Preparation method of ATP7B gene edited somatic cells of bama miniature pigs

Abstract

The invention discloses a preparation method of an ATP7B gene edited somatic cell of a bama miniature pig, which comprises the following steps: S1, isolated culture and identification of fetal fibroblasts, S2, ATP7B gene sgRNA design, S3, construction of a Cas9-ATP7B-sgRNA expression vector, S4, transfection of the fetal fibroblasts and screening of sgRNA, S5, construction of a gene edited monoclonal cell line and the like. Therefore, the preparation of the bama miniature pig fetal fibroblast monoclonal cells subjected to gene editing is completed. The method is simple, high in reliability and relatively high in gene editing efficiency, the obtained bama miniature pig somatic cells edited by the ATP7B gene not only have the capability of continuing to develop and can be used for preparing a subsequent WD animal model, but also have similar growth traits with cardiovascular growth traits to human beings, so that the bama miniature pig somatic cells edited by the ATP7B gene can be used for preparing the WD animal model. And an ideal model can be provided for research on WD neurodegenerative diseases and deterioration mechanisms.

Description

Technical Field

[0001] The present invention relates to the technical field of cell engineering, and specifically relates to a method for preparing ATP7B gene-edited somatic cells of Bama minipigs. Background Art

[0002] Wilson's disease (WD) is an autosomal recessive genetic disease, with clinical manifestations of liver lesions and neurological symptoms, and is a copper ion metabolism disease caused by ATP7B gene mutations.

[0003] Clinical treatment requires in-depth research on the diagnosis, treatment, and pathogenic mechanism of WD, and animal models are widely used to study the pathogenesis of WD. Currently, the animal models of WD are mainly rodents, which are relatively small in size and have significant differences in physiological structure from humans. Except for showing liver symptoms, they cannot perfectly reproduce the neurological symptoms in human clinics. The lack of similar neurological phenotypes in existing animal models limits the research on the neurodegenerative pathogenesis and deterioration mechanism of WD. The cardiovascular growth traits of minipigs are similar to those of humans, making them an ideal model for the development and further improvement of surgical operations; the generation of Bama minipig models for Huntington's disease, familial hypercholesterolemia, tyrosinemia, etc. further confirms the reliability of minipigs as human disease models.

[0004] However, there are few researchers on the Bama minipig model for WD at present, and its reliability is not high. At the same time, the existing methods for preparing ATP7B gene-edited somatic cells of rodents, when applied to Bama minipigs, mainly have problems such as complex operations and low gene editing efficiency. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for preparing ATP7B gene-edited somatic cells of Bama minipigs to solve the above defects.

[0006] To achieve the above purpose, the present invention provides the following technical solutions:

[0007] A method for preparing ATP7B gene-edited somatic cells of Bama minipigs, comprising the following steps:

[0008] S1. Isolation, culture, and identification of fetal fibroblasts:

[0009] Select healthy purebred Bama minipigs at 24.5 days of pregnancy, collect their uteri, and perform isolation, culture, cryopreservation, resuscitation, and viability detection to obtain Bama minipig fetal fibroblasts, and perform sex identification;

[0010] S2. Design of sgRNA for ATP7B gene:

[0011] Obtain the complete genome sequence of porcine ATP7B, clone the full-length CDS sequence using the RNA of Bama pig fetal fibroblasts as a template and sequence it; use the online sgRNA database to select two highly specific high-scoring targets on the first three exons of the Bama minipig ATP7B gene and design six sgRNAs;

[0012] The six sgRNAs are respectively: sgRNA1-1, sgRNA1-2, sgRNA2-1, sgRNA2-2, sgRNA3-1, sgRNA3-2; their 5'-3' sequences are respectively shown in SEQ ID NO.1-NO.6 of the sequence listing;

[0013] S3. Construction of the Cas9-ATP7B-sgRNA expression vector:

[0014] Synthesize the above six sgRNAs in the form of primers, digest the PX459 plasmid with Cas9 expression function with Bbs I, and ligate the above six sgRNAs into the specific sites of the PX459 plasmid respectively to construct a gene editing recombinant vector; after transformation, shaking culture, plasmid extraction and identification, six successfully constructed Cas9-ATP7B-sgRNA expression vectors are obtained;

[0015] S4. Transfection of fetal fibroblasts and screening of sgRNAs:

[0016] Transfect the Cas9-ATP7B-sgRNA expression vector into Bama minipig fetal fibroblasts respectively. After 3 days of transfection, digest the cells and extract genomic DNA; screen for sgRNAs with high cleavage efficiency through DNA sequencing and TIDE online software;

[0017] S5. Construction of the gene-edited monoclonal cell line:

[0018] Select male Bama minipig fetal fibroblasts for resuscitation culture, then perform drug screening with puromycin at different concentration gradients, electrotransfer the sgRNA gene editing plasmid with high cleavage efficiency, and determine the successfully edited monoclonal cells through Sanger sequencing and TIDE software analysis. Finally, detect and identify them to complete the preparation of the gene-edited Bama minipig fetal fibroblast monoclonal cells.

[0019] Preferably, the detailed sequence of the expression vector Cas9-ATP7B-sgRNA1-1 is shown in Sequence Listing SEQ ID NO.7; the sequence fragments of sgRNA1-1 in the detailed sequence of Cas9-ATP7B-sgRNA1-1 are respectively replaced with the 5'-3' sequences of the five sgRNAs, namely sgRNA1-2, sgRNA2-1, sgRNA2-2, sgRNA3-1, and sgRNA3-2, to form the detailed sequences of the 5 expression vectors, namely Cas9-ATP7B-sgRNA1-1, Cas9-ATP7B-sgRNA1-2, Cas9-ATP7B-sgRNA2-1, Cas9-ATP7B-sgRNA2-2, Cas9-ATP7B-sgRNA3-1, and Cas9-ATP7B-sgRNA3-2.

[0020] Preferably, in step S5, the identification includes: genotype detection, off-target detection, identification of the transcriptional function of the metallothionein gene, detection of changes in copper ion content, and identification of its functional impact on the development of porcine early nuclear transfer embryos.

[0021] Preferably, the identification of the transcriptional function of the metallothionein gene is specifically as follows: through qRT-PCR detection, total RNA extraction, RNA reverse transcription, and fluorescence quantitative PCR of the knockout monoclonal cells, the transcriptional level identification of the metallothionein gene in the knockout monoclonal cells is obtained.

[0022] Preferably, the detection of changes in copper ion content is specifically as follows: the changes in copper ion content in gene-edited monoclonal cells are obtained through cell copper colorimetry and BCA protein concentration determination to verify whether positive monoclonal cells with knockout have been successfully screened out.

[0023] Preferably, the identification of its functional impact on the development of porcine early nuclear transfer embryos is specifically as follows: using the ATP7B gene knockout Bama mini-pig fetal fibroblast monoclonal cell line as the donor cell for nuclear transfer, and at the same time using wild-type Bama mini-pig fetal fibroblasts as the control donor cells for somatic cell nuclear transfer. By observing the cell development efficiency and nuclear fixation staining and photographing, it is determined whether the gene-edited Bama mini-pig fetal fibroblast monoclonal cells have an impact on the development of porcine early nuclear transfer embryos.

[0024] Preferably, in step S5, it is determined through drug screening that the concentration of puromycin is 1.5 μg / mL, which can screen out all cells without resistance on the third day and has the least impact on cell morphology.

[0025] The beneficial effects of the present invention are as follows:

[0026] The present invention relates to a method for preparing ATP7B gene-edited somatic cells of Bama minipigs. Through the design of ATP7B gene sgRNA, the construction of the Cas9-ATP7B-sgRNA expression vector, the transfection of fetal fibroblasts, and the screening of sgRNA, gene knockout of ATP7B can be achieved, with high reliability and high gene editing efficiency. The obtained gene-edited Bama minipig fetal fibroblasts have the ability to continue developing and can provide a basis for the establishment of a WD Bama minipig disease model in the later stage.

[0027] The method of the present invention is simple and highly reliable. The obtained ATP7B gene-edited Bama minipig somatic cells can be used for the preparation of subsequent WD animal models, and they are similar to humans in terms of cardiovascular growth traits, and can provide an ideal model for the study of the pathogenesis and deterioration mechanism of WD neurodegeneration. Brief Description of the Drawings

[0028] Figure 1 It is a growth state diagram of the Bama minipig fetal fibroblasts cultured in the present invention;

[0029] Figure 2 It is an agarose gel electrophoresis diagram of gene PCR amplification of the Bama minipig fetal fibroblasts in the present invention;

[0030] Figure 3 It is a cloning diagram of the full length of the porcine ATP7B CDS coding region in the present invention;

[0031] Figure 4 It is a design diagram of sgRNA for the first 3 exon targets of the ATP7B gene in the present invention;

[0032] Figure 5 It is a cloning diagram of the target editing site targeting the first three exons of the ATP7B gene in the present invention;

[0033] Figure 6 It is a PCR identification diagram of the vector sgRNA and the Cas9 gene in the present invention;

[0034] Figure 7 It is a sequencing identification diagram of the Cas9-ATP7B-sgRNA vector in the present invention;

[0035] Figure 8 It is a sequencing peak diagram of the gene editing product in the present invention;

[0036] Figure 9 It is an editing efficiency diagram of sgRNA in cells in the present invention;

[0037] Figure 10 It is a comparison and determination diagram of the puromycin screening concentration in the present invention;

[0038] Figure 11 This is the editing and sequencing result diagram of sgRNA3-1 electroporated primary BMZ-PEF in the present invention;

[0039] Figure 12 This is the editing situation diagram in the gene-edited cell population of the present invention;

[0040] Figure 13 This is the morphological diagram of Bama miniature pig fetal fibroblast monoclonal cells in the present invention;

[0041] Figure 14 This is the off-target sequence prediction diagram of the present invention;

[0042] Figure 15 This is the diagram showing that no off-target occurs in the sequenced and verified gene-edited cell line of the present invention;

[0043] Figure 16 This is the transcription result diagram of the metallothionein gene of the present invention;

[0044] Figure 17 This is the detection result diagram of copper ion level of the present invention;

[0045] Figure 18 This is the comparison diagram of the development of 2-cell, 4-cell, 8-cell and morula embryos with ATP7B knockout in the present invention (scale bar 100 μm);

[0046] Figure 19 This is the blastocyst diagram of Bama miniature pig somatic cell nuclear transfer of the present invention. Detailed implementation manners

[0047] Example 1:

[0048] As Figure 1-10 shown, a method for preparing ATP7B gene-edited somatic cells of Bama miniature pigs includes the following steps:

[0049] S1. Isolation, culture and identification of fetal fibroblasts:

[0050] Select healthy purebred Bama miniature pigs at 24.5 days of gestation, collect their uteri, and perform isolation, culture, cryopreservation, resuscitation and viability detection to obtain Bama miniature pig fetal fibroblasts, and perform sex identification, specifically as follows:

[0051] S11. Isolation and culture:

[0052] (1) Select healthy purebred Bama miniature pigs at 24.5 days of gestation, collect their uteri, and put the uteri into a sterilized fresh-keeping bag and bring them back to the laboratory;

[0053] (2) Rinse the uterus repeatedly with clear water until the surface is clean, and then wipe it with a high-temperature gauze;

[0054] (3) Rinse the uterine surface thoroughly with hydrogen peroxide, iodophor, and 75% ethanol in sequence for disinfection; rinse with normal saline until clean, dry with a gauze after moist heat sterilization, and transfer to the laminar flow hood for operation;

[0055] (4) Draw out the still distended allantoic membrane, tear it to release the amniotic fluid, and transfer the fetus into PBS;

[0056] (5) Wash the fetus in PBS repeatedly for more than 3 times, and remove the residual amnion on the surface of the fetus with forceps; then repeat washing with PBS several times until there is no other maternal tissue left;

[0057] (6) Use forceps to cut off the limbs, head, and tail of a single fetus, peel off the red fetal liver and fetal kidneys, retain the trunk, and place it in PBS for washing more than 3 times;

[0058] (7) Remove the residual PBS from the trunk, and then place the trunk into a culture dish;

[0059] (8) Drop 300.00 μL of type IV collagenase onto the fetal trunk, and use ophthalmic scissors to cut it into homogenate;

[0060] (9) Add 5.00 mL of type IV collagenase to a 15.00 mL centrifuge tube, and add 400.00 μL of 15% FBS; place the centrifuge tube in a 37°C water bath for thorough digestion for 30 min, invert and mix once every 5 min until the liquid becomes viscous; centrifuge at 1000 r / min for 5 min and discard the supernatant;

[0061] (10) Add it to 5.00 mL of DMEM basal medium containing 2% FBS for rinsing, place it in a 37°C water bath for 10 min, centrifuge at 1000 r / min for 5 min and discard the supernatant;

[0062] (11) Repeat the above steps (9) and (10);

[0063] (12) Inoculate the tissue into a T75 culture flask, and add 12.00 - 15.00 mL of medium. Observe and change the medium the next day; when the cells grow to 80% - 95% confluence, cryopreserve the cells.

[0064] Among them, the DMEM basal medium has the following components: 15.00 mL of FBS, 1.00 mL of NEAA, 1.00 mL of Gluta Max, and add DMEM high - glucose medium to 100.00 mL; suck the above components into a sterile centrifuge tube and store at 4°C, and restore to room temperature before use.

[0065] S12. Detection of the viability of cryopreserved cells in small volume:

[0066] (1) Inoculate 100 μL of cell suspension per well in a 96-well plate. Place the culture plate in an incubator and pre-culture it under the conditions of 37 °C and 5% CO₂.

[0067] (2) Add 10 μL of CCK-8 solution to each well. Incubate the culture plate in the incubator for 1 - 4 h, and measure the absorbance at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0068] (3) If the OD value is not to be measured immediately and is intended to be measured later, 10 μL of 0.1 M HCl or 1% SDS (W / V) solution can be added to each well, and the culture plate can be covered and stored in the dark at room temperature; the absorbance will not change within 24 h.

[0069] The isolation and culture of fetal fibroblasts from Bama mini-pigs were carried out by the above method. After removing the fetal membranes from the first batch of Bama mini-pigs, 4 fetal pigs were obtained. After physical shredding and enzymatic digestion, fetal fibroblasts from 4 Bama mini-pigs were obtained respectively. As Figure 1 shown, the cultured fibroblasts grew well. Most of the cells were spindle-shaped after adhering to the wall, with regular nuclear morphology, intact nuclear membranes, clearly visible nucleoli, no aggregation or shrinkage, uniform cytoplasm without obvious granules or vacuoles, and no senescence.

[0070] S13. Gender identification:

[0071] S131. Extraction of genomic DNA:

[0072] (1) The adherent cell population should first be processed into a cell suspension, then centrifuged at 10,000 r / min for 1 min, the supernatant should be aspirated, and 200.00 μL of buffer GA should be added, followed by vortex oscillation until the cells are fully suspended and mixed evenly.

[0073] (2) Add 20.00 μL of Proteinase K and mix well; add 200.00 μL of buffer GB, mix thoroughly by inverting, place at 70 °C for 10 min, the solution should become clear, briefly centrifuge to remove the water droplets on the inner wall of the tube cap; add 200.00 μL of absolute ethanol, shake well for 15 s, at this time, flocculent precipitates may appear, briefly centrifuge to remove the water droplets on the inner wall of the tube cap.

[0074] (3) Add the solution and flocculent precipitates obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12,000 r / min for 30 s, pour out the waste liquid, and place the adsorption column CB3 back into the collection tube; add 500 μL of buffer GD to the adsorption column CB3 (please check whether absolute ethanol has been added before use), centrifuge at 12,000 r / min for 30 s, pour out the waste liquid, and place the adsorption column CB3 in the collection tube.

[0075] (4) Add 600 μL of wash buffer PW to adsorption column CB3, centrifuge at 12,000 r / min for 30 s, discard the waste liquid, and place adsorption column CB3 into the collection tube. Put adsorption column CB3 back into the collection tube, centrifuge at 12,000 r / min for 2 min, and discard the waste liquid. Place adsorption column CB3 at room temperature for several minutes to thoroughly dry the residual wash buffer in the adsorption material.

[0076] (5) Transfer adsorption column CB3 into a clean centrifuge tube, suspend and add 50 - 200 μL of elution buffer TE dropwise to the middle part of the adsorption membrane, place at room temperature for 2 - 5 min, centrifuge at 12,000 r / min for 2 min, and collect the solution into the centrifuge tube.

[0077] (6) Measure the DNA concentration with Nanodrop 2000 / 2000.

[0078] S132. DNA Amplification for Gender Identification

[0079] (1) Perform PCR amplification on the genomic DNA amplification template of fetal pig with reference gene GAPDH and Y chromosome sex-determining gene SRY respectively, and add the following components:

[0080] Prime F (10 μM) 1.50 μL, Prime R (10 μM) 1.50 μL, template DNA 1.50 μL, Enzyme Mix 25.00 ng, RNase-free H 2 O to 50.00 μL; after briefly centrifuging and pipetting to mix evenly, place it in the gene amplifier.

[0081] (2) Run according to the following gene amplifier amplification program:

[0082] 98 °C for 5 s, 98 °C for 10 s, 60 °C for 5 s, 68 °C for 10 s; set the number of cycles to 30 cycles.

[0083] To identify the genders of the 4 isolated Bama miniature pigs, the genomes of 4 pig fetuses were extracted respectively by the above method. Using gene GAPDH as the internal reference and the Y chromosome sex-determining gene (Sex Region Y, SRY) to perform PCR amplification on the genomic DNA amplification template of fetal pig, and the amplification products were subjected to agarose gel electrophoresis. As Figure 2 shown, agarose gel electrophoresis showed that there were bands after GAPDH amplification of the 4 isolated fetal pigs, indicating the effectiveness of each sample genome. Only sperm and E1-1, E1-2, E1-4 showed positive results for SRY amplification products. The results showed that the fetal pigs E1-1, E1-2, and E1-4 were male, and the fetal pig E1-3 was female.

[0084] S2. Design of sgRNA for ATP7B Gene

[0085] S21. Acquisition of the ATP7B genomic sequence:

[0086] (1) Obtain the complete genomic sequence of porcine ATP7B through the NCBI website, and determine the corresponding sequences of the promoter, introns, and exons of the ATP7B gene.

[0087] (2) Design primers to amplify the genomic sequences of exons 1, 2, and 3 in the ATP7B targeted editing region, and obtain sequence information through sequencing.

[0088] (3) Use Taq enzyme to add an A tail to the amplified target fragment, and use T4 ligase to ligate the linear vector pGEM-T-Easy with the target fragment with an added A tail, and react at 37 °C for 30 min.

[0089] (4) Quickly add the ligation product to Escherichia coli Stellar competent cells for transformation, pick monoclonal colonies, extract plasmids, identify by enzyme digestion, and identify by sequencing of the bacterial liquid.

[0090] By analyzing the structure of the porcine ATP7B gene, it was found that it contains 21 exons and 20 introns, is located on chromosome 13, the full length of this gene is 80 kb, the full length of mRNA is 4060 bp. Using the RNA of Bama pig fetal fibroblasts as a template, the full-length CDS sequence was successfully cloned (as shown in Figure 3 ), and the comparison of the sequencing results with the NCBI database showed that some bases had mutations but the encoded amino acid sequence was not affected.

[0091] S22. Design of sgRNA for the ATP7B gene of Bama miniature pigs:

[0092] Use the first three exons of the ATP7B gene of Bama miniature pigs as gene editing targets respectively (as shown in Figure 4 ), and use the online sgRNA design tool "CHOPCHOP" (http: / / chopchop.cbu.uib.no / ) to select two highly specific high-scoring target sites on each of the first three exons (denoted as sgRNA1-1, sgRNA1-2, sgRNA2-1, sgRNA2-2, sgRNA3-1, sgRNA3-2). For these six sgRNAs, their 5'-3' sequences are respectively SEQ ID NO.1 to NO.6 in the sequence listing, and the specific sequences are shown in Table 1.

[0093] Table 1. sgRNAs with high scores targeting the first three exons of the ATP7B gene of Bama miniature pigs

[0094]

[0095]

[0096] As can be seen from Table 1, the score of sgRNA1-1 is 79 points, the score of sgRNA1-2 is 75 points, the score of sgRNA2-1 is 93 points, the score of sgRNA2-2 is 97 points, the score of sgRNA3-1 is 80 points, and the score of sgRNA3-2 is 89 points.

[0097] S23. Cloning and sequencing analysis of the target gene of the edited fragment:

[0098] Clone the target editing sites by targeting the first three exons. Using the genome of Bama pig fetal fibroblasts as a template, the target gene sequence was successfully cloned (as Figure 5 shown). The sequencing results of the cloned product were compared and analyzed with the NCBI database, and there were no base mutations in the targeted editing region.

[0099] S3. Construction of the Cas9-ATP7B-sgRNA expression vector:

[0100] S31. Ligation of sgRNA and Cas9 vector:

[0101] (1) Synthesize sgRNA1-1, sgRNA1-2, sgRNA2-1, sgRNA2-2, sgRNA3-1, and sgRNA3-2 in the form of primers respectively. The annealing primers for sgRNA are shown in Table 2.

[0102] Table 2. Annealing primers for six sgRNAs

[0103] Name Primer sequence(5’-3’) sgRNA1-1-F CACCGACTCGGAGCTCCCGGGCATC sgRNA1-2-F CACCGCACCTGTGGGTCATCCAGAG sgRNA2-1-F CACCGGTCGTGTGTGAAGTCCATCG sgRNA2-2-F CACCGTGGGACCTATTGACGTCGGG sgRNA3-1-F CACCGACAGTGCTGAGAATGCCACG sgRNA3-2-F CACCGCCGCGCGTCCGAGATCCCGC

[0104] (2) Anneal the primers into double strands and add the reaction system according to the following conditions:

[0105] Oligonucleotide-F 9 μL, Oligonucleotide-R 9 μL, 10×Standard Taq Buffer 2 μL, Total 20 μL; after briefly centrifuging and pipetting to mix evenly, place it in a gene amplifier.

[0106] (3) Run according to the following gene amplifier amplification program:

[0107] 95°C for 5 min, 20°C for 4 h. After the run is completed, store it at 4°C for short-term and -20°C for long-term.

[0108] (4) Configure the following system for the pSpCas9(BB)-2A-Puro(PX459)V2.0 plasmid (Addgene #62988) vector with the restriction enzyme BbsⅠ:

[0109] 1 μg of PX459, 5 μL of 10× NEBuffer r2.1, 1 μL of BbsⅠ, H 2 O to 50 μL. After briefly centrifuging and pipetting to mix evenly, digest with enzymes overnight at 37°C.

[0110] (5) Recover the digested products by gel extraction and ligate them to the annealed double-stranded gRNAs respectively. Add the reaction system according to the following conditions:

[0111] 50 ng of PX459, 3 μL of the annealed double-stranded gRNA, 1 μL of T4 DNA ligase, 1 μL of 10× Ligase Buffer, H 2 O to 10 μL. After briefly centrifuging and pipetting to mix evenly, ligate overnight at 16°C.

[0112] By the above method, digest the PX459 plasmid with Bbs I to linearize it, so as to facilitate the insertion of sgRNA into the PX459 plasmid. For the ATP7B gene of Bama miniature pigs, sgRNA1-1, sgRNA1-2, sgRNA2-1, sgRNA2-2, sgRNA3-1, and sgRNA3-2 were inserted into the plasmid PX459 respectively to construct gene editing vectors, which were respectively denoted as Plasmid1-1-sgRNA, Plasmid1-2-sgRNA, Plasmid2-1-sgRNA, Plasmid2-2-sgRNA, Plasmid3-1-sgRNA, and Plasmid3-2-sgRNA. The PCR identification diagrams of the obtained vectors sgRNA and Cas9 gene by PCR identification are as Figure 6 shown.

[0113] S32. Transformation and extraction of the reconstructed plasmid:

[0114] Place the Escherichia coli Stellar competent cells on ice to thaw. Pipette 5.00 μL of the recombinant vector and quickly add it to the Escherichia coli Stellar competent cells. After incubation on ice, culturing, and selection, extract the plasmid according to the endotoxin-free plasmid extraction kit (Tiangen, DP108).

[0115] S33. Identification of the Cas9-ATP7B-sgRNA plasmid:

[0116] (1) Using the extracted plasmid as a template, perform PCR identification. The reaction system is as follows:

[0117] Template DNA < 1 μg, 1 μL of Primer F (10 μM), 1 μL of Primer R (10 μM), 12.5 μL of 2× Taq plus PCRMix, H 20 to 50 μL; After brief centrifugation and pipetting to mix evenly, place it in a gene amplifier.

[0118] (2) Run the reaction product according to the following program: 98°C for 10 s, 55°C for 30 s, 72°C for 1 min, and set the number of cycles to 30 cycles.

[0119] (3) After sequencing and comparing the sequences, a total of 6 expression vectors, namely Cas9-ATP7B-sgRNA1-1, Cas9-ATP7B-sgRNA1-2, Cas9-ATP7B-sgRNA2-1, Cas9-ATP7B-sgRNA2-2, Cas9-ATP7B-sgRNA3-1, and Cas9-ATP7B-sgRNA3-2, are finally obtained. The specific sequencing identification diagram of the vectors is as Figure 7 shown.

[0120] Among them, the detailed sequence of the expression vector Cas9-ATP7B-sgRNA1-1 is shown in Sequence Listing SEQ ID NO.7, with a total of 8,486 bases. The detailed sequence is as follows:

[0121]

[0122] The detailed sequences of the five expression vectors Cas9-ATP7B-sgRNA1-2, Cas9-ATP7B-sgRNA2-1, Cas9-ATP7B-sgRNA2-2, Cas9-ATP7B-sgRNA3-1, and Cas9-ATP7B-sgRNA3-2 are basically the same as the detailed sequence of the expression vector Cas9-ATP7B-sgRNA1-1, and the differences are as follows:

[0123] In the detailed sequence of Cas9-ATP7B-sgRNA1-1 (shown in SEQ ID NO.7 of the sequence listing), the sequence fragment of sgRNA1-1 (shown in SEQ ID NO.1) is respectively replaced with the 5'-3' sequences of the five sgRNAs sgRNA1-2, sgRNA2-1, sgRNA2-2, sgRNA3-1, and sgRNA3-2 (shown in SEQ ID NO.2 to NO.6), thus forming the detailed sequences of the five expression vectors Cas9-ATP7B-sgRNA1-1, Cas9-ATP7B-sgRNA1-2, Cas9-ATP7B-sgRNA2-1, Cas9-ATP7B-sgRNA2-2, Cas9-ATP7B-sgRNA3-1, and Cas9-ATP7B-sgRNA3-2, all of which also contain 8,486 bases.

[0124] S4. Transfection of fetal fibroblasts and screening of sgRNA:

[0125] The Cas9-ATP7B-sgRNA expression vectors were respectively transfected into Bama miniature pig fetal fibroblasts. After 3 days of transfection, the cells were digested and genomic DNA was extracted; sgRNAs with high cleavage efficiency were screened by DNA sequencing and the TIDE online software.

[0126] S41. Electroporation with 2D-Nudeofector System:

[0127] (1) Resuscitate primary Bama miniature pig fetal fibroblasts and culture them in αMEM medium containing 15% fetal bovine serum. When the cell confluence reaches 90%, passage the cells and continue to culture until passage P2. When the cell confluence reaches 90%, prepare for electroporation.

[0128] (2) Add an appropriate amount of medium into a 24-well plate and equilibrate it in an incubator at 37°C and 5% CO2.

[0129] (3) Take out the cells from the incubator, discard the original medium, wash the cells once with PBS, add TE for digestion, and immediately add medium to neutralize the trypsin reaction once most of the cells (>90%) are detached.

[0130] (4) Centrifuge at 1000 g for 4 min, collect the cells, and prepare a sufficient amount of fresh cells (2×105 cells are required each time); gently resuspend the cell pellet in 100.00 μL of Nucleofector TM Solution (keep the cell suspension on ice before use).

[0131] (5) Mix 100 μL of the cell suspension with 5.00 μg of plasmid DNA; transfer the suspension to an electroporation cuvette and select an appropriate electroporation program for electroporation (select U-23 for PEF).

[0132] (6) After electroporation, take out the reaction cup, add 500.00 μL of DMEM basal medium to the reaction cup, and immediately gently transfer the sample to a 6-well plate; incubate the cells in an incubator at 37 °C with 5% CO2.

[0133] (7) Replace the medium containing Puro the next day, and extract the cell genome 3 days after drug screening to determine the knockout efficiency of each sgRNA.

[0134] S42. Detection of cell gene editing efficiency:

[0135] (1) Using the extracted genomic edited cell DNA as a template, amplify the target gene editing site with the designed ATP7B primers, and the size of each fragment does not exceed 500 bp.

[0136] (2) Perform Sanger sequencing on the PCR products with the correct amplified size and a single band, and analyze and compare the peak maps and sequences with the cloned control group sequences to determine whether the target sequence has mutated to judge whether the sgRNA has an editing effect. Use the online TIDE software "RAPID AND EASY QUANTITATIVE ASSESSMENT OF GENOME EDITING" for analysis to select an sgRNA with the highest editing efficiency.

[0137] As Figure 8 shown, DNA sequencing shows that sgRNA1-2, sgRNA3-1, and sgRNA3-2 among the 6 sgRNAs can cause obvious overlapping peaks, indicating that they can cause a high level of targeted mutations. Use the online TIDE software (https: / / tide.nki.nl / ) for analysis to select an sgRNA with the highest editing efficiency. As Figure 9 shown, the knockout efficiencies of sgRNA1-2, sgRNA3-1, and sgRNA3-2 are 13.1%, 58.9%, and 6.6% respectively. Therefore, sgRNA3-1 is selected for subsequent experiments.

[0138] S5. Construction of gene-edited monoclonal cell line:

[0139] Select male Bama miniature pig fetal fibroblasts for resuscitation and culture, then perform drug screening with puromycin at different concentration gradients. Electroporate the sgRNA gene-editing plasmid with high cleavage efficiency, analyze by Sanger sequencing and TIDE software to determine the successfully edited monoclonal cells, and finally detect and identify them to complete the preparation of gene-edited Bama miniature pig fetal fibroblast monoclonal cells.

[0140] S51. Determination of puromycin drug screening concentration curve:

[0141] (1) Day 1: Seed cells in a 24-well plate at a density of 3×104 cells / well, seed enough wells for subsequent gradient experiments, and incubate the cells overnight at 37°C.

[0142] Day 2: Prepare screening medium: fresh medium containing different concentrations of puromycin, replace the freshly prepared drug screening medium in the cells after overnight incubation, and then incubate the cells at 37°C.

[0143] Day 3: Replace the fresh screening medium and observe the cell survival rate.

[0144] (2) Replace the fresh screening medium approximately every 2 days according to the cell growth status.

[0145] (3) Monitor the cells daily, observe the survival cell rate, and thus determine the low drug concentration that can effectively kill non-transfected or all non-transduced cells within 3 days after the start of antibiotic screening.

[0146] As Figure 10 shown, unedited cells in the control group were screened with puromycin at different concentration gradients. 1.5 μg / mL of Puro could screen out all cells without resistance on the third day and had the least impact on cell morphology.

[0147] S52. Construction of gene-edited monoclonal cell line:

[0148] To obtain Bama miniature pig fetal fibroblasts with ATP7B gene knockout, resuscitate the first isolated male primary Bama miniature pig fetal fibroblasts, culture them in αMEM medium containing 15% fetal bovine serum, place them in an incubator at 37°C and 5% CO2. When the cell confluence reaches 90%, electroporate the sgRNA3-1 gene-editing plasmid into Bama miniature pig fetal fibroblasts, collect the genomic products of one well for Sanger sequencing, analyze the electroporation editing efficiency through TIDE software, and finally pick out Bama miniature pig fetal fibroblast monoclonal cells with successful gene editing by the limited cell dilution method after screening with the optimal concentration of Puro (asFigure 13 as shown

[0149] Figure 11 This is the editing sequencing result diagram of the primary BMZ-PEF electrotransfected with sgRNA3-1. Figure 11 (a) is the forward sequencing. Figure 11 (b) is the reverse sequencing. As Figure 11 shown, obvious multiple mutation types occurred before and after the editing site in the cell genome after electrotransfection, indicating that the editing efficiency of this gRNA for the target sequence is relatively high.

[0150] Figure 12 This is the diagram of the editing situation in the gene-edited cell population, and it is the data analysis of the editing efficiency in the Figure 11 results of Figure 12 which shows that the overall editing efficiency can reach 58.9%.

[0151] Detection and identification of single-clone cells with S53 and TP7B gene editing:

[0152] Detect and identify the single-clone cells with TP7B gene editing, including: genotype detection, off-target detection, transcriptional function identification of metallothionein gene, detection of changes in copper ion content, and identification of its functional impact on the development of porcine early nuclear transfer embryos.

[0153] S531. Genotype detection:

[0154] After puromycin screening, use the limiting dilution method to genotype the obtained monoclonal cell line. Obtain the target sequence of the ATP7B gene of the transfected cells by PCR, ligate it to the PLB vector after purification, pick bacteria for DNA sequencing, and identify the obtained monoclonal cell line; or add adapter primer sequences to the genomic template of the obtained gene-edited cells for cloning the targeted editing region and perform high-throughput sequencing. The sequencing results of some gene-edited cells mostly show double-peak and double-allele gene mutations, and the mutation types of a few double-allele sequences are consistent. Select the cell line with the smallest degree of gene change and good cell morphology and viability for subsequent functional verification and subsequent nuclear transfer experiments.

[0155] S532. Off-target detection:

[0156] Use the CRISPR design tool (http: / / crispor.tefor.net) to predict potential off-target sites (OTS) for sgRNA3-1. As Figure 14As shown, four potential off-target sequences (OTS1, OTS2, OTS3, OTS4) with higher scores for potential off-target effects were selected to detect whether off-target effects occurred in gene-edited cells. Using the DNA of positive gene-edited cells as a template, PCR reactions were carried out, and the products were subjected to gene sequencing and compared with the allele sequences of the control group to determine whether there were off-target site mutations. As Figure 15 shown, no gene mutations occurred in the four OTS regions tested in this monoclonal cell line. Therefore, it will be used for the production of early embryos of gene-edited somatic cell nuclear transfer pigs.

[0157] Identification of the transcriptional function of S533 and the metallothionein gene:

[0158] Through qRT-PCR detection, total RNA extraction from knockout monoclonal cells, reverse transcription of RNA, and fluorescence quantitative PCR, the transcriptional level identification of the metallothionein gene in knockout monoclonal cells was obtained.

[0159] Once the ATP7B gene is inactivated, copper ions in the copper ion transport pathway accumulate excessively in cells, and the transcription of the MT1A and MT2B genes that co-transport copper ions is enhanced. The knockout monoclonal cells with better stable passage status of the ATP7B gene and the control group wild-type cells were subjected to qRT-PCR. Compared with the control group, as Figure 16 shown, there were no differences in the transcriptional levels of the related genes of A1 and C2 in the selected knockout monoclonal cell line, the transcriptional level of the related genes of C5 was slightly higher than that of the control group, and the transcriptional level of the related genes of E5 was significantly increased.

[0160] S534 Detection of changes in copper ion content:

[0161] The changes in copper ion content in gene-edited monoclonal cells were obtained through cell copper colorimetry detection and BCA protein concentration determination to verify whether positive monoclonal cells with knockout were successfully screened.

[0162] As Figure 17 shown, the copper ion detection results showed that there were no significant differences in the copper ion content in cells of III-5, III-12, A1, and C2 compared with the control group. The copper ion content in cells of C5 and E5 was significantly higher than that of the control group. The increase in the transcriptional levels of MT1A and MT2B and the increase in intracellular copper ion content indicate that positive monoclonal cells with knockout were successfully obtained and can be used for subsequent experiments.

[0163] S535 Identification of the functional impact on the development of early porcine nuclear transfer embryos:

[0164] Using the ATP7B gene knockout Bama mini-pig fetal fibroblast monoclonal cell line as the donor cell for nuclear transfer, and at the same time using wild-type Bama mini-pig fetal fibroblasts as the control group donor cells for somatic cell nuclear transfer. By observing the cell development efficiency, nuclear fixation staining and taking pictures, it is determined whether the gene-edited Bama mini-pig fetal fibroblast monoclonal cells have an impact on the development of early porcine nuclear transfer embryos, so as to determine that this monoclonal cell can be used for subsequent cloned pig experiments.

[0165] Through steps such as oocyte collection and in vitro maturation, preparation of donor cells, enucleation and nuclear injection of oocytes, fusion and activation of reconstructed oocytes, and immunofluorescence, comparative diagrams of the development of ATP7B knockout 2-cell, 4-cell, 8-cell and morula embryos are obtained ( Figure 18 ) and the blastocyst diagram of Bama mini-pig somatic cell nuclear transfer ( Figure 19 ). From Figure 18 , Figure 19 It can be seen that for somatic cell nuclear transfer, compared with the control group, there is no significant change in the development efficiency of ATP7B knockout 2-cell, 4-cell, 8-cell and morula embryos. Through nuclear fixation staining and taking pictures, it is proved that the gene-edited cells can successfully develop to the blastocyst stage. Therefore, this monoclonal cell can be used for subsequent cloned pig experiments.

[0166] The preparation method of the ATP7B gene-edited somatic cells of the Bama mini-pig in the present invention realizes gene knockout of ATP7B through sgRNA design of the ATP7B gene, construction of the Cas9-ATP7B-sgRNA expression vector, transfection of fetal fibroblasts and screening of sgRNA, with high reliability and high gene editing efficiency; obtaining gene-edited Bama mini-pig fetal fibroblasts with the ability to continue development, which can provide a basis for the establishment of the later WD Bama mini-pig disease model.

[0167] The method of the present invention is simple and highly reliable. The obtained ATP7B gene-edited Bama mini-pig somatic cells can be used for the preparation of subsequent WD animal models, and they are similar to humans in terms of cardiovascular growth traits, and can provide an ideal model for the study of the pathogenesis and deterioration mechanism of WD neurodegeneration.

[0168] The above is an exemplary description of the invention. Obviously, the specific implementation of the present invention is not limited by the above methods. As long as this non-substantial improvement is carried out by adopting the method concept and technical solution of the present invention, or the concept and technical solution of the invention are directly applied to other occasions without improvement, they are all within the protection scope of the present invention.

Claims

1. A method for preparing ATP7B gene-edited somatic cells of Bama miniature pigs, characterized in that: The following steps are involved: S1. Isolation, culture and identification of fetal fibroblasts: Healthy purebred Bama miniature pigs at 24.5 days of gestation were selected, their uteri were collected, and isolated, cultured, cryopreserved, revived, and vitality tested to obtain Bama miniature pig fetal fibroblasts, and their sex was identified. S2. ATP7B gene sgRNA design: The complete genome sequence of porcine ATP7B was obtained, and the full-length CDS sequence was cloned and sequenced using RNA from Bama pig fetal fibroblasts as a template; Using the sgRNA online database, two specific high-scoring targets were selected on each of the first three exons of the ATP7B gene of Bama miniature pigs and six sgRNAs were designed; The six sgRNAs are: sgRNA1-1, sgRNA1-2, sgRNA2-1, sgRNA2-2, sgRNA3-1, sgRNA3-2; ​​their 5'-3' sequences are shown in the sequence list SEQ ID NO.1 to NO.6 respectively; S3. Construction of Cas9-ATP7B-sgRNA expression vector: The six sgRNAs were synthesized in the form of primers, and the PX459 plasmid with Cas9 expression function was digested with Bbs I. The six sgRNAs were connected to the specific sites of the PX459 plasmid to construct gene editing recombinant vectors. After transformation, shaking, plasmid extraction and identification, six successfully constructed Cas9-ATP7B-sgRNA expression vectors were obtained. S4. Transfection of fetal fibroblasts and screening of sgRNA: The Cas9-ATP7B-sgRNA expression vector was transfected into Bama miniature pig fetal fibroblasts. After 3 days of transfection, the cells were digested and genomic DNA was extracted. DNA sequencing and TIDE online software were used to screen sgRNAs with high cutting efficiency. S5. Construction of gene-edited monoclonal cell lines: Male Bama miniature pig fetal fibroblasts were selected for resuscitation culture, and then drug screening was performed using different concentration gradients of puromycin. The sgRNA gene editing plasmid with high cutting efficiency was electroporated, and the successfully edited monoclonal cells were determined through Sanger sequencing and TIDE software analysis. Finally, they were detected and identified, thus completing the preparation of gene-edited Bama miniature pig fetal fibroblast monoclonal cells.

2. The method for preparing ATP7B gene-edited somatic cells of Bama miniature pigs according to claim 1, characterized in that: The detailed sequence of the expression vector Cas9-ATP7B-sgRNA1-1 is shown in the sequence listing SEQ ID NO.7; the sequence fragment of sgRNA1-1 in the detailed sequence of Cas9-ATP7B-sgRNA1-1 is replaced by the 5'-3' sequences of the five sgRNAs sgRNA1-2, sgRNA2-1, sgRNA2-2, sgRNA3-1, and sgRNA3-2, respectively, to form the detailed sequences of the five expression vectors Cas9-ATP7B-sgRNA1-1, Cas9-ATP7B-sgRNA1-2, Cas9-ATP7B-sgRNA2-1, Cas9-ATP7B-sgRNA2-2, Cas9-ATP7B-sgRNA3-1, and Cas9-ATP7B-sgRNA3-2, respectively.

3. The method for preparing ATP7B gene-edited somatic cells of Bama miniature pigs according to claim 1, characterized in that: In step S5, it is identified, including: genotype detection, off-target detection, identification of the transcriptional function of the metallothionein gene, detection of changes in copper ion content and identification of its functional impact on the development of early pig nuclear transplant embryos.

4. The method for preparing ATP7B gene-edited somatic cells of Bama miniature pigs according to claim 3, characterized in that: The transcription function identification of the metallothionein gene is specifically: through qRT-PCR detection, total RNA extraction of knockout monoclonal cells, RNA reverse transcription and fluorescence quantitative PCR, to obtain the transcription level identification of the metallothionein gene in the knockout monoclonal cells.

5. The method for preparing ATP7B gene-edited somatic cells of Bama miniature pigs according to claim 3, characterized in that: The copper ion content change detection is specifically: obtaining the change of copper ion content in gene-edited monoclonal cells through cell copper colorimetry detection and BCA protein concentration determination to verify whether the knockout positive monoclonal cells are successfully screened out.

6. The method for preparing ATP7B gene-edited somatic cells of Bama miniature pigs according to claim 3, characterized in that: The identification of its functional impact in the early nuclear transplantation embryonic development of pigs is specifically as follows: using the ATP7B gene knockout Bama miniature pig fetal fibroblast monoclonal cell line as the donor cell for nuclear transplantation, and using wild-type Bama miniature pig fetal fibroblast cells as the donor cell of the control group, somatic cell nuclear transplantation is performed, and by observing the cell development efficiency and nuclear fixation staining and photography, it is determined whether the gene-edited Bama miniature pig fetal fibroblast monoclonal cells have an effect on the function of the early nuclear transplantation embryonic development of pigs.

7. The method for preparing ATP7B gene-edited somatic cells of Bama miniature pigs according to claim 1, characterized in that: In step S5, the concentration of puromycin was determined to be 1.5 μg / mL through drug screening, which could screen out all non-resistant cells on the third day and have minimal effect on cell morphology.

Images