Method for preparing vanillin by displaying whole-cell catalyst on surface based on Spark-spytag technology

Abstract

The invention relates to a method for preparing vanillin by displaying a whole-cell catalyst on the surface based on a Spark-spytag technology. The method comprises the following steps: 1) verifying surface display feasibility by using red and green fluorescence; (2) constructing a surface display gene engineering bacterium; 3) preparing a whole-cell catalyst; and 4) carrying out a reaction on the optimized whole-cell catalyst and 4-propyl-guaiacol to generate vanillin. According to the invention, ompA protein of Escherichia coli is used as an anchoring motif, and a surface display system of SpyCatcher / SpyTag is constructed. The SpyCatcher / SpyTag system is further optimized to achieve a higher expression level, and the expression of the SpyCatcher / SpyTag system is compared with the expression in a whole-cell intracellular expression system. In addition, the reusability of the SpyCatcher / SpyTag system is evaluated, so that the industrial application is promoted.

Description

Technical Field

[0001] The present invention relates to a method for preparing vanillin by using a SpyCatcher-spytag technology-based surface-display whole-cell catalyst. The method uses the ompA protein of Escherichia coli as an anchoring motif to construct a surface-display system of SpyCatcher / SpyTag (EUGO-IEM), and thus obtains a (EUGO-IEM) whole-cell catalyst to catalyze the synthesis of vanillin from 4-propyl-guaiacol. Background Art

[0002] Vanillin (4-hydroxy-3-methoxybenzaldehyde) is one of the most widely used aromatic chemicals in the world. It is a popular flavoring compound and has a wide range of applications in industries such as food, fragrance, pharmaceuticals, and chemicals. For example, it is used as a flavor in beverages and as a fragrance component in perfumes and cosmetics. In addition, due to its antibacterial, antimutagenic, and antioxidant activities, it is also used as a biological preservative, etc. Even it is regarded as an attractive platform chemical for synthetic materials, fine chemicals, and pharmaceutical products. Natural vanillin ($1200 - $4000 per kilogram) is extracted from the vanilla bean of the Rutaceae family. The typical plant extraction method is to use ethanol as a solvent to extract vanillin from vanilla pods. The cost of vanillin produced from vanilla beans is high, and the market share only accounts for less than 1% of the global vanilla market. Therefore, the biological process for extracting vanillin from natural raw materials has attracted much attention. Currently, the vanillin on the market is mainly chemically synthesized from guaiacol and lignin. Under alkaline conditions, oxidation can be carried out to obtain vanillin, and the yield is about 10%. Most chemical synthesis methods for obtaining synthetic vanillin have disadvantages such as low product purity, dangerous operating conditions, and pollution generated during the process. Therefore, biotransformation, as an alternative technology for synthesizing vanillin, has been increasingly valued in the industry. The biotransformation technology of vanillin usually involves microbial transformation, enzyme synthesis, or direct fermentation from various raw materials. At present, various natural substances, such as lignin, isoeugenol, ferulic acid, and glucose, have been studied for the biosynthesis of natural vanillin. In contrast, vanillin obtained from petroleum-derived lignin meets more than 85% of the total demand. The cost of vanillin based on petroleum derivatives is relatively low, but the environmental impact during the production process and the strict regulations in the food and pharmaceutical industries limit its attractiveness.

[0003] EUGO from Nocardioides sp. YR527 (NspEUGO), a bacterial eugenol oxidase (EUGOs) can act on lignin degradation products. Bacterial eugenol oxidases (EUGOs) consist of only one protomer and only require dioxygen as a cosubstrate. It has a wide range of catalytic substrates, including hydroxylation at the α and γ positions and dehydrogenation of alkyl chains and bicyclic substrates. It is active against various 4-substituted phenols and contains covalently bound FAD, and is expressed very well as a homodimeric enzyme in Escherichia coli.

[0004] A epoxide-diol pathway for converting the eugenol isomer isoeugenol to vanillin by oxidizing the side chain of isoeugenol has been found in bacteria such as Bacillus. The key enzyme of this pathway is isoeugenol monooxygenase (IEM), mainly from Pseudomonas putida IE27, Pseudomonas nitrificans Jin1 and metagenomic DNA from soil. This enzyme is encoded by the IEM gene. Isoeugenol can be converted to vanillin in one step under the catalysis of isoeugenol monooxygenase [8,15,16] without the addition of additional cofactors. Due to the high yield and low cost of isoeugenol, microbial hosts naturally containing this pathway have been widely explored in vanillin production. By systematically optimizing the enzyme production conditions and the whole-cell catalysis process, the efficiency of the biological process has been further improved.

[0005] In the past few decades, many whole-cell catalysis processes have been implemented in various industries to produce a variety of products. The most important advantages of whole-cell catalysts are their high selectivity, cofactor regeneration, high catalytic efficiency, mild conditions, etc., which are also quite attractive in commercial applications. However, there are still disadvantages, such as substrate or product inhibition and possible inactivation at high temperatures, extreme pH values or in organic solvents. The cell membrane can act as a barrier for material transport and is more likely to produce unwanted metabolic by-products, which may be toxic to the cells and difficult to separate.

[0006] Cell surface display is to attach the target protein to the cell surface through recombinant technology, which can avoid metabolic by-products caused by material transport and improve the efficiency of biocatalysts. Currently, the technology has been widely applied to various biotechnological and biomedical fields, such as drug screening and biosensors, etc. Escherichia coli has become one of the most widely used hosts due to its well-studied genome, complete genetic toolbox, high transformation efficiency and good compatibility with heterologous proteins. Regarding the surface display system of Escherichia coli, the success and efficiency of surface display largely depend on the appropriate selection of the anchoring motif and the nature of the target protein. The selection of the anchoring motif is particularly important because an incorrect motif may disrupt the integrity of the cell envelope and lead to growth defects. The OmpA (LOA) system is the first and widely used carrier protein and has been proven to be able to effectively display proteins of various sizes and characteristics.

[0007] Due to the limited molecular weight of the proteins displayed by the anchoring proteins on the cell surface, proteins with larger molecular weights have poor stability. Therefore, to meet the urgent need for enzyme stability, more effective alternative methods are required. The SpyCatcher / SpyTag technology effectively overcomes the above difficulties. It is a protein ligation tag of the fibronectin-binding protein (FbaB) CnaB2 domain found in Streptococcus pyogenes. SpyCatcher is a small protein containing 116 amino acid residues. It can selectively and spontaneously form an isopeptide bond with the short peptide SpyTag without the need for additional enzymes or chemical catalysis. SpyCatcher and SpyTag can rapidly covalently bind under almost any common conditions, forming an irreversible covalent bond between Asp117 of SpyTag and Lys31 of SpyCatcher. This conjugate can resist forces of thousands of piconewtons and can even boil in sodium dodecyl sulfate (SDS).

[0008] In this application, the ompA protein of Escherichia coli was used as the anchoring motif to construct a surface display system of SpyCatcher / SpyTag (EUGO-IEM). The SpyCatcher / SpyTag (EUGO-IEM) system was further optimized to achieve a higher expression level and compared with its performance in the whole-cell (PET-28a-EUGO-IEM) expression system. In addition, the reusability of the SpyCatcher / SpyTag (EUGO-IEM) system was evaluated to promote industrial applications. Summary of the Invention

[0009] The object of the present invention is to provide a method for preparing vanillin by catalyzing 4-propyl-guaiacol using a whole-cell catalyst of Escherichia coli with surface display (EUGO-IEM) based on the Spycather-spytag technology. The Spycather-spytag technology overcomes some inherent disadvantages of whole-cell catalysts, such as surface display carrying larger proteins with better stability, saving equipment for enzyme immobilization, and greatly simplifying the production process, which has important practical significance and industrial application value. It is specifically achieved through the following technical solutions:

[0010] A method for preparing vanillin using a whole-cell catalyst with surface display based on the Spycather-spytag technology, the method comprising the following steps:

[0011] Step 1: Verify the feasibility of surface display by red and green fluorescence;

[0012] Step 2: Construction of surface-displayed genetically engineered bacteria;

[0013] Step 3: Prepare a whole-cell catalyst using the genetically engineered bacteria constructed in Step 2;

[0014] Step 4: Optimize the reaction of the whole-cell catalyst with 4-propyl-guaiacol to produce vanillin.

[0015] Further, in Step 1, using plasmid PETduet-MCR-GFP, Escherichia coli BL21(DE3) genome, and plasmid pRSFDuet-1pRSFDuet-lo as templates, PCR amplify the sfGFP, lpp-OmpA, and SpyCather gene fragments; using plasmid

[0016] pETDuet-His6-TEV-Cys-affibody-LPETGG-mCherry as a template, PCR amplify the bacterial mcherry-Spytag gene fragment.

[0017] Further, the amplification system is 50 μL: 18 μL of ddH2O, 25 μL of 2× buffer, 1 μL of dNTPs at 5 mmol / L, 2 μL of upstream primer at 10 μmol / L, 2 μL of downstream primer at 10 μmol / L, 2 μL of template, and 1 μL of Phanta Max Super-Fidelity DNA Polymerase; the PCR amplification products are electrophoresed on a 1% agarose gel to obtain bands of 771 bp, 579 bp, 413 bp, and 795 bp. Use the Toloprep Gel Extraction and PCR purification Kit recovery kit to recover the PCR products, and cut the gel to recover the sfGFP, lpp-OmpA, SpyCather, and mcherry-Spytag gene fragments;

[0018] The PCR amplification conditions are as follows: pre-denaturation at 95°C for 10 min, 1 cycle in total; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 45 s, 2 cycles in total; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 45 s, 5 cycles in total; denaturation at 95°C for 15 s, annealing at 59°C for 15 s, extension at 72°C for 45 s, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 5 min, 11 cycles in total; 34 cycles in total.

[0019] Furthermore, digest the pBAD plasmid with XhoI and HindIII enzymes. Then, insert sfGFP, lpp-OmpA, and SpyCather into the XhoI and HindIII sites of the pBAD plasmid through homologous recombination to construct the plasmid pBAD-LPP-OMP-GFP-SpyCather. Transfer the recombinant plasmid system into DH5α competent cells, coat it on SOC agar solid medium containing Amp resistance, and culture for 24 h. Pick colonies for colony PCR, and select positive clones to send samples to a sequencing company for sequencing. Amplify the corresponding fragment MCherry-spytag, and then insert it into the Nde I and EcoRI sites of the plasmid PET-28A through homologous recombination to construct the plasmid PET-28A-mcherry-Spytag. Transfer the recombinant plasmid system into DH5α competent cells, coat it on SOC agar solid medium containing Kana resistance, and culture for 24 h. Pick colonies for colony PCR, and select positive clones to send samples to a sequencing company for sequencing. If the sequencing results are correct, chemically transform the two plasmids pBAD-LPP-OMP-GFP-SpyCather and PET-28A-mcherry-Spytag into BL21(DE3).

[0020] Furthermore, for the construction of the surface display genetic engineering bacteria in Step 2: Using the plasmid pET28a-IEM as a template, amplify the anchored unit IEMtag gene sequence with primers IEMtag-F and IEMtag-R1, IEMtag-R2. Using the plasmid pBAD-EUGO as a template, amplify the anchored unit EUGO-link gene sequence with primers EUGO-F and EUGO-R. Connect the PCR products of the IEMtag and EUGO-link gene fragments to the NdeI / EcoRI sites of the plasmid pET28a with a homologous recombination enzyme to obtain the recombinant plasmid pET28a-EUGO-link-IEMtag. Using the plasmid pBAD24-Lpp‘OmpA-3FLAG-SpyCatcher003 as a template, amplify the anchored unit Lpp-OmpA with primers OMPA-F2 and OMPA-R2, and amplify the anchored unit SpyCatcher with primers Spy-F2 and Spy-R2. Connect the PCR products of the Lpp-OmpA and SpyCatcher gene fragments to the XhoI and HindI II sites of the plasmid pBAD with a homologous recombination enzyme to obtain the recombinant plasmid pBAD-ompA-spycather. After the above plasmids (DH5α) are verified correctly by a sequencing company, extract the plasmids and transfer them into Escherichia coli BL21(DE3).

[0021] Furthermore, the specific steps of Step 3 are as follows:

[0022] 1) Inoculation: Pick a single colony strain on the LB solid medium with Amp and kana double antibiotics, inoculate it into 5 ml of LB liquid medium, and culture it at 220 rpm and 37 °C for 12 h. The above process is carried out under strict aseptic conditions in a laminar flow hood;

[0023] 2) Subculture: Pipette 500 μL from 5 ml of LB liquid medium and inoculate it into 500 ml of LB liquid medium. Place it in a Zhichu shaker and culture it at 37 °C and 220 rpm for 6 h until the OD600 reaches 0.6 - 0.8;

[0024] 3) Induced culture of the strain: When the OD600 reaches 0.6 - 0.8, add isopropyl β-D-1-thiogalactopyranoside with a final concentration of 0.4 M / 0.2% L-arabinose, and continue the induced culture at an appropriate temperature for 24 h. Centrifuge, wash the cell pellet twice with a buffer containing 100 mM PBS, pH 7.2 - 7.4, and collect the cells. Description of the Drawings

[0025] Figure 1 It shows the fluorescence expression of Escherichia coli PET-28A-mcherry-Spytag;

[0026] Figure 2 It shows the fluorescence expression of Escherichia coli pBAD-LPP-OMP-GFP-SpyCather;

[0027] Figure 3 It shows the fluorescence expression of Escherichia coli co-expressing GFP-mcherry;

[0028] Figure 4 It is SDS-Page; Lane 1: Whole cell SC-ST (EUGO-IEM); Lane 2: Whole cell 28A-EUGO-IEM;

[0029] Figure 5 It is HPLC: Verification of the catalytic activity of the SC-ST whole cell surface display system;

[0030] Figure 6 It shows the effect of pH on vanillin synthesis;

[0031] Figure 7 It shows the effect of catalytic temperature on vanillin synthesis;

[0032] Figure 8 It shows the effect of 4-propylguaiacol concentration on vanillin synthesis;

[0033] Figure 9 It shows the reusability of the surface-displayed whole cell biocatalyst system;

[0034] Figure 10To investigate the effect of induction temperature on vanillin synthesis and protein expression;

[0035] Figure 11 This is the process flow chart of the preparation method of the present invention. Detailed implementation manners

[0036] The following further describes the present invention in conjunction with the accompanying drawings of the specification to better understand the technical solution.

[0037] A method for preparing vanillin by surface-displaying whole-cell catalysts based on the Spycather-spytag technology, and its process flow chart is as Figure 11 shown, and specifically includes the following steps:

[0038] Step 1: Verify the feasibility of surface display by red and green fluorescence;

[0039] Step 2: Construction of surface-displaying genetically engineered bacteria;

[0040] Step 3: Prepare whole-cell catalysts using the genetically engineered bacteria constructed in Step 1;

[0041] Step 4: Optimize the reaction of the whole-cell catalyst with 4-propyl-guaiacol to produce vanillin by changing single-factor variable conditions.

[0042] Specifically, Step 1 is as follows:

[0043] 1. Obtaining red and green fluorescent protein genes and the anchoring protein OmpA, specifically:

[0044] 1.1 Using plasmid PETduet-MCR-GFP, Escherichia coli BL21(DE3) genome, and plasmid pRSFDuet-1pRSFDuet-lo as templates, PCR amplify the sfGFP, lpp-OmpA, and SpyCather gene fragments; using plasmid pETDuet-His6-TEV-Cys-affibody-LPETGG-mCherry as a template, PCR amplify the bacterial mcherry-Spytag gene fragment.

[0045] 1.2 Using pBAD-OMP-GFP-F and pBAD-OMP-GFP-R, PCR amplify the anchoring protein LPP-OmpA gene fragment:

[0046] (1) pBAD-OMP-GFP-F: 5′ATGGGGATCCGAGCTCGAGAAGGCGACCAAACTGGTGCTG3′;

[0047] (2) pBAD-OMP-GFP-R: 5′TCACCTTTGCTAACTTTTTTGGAACCGCCTTTGTCGTCAT3′;

[0048] 1.3 pBAD-GFP-F and pBAD-SPY-R, PCR amplify the ankyrin sfGFP gene fragment:

[0049] (3) pBAD-GFP-F:

[0050] 5′ATGACGACAAAGGCGGTTCCAAAAAAGTTAGCAAAGGTGA3′;

[0051] (4) pBAD-GFP-R:

[0052] 5′cgctgccgccgccgccCACGTGATTGCTGCCTTTATACAG3′;

[0053] 1.4 pBAD-SPY-F and pBAD-GFP-R, PCR amplify the ankyrin SpyCather gene fragment:

[0054] (5) pBAD-SPY-F:

[0055] 5′ACTGTATAAAGGCAGCAATCACGTGggcggcggcggcagcg3′;

[0056] (6) pBAD-SPY-R:

[0057] 5′TCTTCTCTCATCCGCCAAAACAGCCAAGCTTTTAaatatgcgcatcgcctttggtcgc3′;

[0058] 1.5 28A-Spytag-mCherry-f1, 28A-Spytag-mCherry-f2 and 28A-mCherry-r, PCR amplify the ankyrin mcherry-Spytag gene fragment:

[0059] (7) 28A-Spytag-mCherry-f1:

[0060] 5′TTAtttggtcggtttatacgcatccaccatcacaatatgcgcgctgccgccgccgcc3′;

[0061] 28A-Spytag-mCherry-f2:

[0062] 5′ctgccgccgccgccCTTGTACAGCTCGTCCATGCCGCCGG3′;

[0063] 28A-mCherry-r:

[0064] 5′TGCCGCGCGGCAGCCATATGGTGAGCAAGGGCGAGGACGACA3′。

[0065] The amplification system is 50 μL: 18 μL of ddH2O, 25 μL of 2× buffer, 1 μL of dNTPs at 5 mmol / L, 2 μL of the upstream primer at 10 μmol / L, 2 μL of the downstream primer at 10 μmol / L, 2 μL of the template, and 1 μL of Phanta Max Super-Fidelity DNA Polymerase; The PCR amplification products were electrophoresed on a 1% agarose gel to obtain bands of 771 bp, 579 bp, 413 bp, and 795 bp. The PCR products were recovered using the Toloprep Gel Extraction and PCR purification Kit, and the sfGFP, lpp-OmpA, SpyCather, and mcherry-Spytag gene fragments were recovered by gel excision.

[0066] The PCR amplification conditions were as follows: pre-denaturation at 95°C for 10 min, 1 cycle in total; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 45 s, 2 cycles in total; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 45 s, 5 cycles in total; denaturation at 95°C for 15 s, annealing at 59°C for 15 s, extension at 72°C for 45 s, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 5 min, 11 cycles in total; 34 cycles in total.

[0067] 2. Construction of plasmids for surface display of red and green fluorescent proteins: Digest the pBAD plasmid with XhoI and HindIII. Then, insert sfGFP, lpp-OmpA, and SpyCather into the XhoI and HindIII sites of the pBAD plasmid through homologous recombination to construct the plasmid pBAD-LPP-OMP-GFP-SpyCather. Transfer the recombinant plasmid system into DH5α competent cells, spread them on SOC agar solid medium containing Amp resistance, and culture for 24 h. Pick colonies for colony PCR, and select positive clones to send samples to a sequencing company for sequencing. Amplify the corresponding fragment MCherry-spytag, and then insert it into the NdeI and EcoRI sites of the plasmid PET-28A through homologous recombination to construct the plasmid PET-28A-mcherry-Spytag. Transfer the recombinant plasmid system into DH5α competent cells, spread them on SOC agar solid medium containing Kana resistance, and culture for 24 h. Pick colonies for colony PCR, and select positive clones to send samples to a sequencing company for sequencing. If the sequencing results are correct, chemically transform the two plasmids pBAD-LPP-OMP-GFP-SpyCather and PET-28A-mcherry-Spytag into BL21(DE3).

[0068] 2.1 Restriction digestion system 5 μL: 30 μL of pBAD plasmid, 18 μL of ddH2O, 1 μL of ECoRI enzyme, 1 μL of Nde I enzyme;

[0069] Reaction time: 3 h;

[0070] (1) Homologous recombination system: 10 μL: (sfGFP, lpp-OmpA, SpyCather, pBAD plasmid = 2:2:2:4): 2xMultiF Seamless: 10 μL; Homologous recombination system: 6 μL: (mcherry-Spytag, PET-28a plasmid = 2:4): 2xMultiF Seamless: 6 μL. Place the reaction mixture in a 50 °C water bath for 30 min;

[0071] (2) Cool the reaction system in an ice bath for 1 min, add the above reaction solution to 100 μL of E. coli DH5α competent cells, and mix well;

[0072] (3) Place on ice for 20 min, heat shock at 42 °C for 2 min;

[0073] (4) Ice bath for 2 min, add the competent cells to 500 - 600 μL of B medium, and recover and culture in a shaker at 37 °C and 220 r / min for 50 min;

[0074] (5) After resuscitation culture, take 8000 r / min of the bacterial solution and centrifuge for 2 min. After sucking off 2 / 3 of the supernatant, resuspend the bacterial cells and spread them on the SOC solid medium resistant to Amp and kana.

[0075] 2.2 Co-transform Escherichia coli with plasmid pBAD-LPP-OMP-GFP-SpyCather and PET-28A-mcherry-Spytag:

[0076] (6) Pick a single colony from the pBAD-LPP-OMP-GFP-SpyCather (BL21) culture plate and inoculate it into a 5 mL LB medium test tube. Culture it overnight at 37 °C and 220 r / min on a shaker;

[0077] (7) Transfer 500 μL of the bacterial solution to a 250 mL conical flask containing 50 mL of LB medium. Culture it at 37 °C and 220 r / min on a shaker for 4 - 5 h until OD600 is 0.6 - 0.8;

[0078] (8) Transfer the bacterial solution to a 50 mL centrifuge tube and place it on ice for 15 min;

[0079] (9) Centrifuge at 4 °C and 6000 r / min for 10 min to recover the bacterial cells. Pour out the culture medium and invert the tube for 1 min to allow the liquid medium to drain completely;

[0080] (10) Suspend the precipitate with 10 mL of pre-frozen 0.1 mol / L CaCl2 solution and immediately keep it warm on ice for 15 min;

[0081] (11) Centrifuge at 4 °C and 6000 r / min for 10 min to recover the bacterial cells;

[0082] (12) Resuspend the cells with 1 mL of a mixture of ice-cold 0.1 mol / L CaCl2 and 10% glycerol;

[0083] (13) Aliquot the cells, 100 μL per portion, to obtain competent cells;

[0084] (14) Add the plasmid PET-28A-mcherry-Spytag to 100 μL of E. coli pBAD-LPP-OMP-GFP-SpyCather (BL21) competent cells for chemical transformation to obtain Escherichia coli of the pBAD-LPP-OMP-GFP-SpyCather / PET-28A-mcherry-Spytag type.

[0085] As Figure 1-2As shown in the figure, inverted fluorescence microscope: Select positive clones and inoculate them into 5 mL of LB medium containing 100 mg / mL ampicillin and 50 mg / mL kanamycin. After culturing at 37°C and 220 rpm for 12 h, extract the plasmid using a bacterial plasmid extraction kit. Transform the pBAD-ompA-sfGFP-spycather003 and PET-28a-mCherrytag003 plasmids into Escherichia coli BL21(DE3) competent cells by chemical transformation. Pick single colonies and inoculate them into 5 mL of LB medium containing the corresponding antibiotics. After culturing at 220 rpm and 37°C for 12 h, transfer all of them to 200 mL of LB medium containing 100 mg / mL ampicillin / 50 mg / mL kanamycin. Culture at 220 rpm and 37°C for 5 h. When OD600 reaches 0.5 - 0.8, add the final concentration of 0.2% L-arabinose (mass ratio) / 0.4 M isopropyl β-D-1-thiogalactoside (IPTG) inducer. After inducing at 37°C for 5 h, centrifuge (8000 rpm, 10 min, 4°C), collect the bacterial cells, and use a fluorescence microscope to detect the fluorescence expression of Escherichia coli. Use the non-addition of the inducer as a negative control.

[0086] As Figure 3 shown, confocal laser microscope: Pipette 1 mL of the culture solution (OD600 ≈ 1.6) and centrifuge (6000 rpm, 5 min, 4°C), then resuspend it with 5 mL of PBS phosphate buffer. Then transfer 5 μL of the cells onto a microscope slide and use a confocal fluorescence microscope to observe whether there is an overlapping effect of red and green fluorescence (yellow fluorescence) in the external region of Escherichia coli.

[0087] To test the function of modular SC-ST surface display, this application first studied the formation and integration of the SC-ST complex in the cell envelope using red and green fluorescent proteins and the target protein. For this purpose, ST was fused to the monomeric red fluorescent protein mCherry, and sfGFP was fused to Lpp-OmpA-SC and induced separately to prove that the red and green fluorescent proteins could be expressed separately. Co-transform the mCherry-ST and lp-ompa-sfGFP-sc recombinant plasmids into the same Escherichia coli and induce them with a dual induction system to prove the SC-ST interaction and the co-display of mCherry and sfGFP fluorescence on the cell surface by translocation. Confocal fluorescence microscopy imaging can indeed detect the co-display of the two fluorescent proteins in the external region of Escherichia coli, indicating successful covalent interaction and translocation to the cell envelope, thus confirming the feasibility of the surface co-display of the complex.

[0088] Specifically, step two is as follows:

[0089] Construction of surface-displayed genetically engineered bacteria: Using plasmid pET28a-IEM as a template, the anchored unit IEMtag gene sequence was amplified with primers IEMtag-F and IEMtag-R1, IEMtag-R2. Using plasmid pBAD-EUGO as a template, the anchored unit EUGO-link gene sequence was amplified with primers EUGO-F and EUGO-R. The PCR products IEMtag and EUGO-link gene fragments were ligated into the NdeI / EcoRI sites of plasmid pET28a using homologous recombinase to obtain the recombinant plasmid pET28a-EUGO-link-IEMtag. Using plasmid pBAD24-Lpp‘OmpA-3FLAG-SpyCatcher003 as a template, the anchored unit Lpp-OmpA was amplified with primers OMPA-F2 and OMPA-R2, and the anchored unit SpyCatcher was amplified with primers Spy-F2 and Spy-R2. The PCR products Lpp-OmpA and SpyCatcher gene fragments were ligated into the XhoI and HindIII sites of plasmid pBAD using homologous recombinase to obtain the recombinant plasmid pBAD-ompA-spycather. After the above plasmids (DH5α) were verified correct by a sequencing company, the plasmids were extracted and transferred into Escherichia coli BL21(DE3).

[0090] IEMtag-F, IEMtag-R1 and IEMtag-R2, PCR amplification of IEMtag gene fragment:

[0091] (1) IEMtag-F: 5′CGTGGTCAAAATCTCGGTGGTAGCGGTGGTAGCGCAACCTTTGATCGTAATGATCCGCA3′;

[0092] (2) IEMtag-R1:

[0093] 5′CAAGCTTGTCGACGGAGCTCGAATTCTTAtttggtcggtttatacgcatccaccatcac3′;

[0094] (3) IEMtag-R2:

[0095] 5′acgcatccaccatcacaatatgcgcgctgccgccgccgccATTTTTACTCTGCCAACAG3′.

[0096] EUGO-F and EUGO-R, PCR amplification of EUGO-link gene fragment:

[0097] (4) EUGO-F:

[0098] 5′GCGGCCTGGTGCCGCGCGGCAGCCATATGATGACCCGCACGTTACCACCTGGCGT3′;

[0099] (5)EUGO-R:

[0100] 5′TACGATCAAAGGTTGCGCTACCACCGCTACCACCGAGATTTTGACCACGAAAACGTTGA3′.

[0101] OMPA-F2 and OMPA-R2, PCR amplify the anchor protein Lpp-OmpA, gene fragment:

[0102] (6)OMPA-F2:

[0103] 5′ATGGGGATCCGAGCTCGAGAAGGCGACCAAACTGGTGCTG3′;

[0104] (7)OMPA-R2:

[0105] 5′tatccacgctgccgccgccgccGGAACCGCCTTTGTCGTCATCATCCT3′. Spy-F2 and Spy-R2, PCR amplify the anchor protein SpyCatcher, gene fragment:

[0106] (8)Spy-F2:

[0107] 5′CAAGGATGATGACGACAAAGGCGGTTCCggcggcggcggcagcgtggata3′;

[0108] (9)Spy-R2:

[0109] 5′TCTTCTCTCATCCGCCAAAACAGCCAAGCTTTTAaatatgcgcatcgcctttggtcgc3′.

[0110] Transform pET28a-EUGO-link-IEMtag into Escherichia coli BL21(DE3) competent cells by chemical transformation. After plate culturing for 24 h, pick a single colony and inoculate it into 5 mL of LB medium containing the corresponding antibiotic to prepare pET28a-EUGO-link-IEMtag type competent cells. Then transform the plasmid pBAD-ompA-spycather into the prepared competent cells by chemical transformation again and spread it on the LB solid medium containing both Amp and kana.

[0111] Step 3 is specifically as follows:

[0112] Preparation of SC-ST (EUGO-IEM) whole-cell catalyst

[0113] 1) Inoculation: Pick a single colony strain on the LB solid medium with Amp and kana double antibiotics, inoculate it into 5 ml of LB liquid medium, and culture it at 220 rpm and 37 °C for 12 h. The above process is carried out under strict aseptic conditions in a laminar flow hood.

[0114] 2) Subculture (cell proliferation): Pipette 500 μL from 5 ml of LB liquid medium and inoculate it into 500 ml of LB liquid medium. Place it in a Zhichu shaker (model ZQZY-CS8), and culture it at 37 °C and 220 rpm for 6 h until the OD600 reaches 0.6 - 0.8.

[0115] 3) Inductive culture of the strain: When the OD600 reaches 0.6 - 0.8, add isopropyl β-D-1-thiogalactoside (IPTG) with a final concentration of 0.4 M / 0.2% L-arabinose (mass ratio), and continue the inductive culture at an appropriate temperature for 24 h. Centrifuge, wash the cell pellet twice with a buffer containing 100 mM PBS (pH 7.2 - 7.4), and collect the thalli.

[0116] The method for preparing vanillin from 4-propyl-guaiacol using SC-ST (EUGO-IEM) whole-cell catalyst is as follows:

[0117] Reaction system: Add the substrate 4-propyl-guaiacol with a final concentration of 1 mM / L to 5 mL of 0.1 mol / L Tris-HCl buffer (pH 8.0). At the same time, add 0.1 g of whole-cell catalyst, and mix and react at 30 °C and 200 r / min. After reacting for 24 h, stop stirring.

[0118] Pretreatment of the catalytic product:

[0119] Extraction: Mix 1 mL of the above reaction solution and 1 mL of ethyl acetate in equal volumes, place it in a shaker at 30 °C and 220 rpm, and shake and mix evenly for 10 min. After taking it out, let it stand at room temperature and wait for the organic solvent ethyl acetate and the aqueous phase of the fermentation broth to separate completely; transfer all the organic phase to a 2 ml centrifuge tube.

[0120] Tabletop vacuum centrifugal rotary evaporation: Place a tabletop vacuum centrifugal concentration instrument in the above 2 ml centrifuge tube, and rotary evaporate until all the ethyl acetate evaporates. Operate according to the specifications, remove the bottle containing the oily crude product mixture at the bottom, and add 0.5 ml of methanol. After the crude product is fully dissolved in methanol, transfer 1 mL of it to a centrifuge tube, centrifuge at a speed of 6000 rpm for 1 minute, and filter it through a 0.22 μm filter membrane into a liquid phase sample bottle for detection.

[0121] The chromatographic conditions for detection by HPLC-UV are as follows:

[0122] Detection wavelength: 280 nm;

[0123] Mobile phase: methanol∶0.01% aqueous acetic acid solution Chromatographic column: ZORBAX SB-C18 5 μm (150×4.6 mm);

[0124] Flow rate: 0.5 mL / min;

[0125] Column oven temperature: 30 °C;

[0126] Injection volume: 10 μL;

[0127] Detection time: 35 min;

[0128] Specifically, see Table 1.

[0129] Table 1

[0130]

[0131] Specifically, Step 4 is: Optimize the reaction of the whole-cell catalyst with 4-propyl-guaiacol to produce vanillin under single-factor variable conditions

[0132] Optimization of SC-ST (EUGO-IEM) induction temperature: General procedure for culturing recombinant Escherichia coli: Take the glycerol bacteria stored at -20 °C and inoculate them into LB medium (containing 50 mg / mL kanamycin / 100 mg / mL ampicillin), and shake well at 37 °C and 220 rpm for 12 h. Inoculate 1% (v / v) of the seed solution into the induction medium containing (50 mg / mL kanamycin / 100 mg / mL ampicillin), and shake well at 37 °C and 220 rpm. When OD600 reaches 0.6 - 0.8, add isopropyl β-d-1-thiogalactoside (IPTG) with a final concentration of 0.4 M / 0.2% arabinose (mass ratio), and continue to induce culture at different temperatures of 16 °C, 25 °C, 30 °C, 37 °C, and 220 rpm for 24 h. Centrifuge, wash the cell pellets twice with buffer containing 100 mM PBS (pH 7.2 - 7.4), collect the bacterial cells, and perform SDS-PAGE analysis on the whole cells expressing the fusion protein SC-ST (EUGO-IEM) / Whole cell (EUGO-IEM) (as Figure 4 shown). The enzymatic reaction is carried out in a 25-ml conical flask, and the shaking flask is carried out at 220 rpm and 30 °C. The reaction mixture (5 ml) contains 1 mM 4PG, 0.1 g of recombinant Escherichia coli, 100 mM Tris-Hcl buffer (pH 8.0), and 10% DMSO (V / V). After reacting for 24 h, HPLC detection is performed (asFigure 5 as shown

[0133] As Figure 6 shown, optimization of the catalytic pH conditions of whole-cell SC-ST (EUGO-IEM): By measuring the activity of whole-cell SC-ST (EUGO-IEM) at different buffer solutions (K2HPO4-KH2PO4) with a pH of 6.0, (TRIS-HcL) with a pH of 7.0 - 9.0, adding 0.1 g of the bacterial cells and adding the substrate to a final concentration of 1 mM / L, catalyzing at 30 °C and 220 rpm, and measuring the content of vanillin after 24 h.

[0134] As Figure 7 shown, optimization of the catalytic temperature conditions of whole-cell SC-ST (EUGO-IEM): After determining the optimal pH of surface-displayed SC-ST (EUGO-IEM), at different temperatures (18 °C, 20 °C, 25 °C, 30 °C, and 37 °C), the optimal catalytic temperature of surface-displayed SC-ST (EUGO-IEM) was determined by measuring the activity of whole-cell SC-ST (EUGO-IEM) in suspended cells in 100 mM Tris-HCl (pH 9.0). Adding 0.1 g of the bacterial cells and adding the substrate to a final concentration of 1 mM / L, catalyzing at 220 rpm, and measuring the content of vanillin after 24 h.

[0135] As Figure 8 shown, optimization of the substrate concentration conditions of whole-cell SC-ST (EUGO-IEM): After determining the optimal catalytic temperature and pH of surface-displayed SC-ST (EUGO-IEM), the optimal substrate concentration of surface-displayed SC-ST (EUGO-IEM) was determined by measuring the activity of whole-cell SC-ST (EUGO-IEM) at different substrate concentrations (final concentrations of 0.5 M, 1 M, 2 M, 4 M, 6 M). Adding 0.1 g of the bacterial cells and adding the substrate to a final concentration of 1 mM / L, catalyzing at 30 °C and 220 rpm, and measuring the content of vanillin after 24 h.

[0136] As Figure 9 shown, reusability of whole-cell SC-ST (EUGO-IEM): Under the optimal temperature, pH, and substrate concentration conditions of the above experiments, the cells expressing SC-ST (EUGO-IEM) were suspended in 100 mM Tris-HCl (pH 9.0), and the reusability of the cells was evaluated by repeated enzyme assays. After the enzymatic reaction with the substrate, the cells were centrifuged, the product concentration was measured using the supernatant, the cells were washed with 100 mM Tris-HCl (pH 9.0), resuspended in the same buffer, and reused in the next round of enzyme assays, repeating 5 times.

[0137] Effect of induction temperature on vanillin synthesis and protein expression

[0138] As Figure 10 shown, the induction temperature has an important impact on protein expression. When the induction temperature is high, the protein synthesis rate is too fast, and inclusion bodies are easily formed. A lower induction temperature is beneficial to the production of recombinant proteins, which can improve the yield or activity of the target protein. In this study, the effects of induction temperatures of 16, 25, 30, and 37 °C on protein expression and vanillin production were investigated. SDS-PAGE analysis showed that the expression levels of SC-ST (EUGO-IEM) were different at different temperatures, and the optimal induction temperature was 37 °C. However, the cells expressing the protein at 37 °C showed low activity, while the cells expressing at 25 °C showed the best activity. We speculate that it may be due to the too high induction temperature, resulting in the appearance of inclusion bodies. Correspondingly, the conversion rate of vanillin was the highest at 25 °C. Therefore, 25 °C was selected as the optimal induction temperature for the SC-ST (EUGO-IEM) system in subsequent experiments. Effects of catalytic temperature on vanillin synthesis: In the whole-cell catalytic reaction, the catalytic temperature is an essential factor. Therefore, this application studied the effects of different catalytic temperatures. As the catalytic temperature increased, the conversion rate of vanillin also increased. When the catalytic temperature was 30 °C, the yield of vanillin reached the maximum value. When the temperature reached 37 °C, the yield of vanillin decreased. Therefore, the optimal catalytic temperature was 30 °C.

[0139] Effects of pH on vanillin synthesis: A slight deviation from the optimal pH value will change the ionization of the groups at the enzyme active site and reduce the enzyme activity. In addition, a large deviation will disrupt many non-covalent bonds that maintain the three-dimensional structure of the enzyme, resulting in enzyme denaturation. The buffer used in the enzyme reaction is also an important factor affecting the reaction. Under the buffer Tris-HCL condition, the conversion rate is higher than that under the Kpi buffer, and the maximum value under the buffer condition is (pH 9).

[0140] Effects of 4-propylguaiacol concentration on vanillin synthesis: As Figure 8 shown, it exhibits typical substrate inhibition kinetics. When the substrate concentration exceeds 0.5 mM / L, the vanillin synthesis rate enters a significant non-linear deceleration stage. This phenomenon indicates that the inhibitory effect of isoeugenol on the substrate increases with the increase in concentration, and this inhibitory effect becomes particularly significant under the condition of a high concentration of 6 mM / L. In the actual production process, it is necessary to precisely control the substrate concentration to avoid the decrease in the reaction rate caused by too high substrate concentration, so as to ensure the efficiency and yield of vanillin synthesis.

[0141] Reusability of the surface-displayed whole-cell biocatalyst system: The reuse and regeneration of catalysts can significantly reduce the cost of the catalytic process. Soluble enzymes cannot be effectively separated in the reaction system and thus cannot be recycled. On the other hand, whole-cell catalysis can be reused, and surface display provides higher enzyme activity at the same catalytic time and number of catalytic cycles. SC-ST(EUGO-IEM) can be reused at least twice in the reaction with 4-propylguaiacol as the substrate.

Claims

1. A method for preparing vanillin based on Spycather-spytag technology surface display of whole-cell catalyst, characterized in that: The method comprises the following steps: Step 1: Verify the feasibility of surface display by red and green fluorescence; Step 2: Construction of surface display genetically engineered bacteria; Step 3: preparing a whole-cell catalyst using the genetically engineered bacteria constructed in step 2; Step 4: Optimize the whole-cell catalyst to react with 4-propyl-guaiacol to produce vanillin.

2. A method for preparing vanillin based on Spycather-spytag technology surface display of whole-cell catalysts as claimed in claim 1, characterized in that Step 1: Using plasmid PETduet-MCR-GFP, E. coli BL21 (DE3) genome, and plasmid pRSFDuet-1pRSFDuet-lo as templates, PCR amplify sfGFP, lpp-OmpA, and SpyCather gene fragments; using plasmid pETDuet-His6-TEV-Cys-affibody-LPETGG-mCherry was used as a template to PCR amplify the bacterial mcherry-Spytag gene fragment.

3. A method for preparing vanillin based on Spycather-spytag technology surface display of whole-cell catalysts as claimed in claim 2, characterized in that: Amplification system 50 μL: ddH2O 18 μL, 2× buffer 25 μL, dNTPs 5 mmol / L 1 μL, upstream primer 10 μmol / L 2 μL, downstream primer 10 μmol / L 2 μL, template 2 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL; The PCR amplification products were subjected to 1% agarose gel electrophoresis to obtain bands of 771 bp, 579 bp, 413 bp, and 795 bp. The PCR products were recovered using the Toloprep Gel Extraction and PCR purification Kit, and the sfGFP, lpp-OmpA, SpyCather, and mcherry-Spytag gene fragments were recovered by gel excision. PCR amplification conditions were as follows: pre-denaturation at 95°C for 10 min, for 1 cycle; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, and extension at 72°C for 45 s, for 2 cycles; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 45 s, for 5 cycles; denaturation at 95°C for 15 s, annealing at 59°C for 15 s, and extension at 72°C for 45 s, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 5 min, for 11 cycles; and a total of 34 cycles.

4. A method for preparing vanillin based on Spycather-spytag technology surface display of whole cell catalysts as claimed in claim 1, characterized in that The pBAD plasmid was digested with XhoI and HindIII, and then sfGFP, lpp-OmpA, and SpyCather were inserted into the XhoI and HindIII sites of the pBAD plasmid through homologous recombination to construct the plasmid pBAD-LPP-OMP-GFP-SpyCather. The recombinant plasmid system was transferred into the DH5α competent medium, spread on the SOC agar solid medium containing Amp resistance and cultured for 24 hours. The bacteria were picked for colony PCR, and the positive clones were selected and sent to the sequencing company for sequencing; the corresponding fragment MCherry-spytag was amplified and then inserted into the Nde of the plasmid PET-28A through homologous recombination. I and EcoRI sites, construct plasmid PET-28A-mcherry-Spytag, transfer the recombinant plasmid system into DH5α competent cell, spread on SOC agar solid medium containing Kana resistance and culture for 24 hours, pick bacteria for colony PCR, select positive clones and send samples to sequencing company for sequencing; if the sequencing results are correct, the two plasmids pBAD-LPP-OMP-GFP-SpyCather and PET-28A-mcherry-Spytag are chemically transformed into BL21 (DE3).

5. A method for preparing vanillin based on Spycather-spytag technology surface display of whole cell catalysts as claimed in claim 1, characterized in that Step 2: Construction of surface display genetically engineered bacteria: Using plasmid pET28a-IEM as a template, use primers IEMtag-F, IEMtag-R1, and IEMtag-R2 to amplify the anchor unit IEMtag gene sequence; using plasmid pBAD-EUGO as a template, use primers EUGO-F and EUGO-R to amplify the anchor unit EUGO-link gene sequence; PCR products IEMtag and EUGO-link gene fragments are connected to the NdeI / EcoRI site of plasmid pET28a using homologous recombinase to obtain recombinant plasmid pET28a-EUGO-link-IEMtag; using plasmid pBAD-EUGO as a template, use primers EUGO-F and EUGO-R to amplify the anchor unit EUGO-link gene sequence; using plasmid pBAD 24-Lpp'OmpA-3FLAG-SpyCatcher003 was used as a template, and the anchor unit Lpp-OmpA was amplified with primers OMPA-F2 and OMPA-R2, and the anchor unit SpyCatcher was amplified with primers Spy-F2 and Spy-R2. The PCR products Lpp-OmpA and SpyCatcher, the gene fragments were connected to the XhoI and HindIII sites of the plasmid pBAD using homologous recombinase to obtain the recombinant plasmid pBAD-ompA-spycather. The above plasmid (DH5α) was verified to be correct by a sequencing company and the plasmid was extracted and transferred into Escherichia coli BL21 (DE3).

6. A method for preparing vanillin based on Spycather-spytag technology surface display of whole cell catalysts as claimed in claim 1, characterized in that The specific steps of step three are: 1) Inoculation: Pick a single colony of strains on the LB solid medium with Amp and kana double antibodies, inoculate it into 5 ml LB liquid medium, and culture it at 220 rpm and 37°C for 12 h. The above process is strictly performed in a clean bench under aseptic conditions; 2) Expanded culture: 500uL was taken from 5ml LB liquid medium and inoculated into 500ml LB liquid medium, and then placed in a shaking incubator at 37°C and 220rpm for 6h until OD600 reached 0.6-0.8; 3) Induction culture of bacterial strains: When OD600 reaches 0.6-0.8, add isopropyl β-d-1-thiogalactoside / 0.2% L-arabinose at a final concentration of 0.4 M, continue induction culture at an appropriate temperature for 24 h, centrifuge, wash the cell pellet twice with a buffer containing 100 mM PBS, pH 7.2-7.4, and collect the bacteria.

Images