Biosensor for detecting NOVA2 mRNA based on three-dimensional DNA tetrahedral nucleic acid and application of biosensor

Abstract

The invention discloses a biosensor for detecting NOVA2mRNA based on three-dimensional DNA tetrahedral nucleic acid and application of the biosensor, and belongs to the technical field of sensors. The biosensor comprises an H chain and a DTN; the DTN is formed by hybridizing a T1 chain, a T2 chain, a T3 chain and a T4 chain. The biosensor composed of DTN and H-chain nucleic acid is used for efficiently detecting the low-abundance target NOVA2mRNA, the detection method has the advantages of being good in analysis performance, easy to operate, low in detection limit, high in specificity and the like, the defects of an existing NOVA2mRNA detection method can be overcome, and the detection method is suitable for large-scale popularization and application. And a new way is provided for the detection of NOVA2mRNA and the diagnosis and prognosis of related diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of sensors, and particularly to a biosensor for detecting NOVA2 mRNA based on three-dimensional DNA tetrahedron nucleic acid and its application. Background Art

[0002] DNA molecules and their self-assembly functions can be used to prepare three-dimensional structures. By annealing four oligonucleotide strands, DNA tetrahedron (DTN) structures can be formed. The DTN structure is simple, easy to assemble, has strong nuclease stability and is easily absorbed by cells, making them carriers with great potential in biotechnological applications. Compared with the above properties of other types of DNA nanostructures, DTN can overcome various problems faced by linear oligonucleotides as biosensing reagents, making DTN have broad application prospects in biological applications, biosensing and targeted delivery.

[0003] The full name of the NOVA2 (neuro-oncological ventral antigen 2) gene is neuro-oncological ventral antigen 2, which is a splicing factor. The KH domain on NOVA2 can bind to the YCAY motif of the target gene mRNA precursor, thereby regulating its splicing process. It can play a role in promoting or inhibiting splicing during the splicing regulation process, and the dysregulation of its splicing function is one of the important factors causing the development of neuronal diseases and tumors. Accurately detecting the expression level of NOV2 is very urgent and necessary for disease prevention and prognosis.

[0004] Using quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a currently relatively common and standard method for mRNA detection. To a certain extent, this detection method reduces the disadvantages of time-consuming and low sensitivity of Western blotting, but its sample processing process is cumbersome, the instrument requirements are high, and the existence of non-specific amplification may affect the accuracy of experimental results. These disadvantages greatly limit its application efficiency in actual detection. Therefore, developing a strategy for sensitive detection of NOVA2 mRNA is very beneficial for drug screening, treatment and patient prognosis evaluation. Summary of the Invention

[0005] The purpose of the present invention is to provide a biosensor for detecting NOVA2 mRNA based on three-dimensional DNA tetrahedron nucleic acid and its application to solve the problems existing in the above-mentioned prior art. The biosensor composed of DTN and H-chain nucleic acid of the present invention realizes the efficient detection of low-abundance target NOVA2 mRNA. The detection method of the present invention has good analytical performance, and has the advantages of simple operation, low detection limit, high specificity, etc., which can make up for the defects and deficiencies of the existing detection methods of NOVA2 mRNA, and provides a new way for the detection of NOVA2 mRNA and the diagnosis and prognosis of related diseases.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a biosensor for detecting NOVA2 mRNA based on DTN, and the biosensor includes an H chain and DTN;

[0008] The DTN is hybridized by a T1 chain, a T2 chain, a T3 chain and a T4 chain;

[0009] The nucleotide sequence of the T1 chain is shown in SEQ ID NO.1; the nucleotide sequence of the T2 chain is shown in SEQ ID NO.2; the nucleotide sequence of the T3 chain is shown in SEQ ID NO.3; the nucleotide sequence of the T4 chain is shown in SEQ ID NO.4; the nucleotide sequence of the H chain is shown in SEQ ID NO.5.

[0010] Further, the first base at the 5'-end of the H chain is modified with a fluorescence quenching group BHQ1;

[0011] The 76th base at the 5'-end of the T1 chain is modified with a fluorescence group FAM;

[0012] The 76th base at the 5'-end of the T2 chain is modified with a fluorescence group FAM;

[0013] The 76th base at the 5'-end of the T3 chain is modified with a fluorescence group FAM;

[0014] The 76th base at the 5'-end of the T4 chain is modified with a fluorescence group FAM.

[0015] The present invention also provides a construction method of the above biosensor, including the following steps:

[0016] S1. Thermally denature the T1 chain, T2 chain, T3 chain and T4 chain in a buffer solution containing Mg 2+ to synthesize DTN;

[0017] S2. Incubate and self-assemble the DTN with the H chain to obtain the biosensor.

[0018] Further, the molar ratio of the T1 chain, T2 chain, T3 chain and T4 chain is 1:1:1:1; the molar ratio of the DTN to the H chain is 1:1.

[0019] Further, the temperature of the thermal denaturation is 92-98 °C and the time is 4-6 min; the temperature of the incubation is 35-38 °C and the time is 1.5-2.5 h.

[0020] The present invention also provides the application of the above biosensor or the biosensor obtained by the above construction method in the preparation of a kit for detecting NOVA2 mRNA.

[0021] The present invention also provides a kit for detecting NOVA2 mRNA, which contains the above-mentioned biosensor or the biosensor obtained by the above-mentioned construction method.

[0022] The present invention also provides a method for detecting NOVA2 mRNA by using the above-mentioned kit. The biosensor, the solution to be detected and the buffer solution containing Mg 2+ are mixed to obtain a detection system. After incubation, the fluorescence intensity is detected, and the content of NOVA2 mRNA in the solution to be detected is calculated according to the standard curve.

[0023] Further, in the detection system, the concentration of the biosensor is 0.8 - 1.2 nM, and the concentration of Mg 2+ is 4 - 6 mM.

[0024] Further, the temperature of the mixed incubation is 35 - 38 °C, and the time is 1 - 1.5 h.

[0025] The present invention discloses the following technical effects:

[0026] The preparation method of the tetrahedral DNA nucleic acid (DTN) in the biosensor of the present invention is simple and can be prepared only by annealing 4 short single-stranded DNAs, which simplifies the preparation steps; the use of DTN and H-chain nucleic acid realizes the efficient detection of low-abundance target NOVA2 mRNA, and the detection limit of NOVA2 mRNA can reach 0.319 fM. The detection method of the present invention has good analytical performance, and has the advantages of simple operation, low detection limit, high specificity, etc., and can make up for the defects and deficiencies of the existing detection methods of NOVA2 mRNA. Description of the Drawings

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0028] Figure 1 It is the construction process and detection principle diagram of the biosensor of the present invention;

[0029] Figure 2 It is the influence of the NOVA2 mRNA concentration on the analytical performance of the biosensor in Example 2;

[0030] Figure 3 It is the linear relationship diagram between the logarithm of the NOVA2 mRNA concentration and the fluorescence intensity in Example 2;

[0031] Figure 4For Mg in Example 3 2+ Effect of concentration on the analytical performance of the biosensor;

[0032] Figure 5 For the effect of reaction time on the analytical performance of the biosensor in Example 4;

[0033] Figure 6 For the detection results of the biosensor specificity in Example 5;

[0034] Figure 7 For the fluorescence intensity at different NOVA2 mRNA concentrations in Example 6;

[0035] Figure 8 For the standard curve of the biosensor in Example 6. Detailed implementation manners

[0036] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0037] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0038] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0039] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are only exemplary.

[0040] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0041] The construction process and detection principle of the biosensor of the present invention are as follows Figure 1 shown, and the sequences of each component are as follows

[0042] T1 strand (5'-3'):

[0043]

[0044] T2 strand (5'-3'):

[0045]

[0046] T3 strand (5'-3'):

[0047]

[0048] T4 strand (5'-3'):

[0049]

[0050] H strand (5'-3'): (BHQ1)CTGCGCCCGCCG; (SEQ ID NO.5).

[0051] Among them, the parts with the same label in the T1 strand, T2 strand, T3 strand, and T4 strand are complementary and paired, and anneal and hybridize to form a three-dimensional DNA tetrahedron nucleic acid (DTN): the bold part in the T1 strand is complementary and paired with the bold part in the T4 strand, the italic part in the T1 strand is complementary and paired with the italic part in the T2 strand, and the underlined part in the T1 strand is complementary and paired with the underlined part in the T2 strand; the wavy-underlined part in the T2 strand is complementary and paired with the wavy-underlined part in the T3 strand, and the wavy-underlined part in the T2 strand is complementary and paired with the wavy-underlined part in the T4 strand; the bold-underlined part in the T3 strand is complementary and paired with the bold-underlined part in the T4 strand. Since the DNA strand has flexibility, it folds through complementary pairing to form a DNA tetrahedron

[0052] The sequence of the H strand is respectively complementary and paired with the 65-76th bases at the 5' end of the T1 strand, T2 strand, T3 strand, and T4 strand

[0053] The reaction process during the detection of the biosensor is as follows

[0054] In the absence of the target, the DTN and the H strand are in a stable structure, and the fluorescence is in a quenched state; when the NOVA2 mRNA target exists, the NOVA2 mRNA strand binds to the 57-64 bases at the 5' end of the T1 strand, T2 strand, T3 strand, and T4 strand of the DTN, the H strand is displaced, and the quenching group falls off accordingly. The NOVA2 mRNA completely binds to the 57-76 bases at the 5' end of the T1 strand, T2 strand, T3 strand, and T4 strand of the DTN, and the fluorescent group is exposed, thereby emitting a fluorescence signal

[0055] The sequence of the above-mentioned NOVA2 mRNA target is as follows:

[0056] CTGCGCCCGCCGCCCCCCGG (SEQ ID NO.6).

[0057] The sequence of NOVA1 mRNA used in the following examples of the present invention is as follows:

[0058] AGAACCGCTCCGGCAGCGGC (SEQ ID NO.7).

[0059] Construction of the biosensor in Example 1

[0060] S1. Preparation of DTN

[0061] Synthesize the T1 strand, T2 strand, T3 strand and T4 strand shown in SEQ ID NOs. 1-4, and modify the fluorescent group FAM at the 76th position at the 5' end thereof; mix equimolar amounts of the T1 strand, T2 strand, T3 strand and T4 strand in 10×NE Buffer 2 buffer (10 mM MgCl 2 , 1 mM DDT, 50 mM NaCl, 10 mM Tris-HCl, pH = 7.9) and anneal at 95°C for 5 min, then naturally cool to room temperature to synthesize DTN, and store at 4°C.

[0062] S2. Construction of the biosensor

[0063] Synthesize the H strand shown in SEQ ID NO.5 and modify the quenching group BHQ1 at the 1st position at the 5' end thereof; incubate equimolar amounts of DTN and the H strand in 10×NE Buffer 2 buffer, and self-assemble at 37°C for 2 h to form the biosensor (FDNT), and store at 4°C.

[0064] Effect of NOVA2 mRNA concentration on the analytical performance of the biosensor in Example 2

[0065] Take the FDNT prepared in Example 1 and measure different concentrations of NOVA2 mRNA according to the following steps:

[0066] Take 6 EP tubes and add 30 μL of the detection system respectively: FDNT (3 μL, original concentration 10 nM), 10×NEBuffer buffer (3 μL) and NOVA2 mRNA (3 μL, final concentrations are 0 nM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM) respectively, and make up to 30 μL with ddH 2 O water; incubate the detection system at 37°C for 1 h.

[0067] Record the fluorescence intensity at 520 nm of the detection system with an excitation wavelength of 488 nm. The results are as Figure 2 shown. As can be seen from the figure, as the concentration of NOVA2 mRNA increases, the fluorescence intensity increases significantly. This indicates that the prepared biosensor FDNT is sensitive to the change in the concentration of NOVA2 mRNA and can be used for quantitative detection of the concentration of NOVA2 mRNA. In the range of 100 fM - 1 nM of the concentration of NOVA2 mRNA, the logarithm of its concentration has a good linear relationship with the fluorescence intensity (see Figure 3 ), and the logarithm of its concentration has a good linear relationship with the fluorescence intensity.

[0068] Example 3 Effect of Mg 2+ on the analytical performance of the biosensor

[0069] Take the FDNT prepared in Example 1 and determine the optimal concentration of Mg 2+ according to the following steps:

[0070] Take 6 EP tubes and add 30 μL of the detection system respectively: FDNT (3 μL, original concentration 10 nM), 10×NEBuffer 2 buffer (3 μL), NOVA2 mRNA (3 μL, original concentration 2 nM) and 3 μL of MgCl 2 (original concentrations are 0 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM) respectively, and make up to 30 μL with ddH 2 O water; incubate at 37 °C for 90 min. Record the fluorescence intensity at 520 nm with an excitation wavelength of 488 nm. The results are as Figure 4 shown. As can be seen from the figure, as the concentration of Mg 2+ in the detection system increases, the fluorescence intensity gradually increases, and the absorbance no longer increases significantly after its concentration reaches 3.0 mM. Therefore, 3.0 mM Mg 2+ concentration is selected as the optimal concentration.

[0071] Example 4 Effect of reaction time on the analytical performance of the biosensor

[0072] Take the FDNT prepared in Example 1 and determine the optimal reaction time according to the following steps:

[0073] Take 6 EP tubes and add 30 μL of the detection system respectively: FDNT (3 μL, original concentration 10 nM), 10×NEBuffer 2 buffer (3 μL), NOVA2 mRNA (3 μL, original concentration 2 nM) and MgCl 2 (3 μL, original concentration 30 mM), and make up to 30 μL with ddH 2Make up to 30 μL with water; incubate at 37 °C for 30 min, 60 min, 90 min, 120 min, and 150 min respectively, and record the fluorescence intensity at 520 nm with an excitation wavelength of 488 nm. The results are as Figure 5 shown. It can be seen from the figure that as time increases, the fluorescence intensity gradually increases and reaches an equilibrium state at 90 min and no longer changes. Therefore, 90 min is selected as the optimal reaction time for the system.

[0074] Example 5 Detection of the specificity of the biosensor

[0075] Take the FDNT prepared in Example 1 and determine its detection specificity according to the following steps:

[0076] Take 3 EP tubes for detecting NOVA2 mRNA, NOVA1 mRNA (the homologous gene of NOVA2), and the mixed solution of NOVA2 mRNA and NOVA1 mRNA (Mixed) respectively.

[0077] The detection system is: FDNT (3 μL, 10 nM), 10×NE Buffer 2 buffer (3 μL), MgCl 2 (3 μL, the original concentration is 30 mM), NOVA2 mRNA (3 μL, the original concentration is 2 nM) or NOVA1 mRNA (3 μL, the original concentration is 2 nM) or the mixed solution of NOVA2 mRNA and NOVA1 mRNA (3 μL, molar ratio 1:1, the original concentration is 2 nM), and finally make up to 30 μL with ddH 2 O water; incubate at 37 °C for 90 min. Record the fluorescence intensity at 520 nm with an excitation wavelength of 488 nm. The results are as Figure 6 shown. It can be seen from the figure that the fluorescence intensity of the NOVA2 mRNA group and the Mixed group increases significantly, while there is no obvious change in the NOVA1 mRNA group, the homologous gene of NOVA2. Therefore, the FDNT prepared in Example 1 has good specificity.

[0078] Example 6 Detection of the detection limit of the biosensor

[0079] Take the FDNT prepared in Example 1 and detect NOVA2 mRNA according to the following steps:

[0080] Take 6 EP tubes and add 30 μL of the detection system respectively: FDNT (3 μL, the original concentration is 10 nM), 10×NE Buffer 2 buffer (3 μL), NOVA2 mRNA (3 μL, the final concentrations are 0 nM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM) and MgCl 2(3 μL, original concentration: 30 mM); Incubate at 37 °C for 90 min. Record the fluorescence intensity at 520 nm with an excitation wavelength of 488 nm, as Figure 7 shown. Construct a standard curve based on the NOVA2 mRNA concentration and fluorescence intensity. The results are as Figure 8 shown, and the limit of detection (LOD) is 0.319 fM.

[0081] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A biosensor for detecting NOVA2 mRNA based on DTN, characterized in that: The biosensor includes an H chain and a DTN; The DTN is formed by hybridization of T1 chain, T2 chain, T3 chain and T4 chain; The nucleotide sequence of the T1 chain is shown in SEQ ID NO.1; the nucleotide sequence of the T2 chain is shown in SEQ ID NO.2; the nucleotide sequence of the T3 chain is shown in SEQ ID NO.3; the nucleotide sequence of the T4 chain is shown in SEQ ID NO.4; and the nucleotide sequence of the H chain is shown in SEQ ID NO.

5.

2. The biosensor according to claim 1, characterized in that The first base at the 5' end of the H chain is modified with a fluorescent quenching group BHQ1; The 76th base at the 5' end of the T1 chain is modified with a fluorescent group FAM; The 76th base at the 5' end of the T2 chain is modified with a fluorescent group FAM; The 76th base at the 5' end of the T3 chain is modified with a fluorescent group FAM; The 76th base at the 5' end of the T4 chain is modified with a fluorescent group FAM.

3. The method for constructing a biosensor according to claim 1 or 2, characterized in that: The steps include: S1. The T1 chain, T2 chain, T3 chain and T4 chain are placed in a Mg-containing 2+ Heat denaturation in buffer to synthesize DTN; S2. The DTN is incubated with the H chain for self-assembly to obtain the biosensor.

4. The construction method according to claim 3, characterized in that: The molar ratio of the T1 chain, the T2 chain, the T3 chain and the T4 chain is 1:1:1:1; the molar ratio of the DTN to the H chain is 1:

1.

5. The construction method according to claim 3, characterized in that: The temperature of the thermal denaturation is 92-98°C, and the time is 4-6 minutes; the temperature of the incubation is 35-38°C, and the time is 1.5-2.5 hours.

6. Use of the biosensor according to claim 1 or 2 or the biosensor obtained by the construction method according to any one of claims 3 to 5 in preparing a kit for detecting NOVA2 mRNA.

7. A kit for detecting NOVA2 mRNA, characterized in that: The kit comprises the biosensor according to claim 1 or 2 or the biosensor obtained by the construction method according to any one of claims 3-5.

8. A method for detecting NOVA2 mRNA using the kit according to claim 7, characterized in that: The biosensor, the test solution and the Mg 2+ The buffer solution is mixed to obtain a detection system. After incubation, the fluorescence intensity is detected and the content of NOVA2 mRNA in the test solution is calculated according to the standard curve.

9. The method according to claim 8, characterized in that In the detection system, the concentration of the biosensor is 0.8-1.2 nM, Mg 2+ The concentration is 4-6mM.

10. The method according to claim 8, characterized in that The incubation temperature is 35-38°C and the incubation time is 1-1.5h.

Images