0014] (Ⅱ) Inject sgRNA, Cas9 protein, 5'-homologous arm donor plasmid, and 3'-homologous arm donor plasmid into fertilized eggs of mice with C57BL / 6JGpt background;

[0015] (Ⅲ) Take the surviving fertilized eggs after injection and transplant them into pseudopregnant female mice. The F0 generation mice born are identified by PCR to obtain female mice with the genotype of miR-379 / 410 flox / + .

[0016] Preferably, the preparation method of the sgRNA includes:

[0017] Connect the sgRNAs targeting both ends of the miR-379 / 410 gene cluster with the pUC57 kan-T7 vector to obtain the pUC57kan-sgRNA recombinant plasmid, and obtain the sgRNA for microinjection by in vitro transcription.

[0018] Preferably, the nucleic acid sequence of the sgRNA includes the sequences shown in SEQ ID NO.1 to SEQ ID NO.4.

[0019] SEQ ID NO.1: TGAGGCTTGGCCCTATTGCAGGG.

[0020] SEQ ID NO.2: GAGGCCCAGTCCCTGCAATAGGG.

[0021] SEQ ID NO.3: CCACTCCGTGAACGTCTCCGTGG.

[0022] SEQ ID NO.4: CCACGGAGACGTTCACGGAGTGG.

[0023] Preferably, the preparation method of the 5'-homologous arm donor plasmid and the 3'-homologous arm donor plasmid includes:

[0024] PCR amplify the 5'-homologous arm and 3'-homologous arm of the miR-379 / 410 gene cluster, and connect them with the pMD-18T vector to obtain a 5'-homologous arm donor plasmid containing loxP element and a 3'-homologous arm donor plasmid containing loxP element.

[0025] Preferably, the nucleic acid sequence of the primers for PCR amplifying the 5'-homologous arm and 3'-homologous arm of the miR-379 / 410 gene cluster includes the sequences shown in SEQ ID NO.5 to SEQ ID NO.12.

[0026] SEQ ID NO.5: GCATGCCTGCAGGTCGACGACCTGTTTTGGTTGGAGGTGGGCA。

[0027] SEQ ID NO.6: ATGTATGCTATACGAAGTTATGTGCACGTTAACCACCTACTCAGACAATGCGATGAATAGGGCCAAGCCTCAGAAGGC。

[0028] SEQ ID NO.7: TAACTTCGTATAGCATACATTATACGAAGTTATATGTTCTTGCCCAAG GTCAGTTGGGCAGGGACTGGGCCTCCTCCTTTCT。

[0029] SEQ ID NO.8: CCCGGGGATCCTCTAGAGATAGAGAGGCTGCTCCCATGCACAGGG。

[0030] SEQ ID NO.9: GCATGCCTGCAGGTCGACGACCACCCTGCATGCTTTTTCTCC。

[0031] SEQ ID NO.10: AACTTCGTATAATGTATGCTATACGAAGTTATCTGGTTCTTTCCGCCTCAGATCACGGAGTGGAGGGTGGGGGTTGT。

[0032] SEQ ID NO.11: AGCATACATTATACGAAGTTATAGTACTGTGCACGGACTAACAGAA GAACCCGTTGTGACGTCTCCGTGGCAGCAAGCCAGAG。

[0033] SEQ ID NO.12: CCCGGGGATCCTCTAGAGATAGCAAGCAATGTCTTGGGGAAAG。

[0034] Preferably, the nucleic acid sequences of the primers for PCR identification include the sequences shown in SEQ ID NO.13 to SEQ ID NO.16.

[0035] In a second aspect, the present invention provides a kit for constructing an animal model of metabolic associated fatty liver disease related to low birth weight, and the kit includes sgRNAs targeting the mouse miR-379 / 410 gene cluster, Cas9 protein, 5'-homologous arm donor plasmid and 3'-homologous arm donor plasmid.

[0036] Preferably, the nucleic acid sequence of the sgRNA includes the sequences shown in SEQ ID NO.1 to SEQ ID NO.4.

[0037] Preferably, the 5'-homologous arm donor plasmid and 3'-homologous arm donor plasmid contain loxP elements.

[0038] Preferably, the kit further includes primers for PCR identification of the genotypes of the offspring mice.

[0039] Preferably, the nucleic acid sequence of the primers includes the sequences shown in SEQ ID NO.13 to SEQ ID NO.16.

[0040] SEQ ID NO.13: TGACTGGTTCCCATGTGGAATG.

[0041] SEQ ID NO.14: TAATGCCAAAGTGGCTGGCTC.

[0042] SEQ ID NO.15: TCTGAGGCGGAAAGAACCAG.

[0043] SEQ ID NO.16: TATCTGTGGATGCCGTGGTG.

[0044] In a third aspect, the present invention provides the use of the method for constructing an animal model of metabolic associated fatty liver disease as described in the first aspect and / or the kit as described in the second aspect in studying the pathogenesis of metabolic associated fatty liver disease and screening therapeutic drugs for metabolic associated fatty liver disease.

[0045] In a fourth aspect, the present invention provides a screening model for therapeutic drugs for metabolic associated fatty liver disease. The screening model uses miR-379 / 410LKO mice with liver-specific knockout of the miR-379 / 410 cluster for drug screening, and the miR-379 / 410LKO mice are constructed by the method for constructing an animal model of metabolic associated fatty liver disease as described in the first aspect and / or the kit as described in the second aspect.

[0046] Preferably, the metabolic associated fatty liver disease is metabolic associated fatty liver disease related to low birth weight.

[0047] Compared with the prior art, the present invention has the following beneficial effects:

[0048] The present invention has successfully constructed an animal model related to low birth weight for MAFLD for the first time, providing a new experimental platform for studying the early pathogenesis of MAFLD, revealing the key role of the miR-379 / 410 cluster in connecting embryonic development and MAFLD, and can be used to deeply study the molecular mechanism of MAFLD, screen and evaluate new therapeutic drugs. Through this model, high-risk populations of MAFLD can be discovered earlier, so as to carry out early intervention and delay the progression of the disease. By detecting the expression levels of miR-379 / 410 in different individuals, personalized treatment plans can be provided for patients.

[0049] Compared with existing models, the animal model provided by the present invention has the following advantages: ① An earlier onset model: By gene manipulation during the embryonic development stage, the influence of pre-birth environmental factors on the metabolic health of offspring is simulated. ② More accurate molecular mechanism research: It can more deeply study the specific mechanism of action of the miR-379 / 410 cluster in the pathogenesis of MAFLD. ③ A broader application prospect: It is not only applicable to the study of MAFLD, but also can be used to study other metabolic diseases and the influence of environmental factors on metabolic health. Brief Description of the Drawings

[0050] Figure 1 It is a construction strategy diagram of liver-specific miR-379 / 410 cluster gene knockout mice of the present invention.

[0051] Figure 2 It is a construction strategy diagram of miR-379 / 410 flox / + mice of the present invention.

[0052] Figure 3 It is a construction strategy diagram of miR-379 / 410 flox / + genotype identification of the present invention.

[0053] Figure 4 It is a miR-379 / 410 flox / + :Alb-Cre + / - genotype identification result diagram of mice.

[0054] Figure 5 It is a gene knockout efficiency identification result diagram of miR-379 / 410 in mice.

[0055] Figure 6 It is a diagram of newly born miR-379 / 410LKO mice.

[0056] Figure 7 It is a diagram of the liver appearance of 8-month-old WT mice and miR-379 / 410LKO mice.

[0057] Figure 8These are the HE staining results of the livers of WT and miR-379 / 410 LKO mice.

[0058] Figure 9 These are the oil red staining results of the livers of WT and miR-379 / 410 LKO mice.

[0059] Figure 10 These are the Sirius red staining results of the livers of WT and miR-379 / 410 LKO mice.

[0060] Figure 11 These are the Ki67 immunohistochemical results of the livers of WT and miR-379 / 410 LKO mice.

[0061] Figure 12 These are the detection results of the biochemical indexes of liver function of WT mice and miR-379 / 410 LKO mice.

[0062] Figure 13 These are the protein expression diagrams of fatty acid synthesis-related genes of WT mice and miR-379 / 410 LKO mice.

[0063] Figure 14 These are the protein expression diagrams of cholesterol transport genes of WT mice and miR-379 / 410 LKO mice. Detailed implementation manners

[0064] To further elaborate on the technical means and their effects adopted by the present invention, the present invention will be further described below in conjunction with examples and drawings. It can be understood that the specific implementation manners described herein are only used to explain the present invention, rather than limiting the present invention.

[0065] For those not specifying specific techniques or conditions in the examples, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For those reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through regular channels.

[0066] Example 1 Construction of mice with liver-specific knockout of miR-379 / 410 cluster

[0067] In this example, a mouse with liver-specific knockout of the miR-379 / 410 cluster was constructed. The construction strategy is as Figure 1 shown. In cooperation with Jiangsu Jicui Yakang Biotech Co., Ltd., conditional knockout mice modified with miR-379 / 410 (miR-379 / 410 flox / + ) were constructed using the CRISPR / Cas9 technology. The conditional knockout mice were mated with tool mice to obtain offspring mice with liver-specific miR-379 / 410 cluster gene knockout. Since miR-379 / 410 is a maternally expressed imprinted gene, female miR-379 / 410flox / + Mice and male ALB-Cre + / - were mated to obtain liver-specific miR-379 / 410 cluster knockout mice (miR-379 / 410LKO) and control wild-type mice with the same genetic background (WT mice). This model provides a more reliable mouse model for further studying the function of the miR-379 / 410 gene cluster in hepatocytes.

[0068] miR-379 / 410 flox / + The construction strategy of miR-379 / 410 Figure 2 mice is as shown below and includes the following steps:

[0069] (1) Design sgRNA: According to the sequences at both ends of the miR-379 / 410 gene cluster in mice, gRNAs were designed for both ends of the gene cluster. The sgRNAs designed for its 5' end are gRNA1 and gRNA2; the sgRNAs designed for its 3' end are gRNA3 and gRNA4.

[0070] gRNA1 (SEQ ID NO.1): TGAGGCTTGGCCCTATTGCAGGG.

[0071] gRNA2 (SEQ ID NO.2): GAGGCCCAGTCCCTGCAATAGGG.

[0072] gRNA3 (SEQ ID NO.3): CCACTCCGTGAACGTCTCCGTGG.

[0073] gRNA4 (SEQ ID NO.4): CCACGGAGACGTTCACGGAGTGG.

[0074] (2) Clone the sgRNA into the pUC57 kan-T7 vector: Synthesize the upstream and downstream primers of the sgRNA, and the double-stranded DNA formed by primer annealing was cloned into the pUC57 kan-T7 vector to obtain the pUC57 kan-T7 recombinant plasmid.

[0075] ① Primer annealing: Among them, gRNA1 and gRNA2 were annealed, and gRNA3 and gRNA4 were annealed. Annealing program: 37°C for 30 min; 95°C, 5 min; cool down to 85°C at a rate of -2°C / s, and then cool down to 25°C at a rate of -0.1°C / s, and store at 4°C. The annealing reaction system of the sgRNA upstream and downstream primers is shown in Table 1.

[0076] Table 1

[0077] Component Dosage Forward primer (100 μM) 1 μL Reverse primer (100 μM) 1 μL PNK buffer 1 μL T4 PNK 1 μL Water Make up to 10 μL

[0078] ② Insert the sgRNA sequence into the pUC57 kan-T7 vector (previously digested with Bse I) for ligation (T4 DNA ligase, NEB) to obtain the pUC57 kan-sgRNA recombinant plasmid.

[0079] ③ The pUC57 kan-sgRNA recombinant plasmid obtained in step ② was subjected to in vitro transcription according to the instructions of the in vitro transcription kit to obtain sgRNA for microinjection.

[0080] (3) Based on the pMD-18T plasmid, construct the 5’donor recombinant plasmid and the 3’donor recombinant plasmid respectively.

[0081] ① The primer sequences for amplifying the homologous arms are shown in Table 2.

[0082] Table 2

[0083]

[0084]

[0085] Among them, CCCGGGGATCCTCTAGAGAT in SEQ ID NO.8 and CCCGGGGATCCTCTAGAGAT in SEQ ID NO.12 are the regions homologous to the pMD-18T vector; CCTGTTTTGGTTGGAGGTGGGCA in SEQ ID NO.5, AATAGGGCCAAGCCTCAGAAGGC in SEQ ID NO.6, CCACCCTGCATGCTTTTTCTCC in SEQ ID NO.9, and TCACGGAGTGGAGGGTGGGGGTTGT in SEQ ID NO.10 are the 5’arm genomic sequences; GCAGGGACTGGGCCTCCTCCTTTC T in SEQ ID NO.7, AGAGAGGCTGCTCCCATGCACAGGG in SEQ ID NO.8, ACGT CTCCGTGGCAGCAAGCCAGAG in SEQ ID NO.11, and AGCAAGCAATGTCTTGGGGAAA G in SEQ IDNO.12 are the 3’arm genomic sequences; the bold parts in SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.10, and SEQ ID NO.11 are part of the loxp sequence + exogenous specific identification primer, and the underlined parts are the loxp homologous regions.

[0086] ② PCR was used to obtain the 5arm homologous arm fragment and the 3arm homologous arm fragment, and the reaction system and reaction program are shown in Table 3.

[0087] Table 3

[0088]

[0089] ③ Construction of 5’ donor plasmid: Linearize the pMD-18T vector using Not I + Spe I. Perform SLIC ligation (SLIC ligase: NEBuilder HiFi DNA Assembly Master Mix) on the 5’ homologous arm PCR product of 5’ Donor, the 3’ homologous arm PCR product of 5’ Donor, and the digested pMD-18T vector. Incubate the ligation system shown in Table 4 at 50 °C for 15 min. After incubation, keep the sample on ice for subsequent transformation. Transform competent Escherichia coli with 2 μL of the cold-assembled product, spread on an ampicillin-resistant plate, and verify the vector by sequencing.

[0090] Table 4

[0091]

[0092]

[0093] ④ Construction of 3’ donor plasmid: Linearize the pMD-18T vector using Not I + Spe I. Perform SLIC ligation (SLIC ligase: NEBuilder HiFi DNA Assembly Master Mix) on the 5’ homologous arm PCR product of 3’ Donor, the 3’ homologous arm PCR product of 3’ Donor, and the digested pMD-18T vector. Incubate the ligation system shown in Table 4 at 50 °C for 15 min. After incubation, keep the sample on ice for subsequent transformation. Transform competent Escherichia coli with 2 μL of the cold-assembled product, spread on an ampicillin-resistant plate, and verify the vector by sequencing.

[0094] (4) Microinject Cas9 protein, in vitro transcribed gRNAs (gRNA1, gRNA2, gRNA3, gRNA4), 5’ Donor plasmid, and 3’ Donor plasmid into fertilized eggs of C57BL / 6JGpt background mice. Transfer the surviving fertilized eggs after injection into pseudopregnant female mice and wait for them to give birth. Tail and toe clippings of the F0 offspring born to recipient mice are numbered at 5 - 7 days, and genomic DNA is extracted for PCR and sequencing identification to confirm the genotype. The identification strategy is as Figure 3 shown, and the primers used are shown in Table 5.

[0095] Table 5

[0096]

[0097] To confirm whether the gene knockout mice were successfully constructed, primers were designed for the miR-379 / 410 flox / + genotype and the ALB-Cre + / - genotype respectively to identify the genotypes of the offspring. Identification was carried out according to the aforementioned identification strategy, and the results are as Figure 4 shown. The left figure is the identification result of miR-379 / 410. 1 is the PCR product of the 3’ arm, 2 is the PCR product of the 5’ arm, and 3 is the PCR product of GAPDH. The right figure is the Cre identification result. Mice numbered 39#, 48#, 52#, and 84# are miR-379 / 410 flox / + :Alb-Cre + / - mice, that is, miR-379 / 410LKO mice.

[0098] The expression of the miR-379 / 410 cluster in the liver tissue of mice was detected at the RNA level by qPCR. Since the miR-379 / 410 cluster includes 41 microRNAs, we randomly selected 3 microRNAs (miR-379, miR-300, miR-410) for qPCR detection. The results are as Figure 5 shown. The expression levels of miR-379 (0.1971±0.0743), miR-300 (0.3326±0.1115), and miR-410 (0.2610±0.0806) in the RNA of the liver of miR-379 / 410LKO mice were all lower than those in the WT group (miR-379 (0.5993±0.1295), miR-300 (0.7337±0.0681), miR-410 (0.5185±0.0755), p<0.001, n = 12). Therefore, the above results indicate that the miR-379 / 410 cluster was successfully knocked out in miR-379 / 410LKO mice, and miR-379 / 410LKO mice can survive normally and have reproductive ability.

[0099] Example 2 Phenotype detection of miR-379 / 410LKO mice

[0100] (1) Newborn miR-379 / 410LKO mice showed the phenomenon of low birth weight

[0101] To study the effect of the liver miR-379 / 410 cluster on birth weight, female miR-379 / 410 flox / + mice were mated with male ALB-Cre + / - mice, and the birth weights of the offspring were observed. The results are as Figure 6In the left figure, it was found that among the 8 offspring mice obtained, 2 showed the phenomenon of low body weight. Genotype identification was performed on the 8 offspring mice, and the results showed that the genotypes of the 2 low-body-weight mice were ALB-Cre + / - : miR-379 / 410 flox / + mice, that is, miR-379 / 410 LKO mice. Among the genotypes of the other 6 mice, 2 were ALB-Cre + / - : miR-379 / 410 + / + mice, and 4 were ALB-Cre - / - : miR-379 / 410 flox / + mice, that is, mice in which miR-379 / 410 was not successfully knocked out. The results showed that after specifically knocking out the miR-379 / 410 cluster in the liver, neonatal mice showed the phenomenon of low birth weight.

[0102] (2) Parental origin effect of miR-379 / 410 on neonatal mouse birth weight

[0103] To verify the effect of the parental origin of the miR-379 / 410 imprinted gene cluster on mouse birth weight, female miR-379 / 410 flox / + mice were mated with male ALB-Cre + / - mice, and at the same time, female ALB-Cre + / - mice were mated with male miR-379 / 410 flox / + mice. The birth weights of the offspring of the two groups of crosses were recorded respectively, and the differences between the two groups were compared. The results are as Figure 6 shown. It was found that ALB-Cre flox / + : miR-379 / 410 + / - mice obtained by mating female miR-379 / 410 + / - : miR-379 / 410 flox / + mice showed the phenomenon of low birth weight, and vice versa, there was no phenomenon of low birth weight. The results showed that the maternal allele of the miR-379 / 410 imprinted gene cluster plays an important role in regulating mouse birth weight, while the role of the paternal allele is relatively weak.

[0104] Example 3 Liver function detection of miR-379 / 410 LKO mice

[0105] (1) Observation of the appearance of the liver of miR-379 / 410 LKO mice

[0106] During the experiment, as the feeding time of the mice increased, compared with the WT mice, the miR-379 / 410 LKO mice had unkempt hair, a greasy feeling, and were sluggish. To detect the effect of the miR-379 / 410 cluster on the liver, when the miR-379 / 410 LKO mice were raised to 8 months old, the livers of the sacrificed mice were taken out, dissected, and the intact liver tissues were separated for pathological observation. The blood on the surface of the liver was rinsed with PBS solution and photographed. As Figure 7 shown, from the appearance of the liver, the livers of the WT group mice were normal in size and color, with neat liver edges, reddish-brown in color, and elastic; the liver tissues of the miR-379 / 410 LKO mice were pale, enlarged in volume, had a greasy feeling, and were swollen and fragile.

[0107] (2) Histopathological staining of the liver tissues of miR-379 / 410 LKO mice

[0108] The results of HE staining ( Figure 8 ) showed that the hepatic cord spaces of miR-379 / 410 LKO mice became larger, the hepatocytes were arranged disorderly, edematous, with mild fatty degeneration and vacuolar degeneration; the results of oil red staining ( Figure 9 ) showed that there were obvious red fat droplets in the livers of LKO mice; the results of Sirius red staining ( Figure 10 ) showed that the collagen fibers in the hepatic sinusoids of miR-379 / 410 LKO group mice were deposited in a strip-like manner; the results of immunohistochemical staining of Ki67 ( Figure 11 ) showed that the expression level of Ki67 in the liver nuclei of miR-379 / 410 LKO mice was significantly higher than that of WT mice. In summary, miR-379 / 410 LKO mice developed fatty liver and were accompanied by inflammatory reactions.

[0109] (3) Detection of liver function in miR-379 / 410 LKO mice

[0110] To comprehensively evaluate the effect of miR-379 / 410 cluster knockout on the liver, serum liver function tests were used to evaluate whether the liver metabolic function was impaired. Serum was taken from 5-month-old and 11-month-old miR-379 / 410 LKO mice to detect the contents of serum albumin (ALB), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) in the serum. The results are as Figure 12Shown as follows: ALT in the serum of 5-month-old miR-379 / 410 LKO mice (34.067±7.508) and ALT in the serum of 11-month-old miR-379 / 410 LKO mice (38.633±3.595) had no significant differences compared with ALT in 5-month-old WT mice (27.633±0.404, P = 0.2125) and ALT in 11-month-old WT mice (38.633±3.024, P>0.9999); however, the AST levels in the serum of 5-month-old miR-379 / 410 LKO mice (117.000±12.241) and the AST levels in 11-month-old (182.600±36.350) were respectively higher than AST in 5-month-old WT mice (96.833±2.194, P = 0.0484) and AST in 11-month-old WT mice (104.267±11.568, P = 0.0237); indicating that the hepatocytes of 5-month-old miR-379 / 410 LKO mice were damaged; while the level of ALB in the serum of 5-month-old miR-379 / 410 LKO mice (23.167±1.563) was lower than that of WT mice (27.733±1.041, P = 0.0136), indicating that the protein synthesis function of hepatocytes in 5-month-old miR-379 / 410 LKO mice was damaged.

[0111] Example 4 Detection of Gene Expression Related to Lipid Metabolism in the Liver Tissue of miR-379 / 410 LKO Mice

[0112] In this example, the genes related to lipid metabolism in miR-379 / 410 LKO mice were detected. PPARγ and FAS are key genes in the fatty acid synthesis pathway, APOA4 is an apolipoprotein, and Fabp2 is related to cholesterol synthesis metabolism; CD36 is a fatty acid transporter. An increase in liver CD36 expression leads to more free fatty acids entering hepatocytes, aggravating liver lipid accumulation; FGF21 is a hormone mainly secreted by the liver. FGF21 attempts to reduce hepatic steatosis by promoting fatty acid oxidation and improving insulin sensitivity. The results are as Figure 13 shown. Compared with WT mice, the expression levels of genes related to fatty acid synthesis (PPARγ and FAS) in the liver of miR-379 / 410 LKO mice decreased. As Figure 14 shown, compared with WT mice, the CD36 expression in miR-379 / 410 LKO mice was significantly upregulated. This result indicates that the deletion of miR-379 / 410 leads to an enhanced ability of the liver to uptake fatty acids. At the same time, the FGF21 expression was upregulated in LKO mice, indicating that the body attempts to cope with the progression of fatty liver by activating the FGF21 signaling pathway, which further supports the view that LKO mice are in the advanced stage of MAFLD.

[0113] Generally speaking, in the early stage of MAFLD, due to insulin resistance activating SREBP-1c, the expression of HMG-CoA reductase is upregulated, leading to an increase in cholesterol synthesis. As the disease progresses, the expression of genes related to cholesterol synthesis tends to be downregulated, while the expression of genes related to cholesterol esterification is upregulated, resulting in a large accumulation of cholesterol esters in hepatocytes. In previous studies on miR-379 / 410 knockout hepatocyte lines, it was found that the miR-379 / 410 knockout hepatocyte lines mimicked the early stage of MAFLD, that is, an increase in cholesterol synthesis. In the animal model of the present invention, the long-term deletion of miR-379 / 410 may lead to more complex metabolic disorders, causing the liver to lose balance in cholesterol regulation, and ultimately manifested as a decrease in the expression of genes related to cholesterol synthesis, but an increase in cholesterol esterification. This indicates that the miR-379 / 410 knockout mouse model may mimic the advanced stage of MAFLD, that is, the aggravation of cholesterol metabolism disorders.

[0114] Based on the above results, the following conclusions can be drawn: ① Knocking out the miR-379 / 410 cluster in hepatocytes affects the embryonic development of mice, resulting in the phenomenon of low birth weight. ② miR-379 / 410LKO mice develop fatty liver and are accompanied by inflammatory responses. ③ The miR-379 / 410 knockout mouse model mimics the advanced stage of MAFLD, showing the compensatory response of MAFLD. Therefore, the present invention reveals the key role of the miR-379 / 410 cluster in the occurrence and development of MAFLD, providing a new perspective for understanding the molecular mechanism of MAFLD.

[0115] To sum up, the present invention constructs a miR-379 / 410LKO mouse model, deeply revealing the molecular characteristics of the advanced stage of MAFLD, providing a theoretical basis for early diagnosis and intervention. Therefore, designing and synthesizing specific inhibitors targeting the miR-379 / 410 cluster or the PI3K / AKT pathway, verifying them on animal models, and evaluating the pharmacodynamics and safety of potential therapeutic drugs lay the foundation for clinical trials.

[0116] The applicant declares that the above description is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by any person skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A method for constructing an animal model of metabolic-related fatty liver disease associated with low birth weight, characterized in that: The method for constructing the metabolism-related fatty liver disease animal model comprises the following steps: (1) Obtaining miR-379 / 410 modified conditional knockout of miR-379 / 410 flox / + Female mice; (2) The female mice obtained in step (1) were inoculated with ALB-Cre + / - Male mice were mated to obtain liver-specific miR-379 / 410 cluster knockout miR-379 / 410LKO mice, which is the metabolic-related fatty liver disease animal model.

2. The method for constructing an animal model of metabolic-related fatty liver disease according to claim 1, characterized in that: miR-379 / 410 flox / + The method for preparing female mice comprises the following steps: (I) preparing sgRNA, Cas9 protein, 5' homology arm donor plasmid and 3' homology arm donor plasmid targeting the mouse miR-379 / 410 gene cluster respectively; (II) Inject sgRNA, Cas9 protein, 5' homology arm donor plasmid and 3' homology arm donor plasmid into fertilized eggs of mice with C57BL / 6JGpt background; (III) The fertilized eggs that survived the injection were transplanted into pseudo-pregnant female mice. The F0 generation mice born were identified by PCR, and the genotype was obtained as miR-379 / 410 flox / + of female mice.

3. The method for constructing an animal model of metabolic-related fatty liver disease according to claim 2, characterized in that: The preparation method of the sgRNA comprises: The sgRNA targeting both ends of the miR-379 / 410 gene cluster was connected to the pUC57 kan-T7 vector to obtain the pUC57 kan-sgRNA recombinant plasmid, and the sgRNA for microinjection was obtained by in vitro transcription.

4. The method for constructing an animal model of metabolic-related fatty liver disease according to claim 2 or 3, characterized in that: The nucleic acid sequence of the sgRNA includes the sequences shown in SEQ ID NO.1 to SEQ ID NO.

4.

5. The method for constructing an animal model of metabolic-related fatty liver disease according to claim 2, characterized in that: The preparation method of the 5' homology arm donor plasmid and the 3' homology arm donor plasmid comprises: The 5' homology arm and 3' homology arm of the miR-379 / 410 gene cluster were amplified by PCR and ligated with the pMD-18T vector to obtain a 5' homology arm donor plasmid containing a loxP element and a 3' homology arm donor plasmid containing a loxP element; Preferably, the nucleic acid sequences of the primers for PCR amplification of the 5' homology arm and the 3' homology arm of the miR-379 / 410 gene cluster include the sequences shown in SEQ ID NO.5 to SEQ ID NO.

12.

6. The method for constructing an animal model of metabolic-related fatty liver disease according to claim 2, characterized in that: The nucleic acid sequences of the primers identified by PCR include sequences shown in SEQ ID NO.13 to SEQ ID NO.

16.

7. A kit for constructing an animal model of metabolic-related fatty liver disease associated with low birth weight, characterized in that: The kit includes sgRNA targeting the mouse miR-379 / 410 gene cluster, Cas9 protein, 5' homology arm donor plasmid and 3' homology arm donor plasmid.

8. The kit according to claim 7, characterized in that The nucleic acid sequence of the sgRNA includes the sequences shown in SEQ ID NO.1 to SEQ ID NO.4; Preferably, the 5' homology arm donor plasmid and the 3' homology arm donor plasmid contain loxP elements; Preferably, the kit further comprises primers for PCR identification of the genotype of offspring mice; Preferably, the nucleic acid sequence of the primer includes the sequence shown in SEQ ID NO.13 to SEQ ID NO.

16.

9. Use of the method for constructing an animal model of metabolic-related fatty liver disease according to any one of claims 1 to 6 and / or the kit according to claim 7 or 8 in studying the pathogenesis of metabolic-related fatty liver disease and screening therapeutic drugs for metabolic-related fatty liver disease.

10. A screening model for drugs for treating metabolic-related fatty liver disease, characterized in that: The screening model uses miR-379 / 410LKO mice with liver-specific miR-379 / 410 cluster knockout for drug screening, and the miR-379 / 410LKO mice are constructed by the method for constructing an animal model of metabolic-related fatty liver disease according to any one of claims 1 to 6 and / or the kit according to claim 7 or 8; Preferably, the metabolism-associated fatty liver disease is low birth weight-associated metabolic-associated fatty liver disease.

Images