Construction method and application of Lepr gene knockout mouse model

Abstract

The invention discloses a construction method and application of an Lepr gene knockout mouse model, and relates to the technical field of gene knockout animal models. The constructed Lepr gene knockout mouse model has obvious obesity characterization, and the constructed Lepr gene knockout mouse model can be applied to a screening model for obesity drug treatment, a disease animal model for hyperlipidemia treatment and deep understanding of pathogenesis of hyperlipidemia.

Description

Technical Field

[0001] The present invention relates to the technical field of gene knockout animal model, and particularly relates to a construction method and application of a Lepr gene knockout mouse model. Background Art

[0002] Obesity causes various diseases such as cardiovascular and cerebrovascular diseases, diabetes, and fertility disorders, seriously affecting human health. The leptin gene (Leptin, LEP gene) and the leptin receptor gene (Leptin Receptor, LEPR gene) are commonly present in mammals and are the main genes in the human body that control energy basal metabolism and obesity. The LEP gene is specifically expressed in adipose tissue and encodes the leptin protein, i.e., leptin. After being synthesized in adipose tissue, leptin is secreted into the blood and reaches multiple parts of the body through the blood to bind to its receptor. The leptin receptor gene Lepr encodes the leptin receptor protein, which belongs to the type I cytokine receptor family and is widely distributed in the brain, heart, liver, kidney, lung, spleen, pancreas, testis, and adipose tissue. Leptin binds to LEPR distributed in the hypothalamus, regulates intracellular signal pathways such as JAK / STAT and MAPK, and regulates the secretion of hormones in the hypothalamic-pituitary-adrenal axis, resulting in a decrease in food intake and an increase in energy consumption. Leptin binds to LEPR in other tissues, has endocrine regulatory functions, can increase basal metabolism, affect reproductive function, regulate pancreatic β-cell function and insulin secretion, affect innate and adaptive immunity, and participate in the regulation of hematopoiesis, angiogenesis, bone formation, and wound healing.

[0003] Patients with hereditary leptin receptor protein gene (Lepr) mutations have symptoms such as severe early-onset obesity, bulimia, hypogonadism, neuroendocrine abnormalities, and metabolic disorders. By sequencing the Lepr gene in a large number of patients with early-onset severe obesity, it was found that about 3% of the patients had different types of homozygous Lepr gene mutations, resulting in defective LEPR protein function. LEPR and its mediated downstream signal pathways have long been an important target direction in the study of obesity.

[0004] Currently, the BKS-db (DB / DB) mouse model (i.e., the Lepr gene-deficient mouse model with a C57BLKS / J genetic background) is the main experimental animal model for studying metabolic diseases of the LEPR pathway. BKS-db mice are infertile in females, have reduced male reproductive ability, start to become obese at about 3-4 weeks, have elevated plasma insulin, elevated blood glucose, and die at about 10 months of age. BKS-DB mice are widely used in the research and development of the pathogenesis and drug screening related to obesity and hyperglycemia. However, many studies have pointed out that mice with a C57BLKS genetic background have a significant susceptibility to hyperglycemia and obesity, and the genetic factors among them are still unclear. Compared with other inbred mouse strains, the total cholesterol and high-density lipoprotein levels of C57BLKS mice are lower when on a normal diet. The total cholesterol and high-density lipoprotein levels are relatively high in a diet-induced atherosclerosis diet (Naggert JK, Mu JL, Frankel W, Bailey DW, Paigen B. Genomic analysis of the C57BL / Ks mouse strain. Mamm Genome. 1995. 6(2): 131-3.). The atherosclerotic lesions caused by a high-fat diet in C57BLKS mice are more severe than those in other inbred mouse strains. The Cpefat gene mutation leads to severe obesity, hyperlipidemia, and hyperglycemia in C57BLKS background mice, while only mild obesity without hyperglycemia in HRS / J background mice ([1] Mao HZ, Roussos ET, Péterfy M. Genetic analysis of the diabetes-prone C57BLKS / J mouse strain reveals genetic contribution from multiple strains. Biochim Biophys Acta. 2006. 1762(4): 440-6. [2] Leiter EH, Chapman HD, Coleman DL. The influence of genetic background on the expression of mutations at the diabetes locus in the mouse. V. Interaction between the db gene and hepatic sex steroid sulfotransferases correlates with gender-dependent susceptibility to hyperglycemia. Endocrinology. 1989. 124(2): 912-22.).Current research results have not yet discovered the genetic genes that determine the susceptibility to hyperglycemia and obesity in C57BLKS mice, nor can the molecular mechanism of their susceptibility be explained (Collin GB, Maddatu TP, Sen S, Naggert JK. Genetic modifiers interact with Cpe(fat) to affect body weight, adiposity, and hyperglycemia. Physiol Genomics. 2005. 22(2): 182-90.). Due to the C57BLKS genetic background of BKS-DB mice, their classic obesity and hyperglycemia phenotypes are not the result of a complete deletion of the Lepr gene, but rather the superimposed effect of the Lepr gene deletion and the susceptibility of the C57BLKS genetic background. Moreover, due to their special C57BLKS background, BKS-DB mice cannot be used to analyze and compare phenotypes with other genetically modified mice with a B6 (C57BL / 6J) background, or to conduct genetic mating of mice to study the synergistic effects of multiple genes. Summary of the Invention

[0005] Based on the deficiencies in the prior art, the present invention provides a method for constructing a Lepr gene knockout mouse model under a C57BL / 6J background and its application.

[0006] This study was based on C57BL / 6 mice to construct Lepr gene mutant mice. The sgRNA sites were designed on both sides of exon19 in the topological region and transmembrane region of the Lepr gene. Using the CRISPR / Cas9 technology and fertilized egg injection technology, a 159bp genomic fragment was cut, deleting 908aa - 960aa in its topological region, resulting in premature termination of the Lepr gene, disrupting the intracellular signal transduction function of the mouse LEPR protein, without affecting other Lepr gene subtypes. The obtained F0 generation mice were purified by mating and breeding to obtain stable C57BL6 background Lepr gene knockout mice. These mice have a clear genetic background, lack functional LEPR protein, and have obvious characteristics such as obesity, hyperlipidemia, and reproductive organ development defects. They do not have the characteristics of hyperglycemia, hyperinsulinemia, and high mortality of BKS-DB mice (Lepr gene knockout mice with C57BLKS / J background). They are a new type of obese mouse model with Lepr gene knockout. Their gene phenotypes exclude the influence of the C57BLKS / J genetic background and are the direct result of Lepr gene deletion. They can be used to study the pathogenesis of obesity, hyperlipidemia, and reproductive organ development defects in the Lepr gene pathway, evaluate the screening of therapeutic drugs and the efficacy of treatment methods for various diseases such as obesity-related cardiovascular and cerebrovascular diseases and fertility disorders, and have broad application prospects. They can also be used for systematic comparative analysis with other B6 (C57BL / 6J) background gene knockout mice and the study of the synergistic effects of multiple genes in genetic mating.

[0007] The specific technical solution of the present invention is as follows:

[0008] The present invention provides a method for constructing a Lepr gene knockout mouse model, deleting 908aa - 960aa in the topological region of the Lepr gene in mice, resulting in premature termination of the Lepr gene and causing the absence of functional LEPR protein.

[0009] Preferably, the mice are C57BL / 6J background mice.

[0010] Specifically, the CRISPR-Cas9 gene knockout method is used, and a total of three sgRNAs are used. The nucleotide sequences of the sgRNAs are as follows:

[0011] sg-1: AGAACGCTCTTCCAGACGTG;

[0012] sg-2: TGGCGGCGTACGAGGCTGAG;

[0013] sg-3: ACTGTGGAATACCCATCACG.

[0014] Preferably, the mass concentrations of sg-1, sg-2, and sg-3 are the same.

[0015] The method for constructing the Lepr gene knockout mouse model of the present invention includes the following steps:

[0016] (1) Take mouse sperm and oocytes respectively, and obtain fertilized eggs after in vitro fertilization;

[0017] (2) Mix the purified and active sgRNA with Cas9 protein and microinject it into the fertilized eggs obtained in step (1) to obtain fertilized eggs after injection;

[0018] (3) Transplant the fertilized eggs after injection obtained in step (2) into the oviduct of pseudopregnant mice to develop and give birth to obtain F0 generation chimeric mice;

[0019] (4) Mate and breed the F0 generation chimeric mice with wild-type mice to obtain F1 generation heterozygous mice;

[0020] (5) The F1 generation heterozygous mice are then mated between males and females of the same genotype to obtain F2 generation homozygous mice, which are the Lepr gene knockout mouse model.

[0021] Preferably, the concentration of Cas9 protein during microinjection is 100 ng / μL, and there are 3 sgRNAs, and the concentration of each sgRNA is 40 ng / μL. The total mass concentration ratio of Cas9 protein to the 3 sgRNAs is 1:0.9 - 1.5.

[0022] In steps (3) to (5), the tails of the born mice are cut to extract DNA, and PCR amplification and sequencing of the PCR amplified DNA products are used to respectively select heterozygous and Lepr gene knockout mice.

[0023] The present invention also provides the application of the Lepr gene knockout mouse model constructed by the above construction method in the screening of obesity drugs targeting the Lepr signaling pathway.

[0024] The Lepr gene knockout mouse model constructed by the construction method of the present invention can be used as a disease animal model for hyperlipidemia to deeply understand the pathogenesis of hyperlipidemia.

[0025] The present invention constructs a model of Lepr gene knockout mice by using a combination of sgRNAs and CRISPR-Cas9 technology, and the construction method is stable.

[0026] The obesity and hyperlipidemia phenotypes of the Lepr gene knockout mouse model constructed by the present invention are obvious. The Lepr gene knockout mice constructed according to the present invention can be used as a screening model for obesity and hyperlipidemia drug treatment, and can be used to deeply understand the pathogenesis of obesity and hyperlipidemia. Brief Description of the Drawings

[0027] Figure 1Construction and gene identification analysis of Lepr gene knockout mice. A shows the sequencing of PCR products to analyze the knockout sequence of the gRNA target in F1 generation mice. "(#bp)" represents the omitted gene coding number, "---" represents the deleted bp, and Exon 1...19 represent exons 1...19. B shows the gene identification results of the born F0 generation chimeric mice, where mice 21# and 24# represent different fragment deletions. Marker is DL1000. C shows the F1 generation heterozygous Lepr + / - mice were intercrossed to obtain homozygous Lepr - / - mice gene identification results. Among them, the wild-type mice are 421bp, and Lepr - / - mice are 272bp, and Lepr + / - mice have 421bp and 272bp bands; Marker is DL1000.

[0028] Figure 2 Analysis of the obese phenotype of Lepr gene knockout mice. A and B show the body weight statistics of male and female 16-week-old Lepr - / - mice and wild-type mice born in the same litter (n≥4). C shows the body shape diagrams of 16-week-old female Lepr - / - mice and wild-type mice born in the same litter.

[0029] Figure 3 For 16-week-old wild-type and Lepr - / - mice, after 8 weeks of normal diet and high-fat diet, the analysis of the body weight (A), blood glucose (B), and insulin (C) levels of wild-type and Lepr - / - mice.

[0030] Figure 4 For 16-week-old wild-type and Lepr - / - mice, after 8 weeks of normal diet and high-fat diet, the analysis of the four blood lipid items of wild-type and Lepr - / - mice. A shows the level change of TG (triglyceride); B shows the level change of TCHO (total cholesterol); C shows the level change of LDL-c (low-density lipoprotein); D shows the level change of HDL-c (high-density lipoprotein).

[0031] Figure 5 For 16-week-old wild-type and Lepr - / - mice, after 8 weeks of normal diet and high-fat diet, the blood biochemical analysis of wild-type and Lepr - / - mice. A shows the level change of total protein (TP); B shows the level change of albumin (ALB); C shows the level change of insulin (INS); D shows the level change of aspartate aminotransferase (AST / GOT); E shows the level change of alanine aminotransferase (ALT / GPT).

[0032] Figure 6 For wild-type and Lepr mice at 16 weeks of age - / - After 8 weeks of normal diet and high-fat diet in mice, blood routine analysis of wild-type and Lepr mice - / - A shows the level change of white blood cell count (WBC); B shows the level change of red blood cell count (RBC); C shows the level change of hemoglobin concentration (HGB); D shows the level change of platelet count (PLT).

[0033] Figure 7 For wild-type and Lepr mice at 16 weeks of age - / - After 8 weeks of normal diet and high-fat diet in mice, oil red O fat staining analysis of the aortic arch of wild-type and Lepr mice - / - A shows the staining of wild-type mice and Lepr mice under normal diet conditions - / - B shows the staining of wild-type mice and Lepr mice under high-fat diet conditions - / -

[0034] Figure 8 Analysis of body weight (A), blood glucose (B), and insulin (C) levels of wild-type and Lepr mice at 16 weeks and 48 weeks of age - / -

[0035] Figure 9 Analysis of four blood lipid parameters of wild-type and Lepr mice at 16 weeks and 48 weeks of age - / - A shows the level change of TG; B shows the level change of TCHO; C shows the level change of LDL-c; D shows the level change of HDL-c

[0036] Figure 10 Analysis of blood biochemistry of wild-type and Lepr mice at 16 weeks and 48 weeks of age - / - A shows the level change of TP; B shows the level change of ALB; C shows the level change of AST / GOT; D shows the level change of ALT / GPT; E shows the level change of INS

[0037] Figure 11 Analysis of blood routine of wild-type and Lepr mice at 16 weeks and 48 weeks of age - / - A shows the level change of WBC; B shows the level change of RBC; C shows the level change of HGB; D shows the level change of PLT

[0038] Figure 12 Analysis of oil red O fat staining of the aortic arch of wild-type and Lepr mice at 16 weeks and 48 weeks of age - / - A shows the staining of Lepr mice and wild-type mice at 16 weeks of age - / - B shows the staining of Lepr mice and wild-type mice at 48 weeks of age​​- / - Staining of mice and wild-type mice.

[0039] Figure 13 Lepr gene knockout mice have significant reproductive defects. A and B counted 4 - 6 pairs of Lepr - / - male and female mice mating with each other, Lepr - / - male and female mice mating with wild-type mice respectively, and the average number of litters and the number of mice per litter born from wild-type mice mating.

[0040] Figure 14 For wild-type and Lepr - / - Histopathological analysis of the testes of wild-type and Lepr mice. A shows the testis weight ratio statistics of wild-type and Lepr - / - mice (n≥4). B shows the testis pictures of wild-type and Lepr - / - mice. C shows the H&E stained sections of the testes of wild-type and Lepr - / - mice. D shows the Ki67 stained sections of the testes of wild-type and Lepr - / - mice.

[0041] Figure 15 For wild-type and Lepr - / - Histopathological analysis of the ovaries of wild-type and Lepr mice. A shows the ovary pictures of wild-type and Lepr - / - mice. B shows the H&E stained sections of the ovaries of wild-type and Lepr - / - mice. C shows the Ki67 stained sections of the ovaries of wild-type and Lepr - / - mice. Specific implementation manners

[0042] The following further elaborates on the present invention with specific embodiments, which is an explanation rather than a limitation of the present invention.

[0043] The obese and hyperlipidemic mouse model with Lepr gene knockout established in the present invention, compared with wild-type mice and Lepr mice with different genetic backgrounds constructed by other methods - / - shows characteristic obesity, hyperlipidemia, and reproductive defects. The Lepr gene knockout mice constructed in the present invention can be used in a screening model for drug treatment of obesity, hyperlipidemia, and obesity-related reproductive defects based on the Lepr signaling pathway.

[0044] Experimental animals:

[0045] SPF-grade C57BL / 6J mice were provided by Shanghai SLAC Laboratory Animal Co., Ltd. (SCXK(Shanghai)2017 - 0005); ICR mice were provided by Zhejiang Laboratory Animal Center (SZXK(Zhejiang)2014 - 0001).

[0046] Construction of Lepr Gene Knockout Mice in Example 1

[0047] (1) According to the mouse Lepr gene sequence in Genbank (Genbank number: NM_146146.4), the gRNA sequences were designed using the website tool at http: / / crispr.mit.edu / for the coding region topological region and transmembrane region (see SEQ ID NO.1 in the sequence listing).

[0048] sgRNA-1: TTCTGCAAATGTGACTGAAT,

[0049] sgRNA-2: CTTCTTCTGGAGCCTGAACC,

[0050] sgRNA-3: AGCAGCTATGGTCTCCCTTC.

[0051] (2) In vitro transcription of sgRNA

[0052] The method in the literature (S.Chen, et.a1., Highly Efficient Mouse Genome Editing by CRISPR Ribonucleoprotein Electroporation of Zygotes, J Biol Chem 291(2016)14457-14467.) was used to rapidly synthesize the gRNA transcription template by PCR with Phusion high-fidelity DNA polymerase (NEB); the gRNA was synthesized in vitro using the MEGAshortscript transcription kit (Ambion); and the gRNA was purified using the Megaclear purification kit (Ambion).

[0053] (3) Preparation of CRISPR-Cas9 gene knockout fertilized eggs

[0054] 100 ng / μl of Cas9 protein and 40 ng / μl each of sgRNA-1, sgRNA-2, and sgRNA-3 were mixed and injected into the fertilized eggs using fiber injection technology, and the fertilized eggs treated as above were transplanted into the uterus of ICR surrogate mice.

[0055] (4) Surrogacy and obtaining F0 generation founder mice

[0056] A total of 28 F0 generation founder mice were obtained by the surrogacy of surrogate mice. The tails of the newborn mice were cut off, and PCR amplification was performed followed by DNA sequencing of the amplification products; the obtained F0 generation mice were identified by DNA sequencing and PCR ( Figure 1 B); the specific DNA fragments deleted in the mice are shown in SEQ ID NO.1.

[0057] (5) Breeding offspring

[0058] The F0 chimeric mice were mated with wild-type mice to breed C57BL / 6J (Mouse ID#21, #24) × C57BL / 6J (WT), and the F1 generation of mice was obtained; the F1 generation of mice was subjected to PCR sequencing and identification to determine the genotype mutation ( Figure 1 ) as LineA, and the knockout sequence is shown in SEQ ID NO.1; the F1 generation of LineA mice was crossbred to obtain the F2 generation of mice, and the tails of the F2 generation of mice were cut and amplified by PCR, and the PCR amplification products were identified and DNA sequenced ( Figure 1 ).

[0059] (6) The sequence information of the PCR primers designed for gene identification in the construction steps is as follows:

[0060] PCR primer Mouse Lepr-F: 5’-AGACTGCCTCTCCCTTCTGATTTT-3’,

[0061] PCR primer Mouse Lepr-R: 5’-ACTCATCCTCACAGGTTACCTGG-3’.

[0062] Example 2 The Lepr gene knockout mice have significant obesity phenotypes

[0063] Under normal diet, Lepr - / - mice and their wild-type littermates (n≥4 each) were subjected to body weight and blood glucose analysis. As Figure 2 shown in A, compared with the wild-type mice, the body weight of the Lepr - / - mice constructed in the present invention increased significantly under normal diet. As Figure 2 shown in B, at 16 weeks of age under normal diet, the female Lepr - / - mice were more obese than the wild-type female mice ( Figure 2 C).

[0064] Example 3 Analysis of body weight, blood glucose, and insulin levels of 16-week-old wild-type and Lepr - / - mice after 8 weeks of normal diet and high-fat diet - / - After 8 weeks of normal diet and high-fat diet for the 16-week-old wild-type and Lepr

[0065] mice constructed in the present invention, the body weight, blood glucose, and insulin levels of the wild-type and Lepr - / - mice were analyzed. Compared with the wild-type mice, the body weight ( Figure 3 ) of the Lepr Figure 3B and C). The Lepr constructed in the present invention - / - Compared with wild-type mice, after 8 weeks of high-fat diet, the body weight of Lepr mice increased significantly ( Figure 3 A); there were no significant changes in body glucose and insulin levels ( Figure 3 B and C). In female Lepr - / - mice, compared with wild-type mice, the body glucose and insulin levels were higher in normal diet, but due to the small number of mice tested (n≥3), further data analysis needs to be continued to determine its accuracy.

[0066] Example 4 Wild-type and Lepr at 16 weeks of age - / - After 8 weeks of normal diet and high-fat diet in mice, wild-type and Lepr - / - Analysis of four lipid parameters, blood biochemistry, and blood routine in mice

[0067] Under normal diet and high-fat diet, Lepr - / - In mice and their littermate wild-type mice (N>6), after anesthesia with sodium pentobarbital aqueous solution, blood was collected from the orbital venous plexus; for blood biochemical detection, an automatic blood analyzer (Celltace) was used;

[0068] The detection indexes included: TG, TCHO, LDL-c, HDL-c, TP, ALB, INS, AST / GOT, ALT / GPT;

[0069] The Lepr constructed in the present invention under normal diet - / - Compared with wild-type mice, TG, TP, and AST / GOT increased significantly; ALB increased significantly and was more obvious in male mice, while TCHO, LDL-c, HDL-c, and ALT / GPT did not change significantly ( Figures 4 - 5 );

[0070] The Lepr constructed in the present invention under high-fat diet - / - Compared with wild-type mice, LDL-c and ALT / GPT increased significantly, TCHO increased significantly in male mice, while TG, HDL-c, TP, ALB, and AST / GOT did not change significantly ( Figures 4 - 5 ).

[0071] The Lepr constructed in the present invention under normal diet - / - Compared with wild-type mice ( Figure 6 ), RBC and HGB decreased significantly, while WBC and PLT did not change significantly.

[0072] The Lepr mice constructed in the present invention - / - compared with wild-type mice ( Figure 6 ), there were no significant changes in WBC, RBC, HGB, and PLT.

[0073] Example 5 Aortic arch growth and atherosclerotic lesions in 16-week-old wild-type and Lepr - / - mice after 8 weeks of normal diet and high-fat diet. For wild-type and Lepr - / - mice, the aortic arch

[0074] Cervical dislocation was used to sacrifice Lepr - / - mice and their littermate wild-type mice under normal diet and high-fat diet. The aortic arches were dissected, fixed overnight with 4% paraformaldehyde solution, and stained with Oil Red O for fat. Microscopic examination was performed to observe the aortic arches of Lepr - / - mice and wild-type mice under normal diet and high-fat diet, respectively. The vascular wall thickness at the aortic arch of Lepr - / - mice was significantly greater than that of wild-type mice, and there was clear fat staining inside the blood vessels, indicating preliminary atherosclerotic lesions of the aortic arch ( Figure 7 ).

[0075] Example 6 Analysis of body weight, blood glucose, and insulin levels in 16-week-old and 48-week-old wild-type and Lepr - / - mice

[0076] For 16-week-old and 48-week-old Lepr - / - mice and their littermate wild-type mice, body weight, blood glucose, and insulin levels were analyzed. For 16-week-old and 48-week-old Lepr - / - mice and their littermate wild-type mice, blood was collected from the orbital venous plexus after anesthesia with sodium pentobarbital aqueous solution. Compared with wild-type mice, the 16-week-old Lepr - / - mice constructed in the present invention ( Figure 8 ) had a significantly increased body weight; there were no significant changes in blood glucose and insulin.

[0077] Compared with wild-type mice, the 48-week-old Lepr - / - mice constructed in the present invention ( Figure 8 ) had a significantly increased body weight; blood glucose and insulin were significantly increased, and the increase was more obvious in female mice.

[0078] Example 7 Analysis of four lipid parameters, blood biochemistry, and blood routine in 16-week-old and 48-week-old wild-type and Lepr - / - mice

[0079] Blood biochemical tests were performed using an automatic blood biochemical analyzer;

[0080] The detection indicators included: TG, TCHO, LDL-c, HDL-c, TP, ALB, INS, AST / GOT, ALT / GPT;

[0081] The 16-week-old Lepr - / - mice constructed in the present invention, compared with wild-type mice ( Figure 9 and Figure 10 ), showed a significant increase in TG, TP, and AST / GOT, a significant increase in ALB with a more significant increase in male mice, a significant increase in INS in female mice, and no significant changes in TCHO, LDL-c, HDL-c, and ALT / GPT;

[0082] The 48-week-old Lepr - / - mice constructed in the present invention, compared with wild-type mice ( Figure 9 and Figure 10 ), showed a significant increase in LDL-c and INS, a significant increase in TCHO and ALT / GPT with a more significant increase in male mice, a significant increase in ALB and AST / GOT in male mice, and no significant changes in TG, HDL-c, and TP.

[0083] For the 16-week-old and 48-week-old Lepr - / - mice and their littermate wild-type mice (N>6 each), after anesthesia with sodium pentobarbital aqueous solution, blood was collected from the orbital venous plexus;

[0084] Blood routine tests were performed using an automatic blood routine analyzer (Celltace);

[0085] The detection indicators included: WBC, RBC, HGB, PLT;

[0086] The 16-week-old Lepr - / - mice constructed in the present invention, compared with wild-type mice ( Figure 11 ), showed a significant decrease in RBC, HGB, HCT (hematocrit), and MCV, and no significant changes in WBC and PLT.

[0087] The 48-week-old Lepr - / - mice constructed in the present invention, compared with wild-type mice ( Figure 11 ), showed a significant decrease in RBC and HCT, and no significant changes in WBC, HGB, and PLT.

[0088] Example 8 Growth and atherosclerotic lesions of the aortic arch in 16-week-old and 48-week-old wild-type and Lepr - / - mice

[0089] Cervical dislocation was used to euthanize 16-week-old and 48-week-old Lepr - / - mice and their littermate wild-type mice. The aortic arches were dissected, fixed overnight in 4% paraformaldehyde solution, and stained with Oil Red O for fat. Microscopic examination was performed to observe the aortic arches of 16-week-old and 48-week-old Lepr - / - mice and wild-type mice respectively. The vascular wall thickness at the aortic arch of Lepr - / - mice was significantly greater than that of wild-type mice, and there was relatively clear fat staining inside the blood vessels, indicating preliminary aortic arch atherosclerosis( Figure 12 ).

[0090] Example 9 Lepr gene knockout mice have significant reproductive ability defects

[0091] Lepr - / - male and female mice were respectively mated with wild-type mice for 4 months for comparison, including: Lepr- / - mice mated with each other, Lepr - / - male and female mice were respectively mated with wild-type male and female mice, and wild-type mice mated with each other. As Figure 13 shown in A, Lepr - / - comparing the litter numbers of wild-type mice, it was found that the litter numbers of male and female Lepr - / - mice decreased significantly. As Figure 13 shown in B, Lepr - / - comparing the litter sizes of wild-type mice, it was found that the litter sizes of male and female Lepr - / - mice decreased significantly.

[0092] Cervical dislocation was used to euthanize Lepr - / - male mice and their littermate wild-type male mice. Their testes and epididymides were dissected; each testis was weighed. As Figure 14 shown, the testis weight ratio of Lepr - / - male mice was significantly smaller than that of wild-type male mice. Lepr - / - mice and their littermate wild-type mice were dissected to obtain testis tissues, which were fixed overnight in 4% paraformaldehyde solution, stained with hematoxylin and eosin (H&E) and Ki67, and then the tissue structure of the testes was observed under a microscope. Microscopic examination was performed to observe the morphology of the seminiferous tubules of wild-type and Lepr - / - mice respectively. The number of seminiferous tubules in Lepr - / - mice was small, and the number of Ki67-positive cells was small( Figure 14 ).

[0093] Cervical dislocation was used to euthanize Lepr - / -Female mice and wild-type female mice of the same litter were dissected to obtain their ovarian and uterine tissues for hematoxylin and eosin (H&E) staining and Ki67 staining, and the organizational structure of the ovaries was observed under a microscope. Microscopic examination was performed to observe the number of follicles in wild-type and Lepr - / - mice, respectively. It was found that the number of follicular cells in wild-type mice was relatively large, while the number of follicles in Lepr - / - mice decreased ( Figure 15 ).

Claims

1. A method for constructing a Lepr gene knockout mouse model, characterized in that: Exon 19 of the Lepr gene was knocked out in mice, resulting in the absence of functional LEPR protein.

2. The method for constructing the Lepr gene knockout mouse model according to claim 1, characterized in that: The mice were of C57BL / 6J background.

3. The method for constructing the Lepr gene knockout mouse model according to claim 1, characterized in that: Using the CRISPR-Cas9 gene knockout method, three sgRNAs were used, and the nucleotide sequences of the sgRNAs were: sg-1:AGAACGCTCTTCCAGACGTG; sg-2:TGGCGGCGTACGAGGCTGAG; sg-3: ACTGTGGAATACCCATCACG.

4. The method for constructing a Lepr gene knockout mouse model according to claim 3, characterized in that: The mass concentrations of sg-1, sg-2 and sg-3 are the same.

5. The method for constructing a Lepr gene knockout mouse model according to claim 3, characterized in that: The following steps are involved: (1) Sperm and oocytes of mice are obtained separately, and fertilized eggs are obtained after in vitro fertilization; (2) mixing the purified active sgRNA with the Cas9 protein and microinjecting the mixture into the fertilized egg obtained in step (1) to obtain an injected fertilized egg; (3) transplanting the injected fertilized eggs obtained in step (2) into the fallopian tubes of pseudo-pregnant mice for development and delivery to obtain F0 generation chimeric mice; (4) F0 generation chimeric mice are mated with wild-type mice to obtain F1 generation heterozygous mice; (5) The F1 generation heterozygous mice are then mated with males and females of the same genotype to obtain the F2 generation homozygous mice, which are the Lepr gene knockout mouse model.

6. The method for constructing a Lepr gene knockout mouse model according to claim 5, characterized in that: The concentration of Cas9 protein during microinjection was 100 ng / μL, and the concentration of each of the three sgRNAs was 40 ng / μL.

7. The method for constructing a Lepr gene knockout mouse model according to claim 6, characterized in that: The total mass concentration ratio of Cas9 protein to three sgRNAs was 1:0.9-1.

5.

8. Use of the Lepr gene knockout mouse model constructed by the construction method according to any one of claims 1 to 7 in the screening of obesity drugs targeting the Lepr signaling pathway.

Images