Molecular marker linked with oyster sex, primer pair for detecting molecular marker and application

Abstract

The invention relates to the technical field of molecular marker-assisted breeding, in particular to an oyster sex-linked molecular marker, a primer pair for detecting the molecular marker and application. The molecular marker is an InDel marker Chr9: 8462525, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 1, and the nucleotide sequences of a primer pair for detecting the molecular marker are as shown in SEQ ID NO: 2 and SEQ ID NO: 3. By detecting the molecular marker, the sex of the oysters can be predicted, male linkage alleles can be screened, PCR amplification and electrophoresis can be carried out, and the molecular marker has important application value in breeding unisexual oyster varieties or strains.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and particularly relates to a molecular marker linked to the sex of oysters, a primer pair for detecting this molecular marker, and applications thereof. Background Art

[0002] Oysters are the most cultivated marine shellfish in China and have important edible and economic values. Among them, the Fujian oyster has become one of the important economic aquaculture varieties due to its fast growth rate and excellent edible value. The growth and nutritional components of the Fujian oyster show sexual dimorphism, and males are significantly superior to females in terms of nutritional value and fatness. Therefore, cultivating high-male strains has potential application value.

[0003] Since the 1970s, scientific researchers have begun to focus on the genetic factors regulating the sex of oysters. In the half-sib families of the American oyster and the Pacific oyster, the paternal effects of sex traits have been observed successively, and accordingly, the "three-locus model" and the "single-locus model" of sex genetic determination have been proposed successively. In two independent studies based on microsatellite markers and GBS sequencing, a single major sex QTL has been identified in the Pacific oyster respectively. These previous studies have all shown that genetic factors play an important role in the sex determination of oysters.

[0004] Therefore, developing a sex-linked marker and a simple method for detecting the genotype of this marker is the key to aggregating male-linked alleles and cultivating monosexual oyster strains. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a molecular marker linked to the sex of oysters, a primer pair for detecting this molecular marker, and applications thereof.

[0006] The present invention is implemented as follows:

[0007] The present invention first provides a molecular marker linked to the sex of oysters, and the molecular marker is an InDel marker Chr9:8462525; the nucleic acid sequence of the Chr9:8462525 molecular marker is as shown in SEQ ID NO:1.

[0008] The present invention also provides a primer pair for detecting the molecular marker as described in claim 1, and is characterized in that: its nucleotide sequence is as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0009] Finally, the present invention provides the application of the molecular marker, which is at least one of the following a to c:

[0010] a. For predicting the sex of oysters;

[0011] b. For screening individuals containing male-linked alleles;

[0012] c. For cultivating mono-sex oyster strains or varieties.

[0013] Furthermore, the oyster is Crassostrea angulata.

[0014] Furthermore, the screening in step b includes the following steps:

[0015] (1) Extraction of oyster DNA;

[0016] (2) PCR analysis using primer pairs;

[0017] (3) Detecting the PCR amplification products by electrophoresis to determine whether the oyster sample to be tested contains male-linked alleles.

[0018] Even further, the primer pairs in step (2) have nucleotide sequences shown as SEQ ID NO:2 and SEQ ID NO:3.

[0019] Even further, using the genomic DNA of the oyster to be tested, Crassostrea angulata, as a template, PCR amplification is carried out using the primer pairs shown as SEQ ID NO:2 and SEQ ID NO:3, and the amplification products are detected. The judgment results are as follows:

[0020] When the amplification product is a single band of 224bp, the sample to be tested contains a homozygote with 0 male-linked alleles, and the gender is female-biased.

[0021] When the amplification products are two bands of 224bp and 211bp, the oyster sample to be tested, Crassostrea angulata, is a heterozygote containing 1 male-linked allele, and the gender is male-biased.

[0022] When the amplification product is a single band of 211bp, the sample to be tested is a homozygote containing 2 male-linked alleles, and the gender is male-biased;

[0023] Even further, the PCR system for the PCR analysis in step (2) is 10 μL, including 5 μL of 2×PCR Mix, 0.4 μL of each of the forward and reverse primers, 0.5 μL of genomic DNA, and 3.7 μL of sterile double-distilled water; reaction conditions: pre-denaturation at 94 °C for 2 minutes; then denaturation at 94 °C for 30 seconds, annealing at Tm for 30 seconds, extension at 72 °C for 1 minute, for a total of 30 cycles, and finally extension at 72 °C for 5 minutes.

[0024] The present invention has the following advantages:

[0025] (1) The present invention provides a molecular marker Chr9:8462525 that is closely linked to the phenotypic sex of Crassostrea angulata.

[0026] (2) By detecting the molecular markers of the present invention, heterozygotes or homozygotes containing male-linked alleles can be screened. Thus, male-linked alleles can be purposefully aggregated, which can increase the proportion of male individuals in the breeding population and has important application value for accelerating the cultivation process of the high-male strain of Fujian oyster.

[0027] (3) Detection of the molecular markers of the present invention can be achieved by PCR amplification and electrophoresis, and by detecting the number and size of the amplified bands. It can be operated with conventional instruments and has the characteristics of being fast, efficient and low-cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The present invention will be further described below with reference to the drawings in conjunction with embodiments.

[0029] Figure 1 For the mapping of sex-associated loci of Fujian oyster. A. Results of genome-wide association analysis of phenotypic sex of Fujian oyster based on InDel, -log10(P)=7.476; B. Genetic differentiation index (FST) of genome-wide InDel between female and male Fujian oysters; C. Distribution map of genome-wide sex-dimorphic InDel, with a window size of 10 kb.

[0030] Figure 2 For the genotyping result map of nine individuals with known genotypes, where 00 represents genotype 0 / 0, 01 represents genotype 0 / 1, and 11 represents genotype 1 / 1. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The technical solutions of the present invention will be clearly and completely described below with reference to the drawings and specific embodiments. Those not specified in the embodiments are carried out according to conventional conditions or conditions recommended by the manufacturer. Those reagents or instruments not specified in the manufacturer are all conventional products that can be obtained through commercial purchase. The following embodiments are only for illustrating the present invention and do not limit the scope of the present invention in any way.

[0032] In the following embodiments, the molecular marker Chr9:8462525 is obtained by the following method:

[0033] Samples of sexually matured 1-year-old "Fuli No. 1" Fujian oyster breeding population were randomly collected from Jiangkou Bay, Fujian Province for the mapping of sex determination loci.

[0034] Using a microscope to observe, the phenotypic sex of the samples was determined according to the gamete morphology. 57 female oysters and 55 male oysters were selected from 1-year-old Fujian oysters and sent to the company for genome resequencing.

[0035] Three methods were used to identify candidate sex-associated InDels:

[0036] 1) Genome-wide association study (GWAS): A genome-wide association study (GWAS) was conducted on the sex traits of 112 Fujian oysters, and a total of 192 InDels significantly associated with sex were identified, all of which were located on chromosome 9 ( Figure 1 in A).

[0037] 2) Estimation of the genetic differentiation index (FST) between sexes across the genome: The samples were divided into two groups, female and male, according to sex, and the genetic differentiation index (FST) between females and males was calculated for InDels across the genome. A total of 167 InDel loci with high differentiation between sexes (FST>0.25) were identified, all of which were located on chromosome 9 ( Figure 1 in B).

[0038] 2) Genome-wide distribution of sex-dimorphic InDel loci: Based on the above resequencing data, InDel loci with sex-dimorphic genotypes were detected: namely, loci where female samples showed homozygosity (0 / 0), while male samples were heterozygous (0 / 1 or 1 / 0) or another homozygous form (1 / 1). A total of 78 sex-dimorphic InDels were screened, all of which were located on chromosome 9 ( Figure 1 in C).

[0039] Combining the screening results of GWAS significant loci, sex-highly differentiated loci, and sex-dimorphic InDel loci, a total of 4 candidate sex-associated InDels were screened out.

[0040] Furthermore, through the correspondence between phenotype and genotype, the marker Chr9:8462525, which is tightly linked to the phenotypic sex, was obtained.

[0041] Example 1

[0042] A molecular marker tightly linked to the sex of oysters, wherein the molecular marker is Chr9:8462525. The nucleic acid sequence of Chr9:8462525 is shown in SEQ ID NO:1.

[0043] SEQ ID NO:1 (5’→3’)

[0044] GTAGGTGCTTTAG

[0045] The nucleic acid sequences of the primers for detecting the above molecular marker are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0046] Chr9:8462525 F: 5’ CAGTAATTAAGAGGGAATAACACAG 3’ (SEQ ID NO:2);

[0047] Chr9: 8462525 R: 5’ ACCCTTGCGTTAGAAATTCAT 3’ (SEQ ID NO:3).

[0048] Using oyster genomic DNA as a template, after amplification with the primer pair for detecting the Chr9: 8462525 molecular marker, when the amplification product is a single band of 224bp (SEQ ID NO:4), the genotype is recorded as 0 / 0, and the genetic sex of the oyster sample to be tested from Fujian is female-biased.

[0049] When the amplification products are two bands of 224bp (SEQ ID NO:4) and 211bp (SEQ ID NO:5), the genotype is recorded as 0 / 1, and the sex of the oyster sample to be tested from Fujian is male-biased.

[0050] If the amplification product is a single band of 211bp (SEQ ID NO:5), the genotype is 1 / 1, and the sex of the oyster sample to be tested from Fujian is male-biased;

[0051] SEQ ID NO:4 (5’→3’)

[0052] 5’ ACCCTTGCGTTAGAAATTCATTTTTGACTTGCATTCTTTATAAATATGA TTTGTCTTCTCTGTATTCTAAGATTTCCCTTTTCCTAAAGCACCTACTTGTTCCACTTTTTAAAGCACATAAATATATGCCACCGCATGGGAGTAGTAACGAATGTCTCTTCACTTTTCATTCGACACAAAAAACCAAAAACAGAGCTGTCTGTGTTATTCCCTCTTAATTACTG 3’

[0053] SEQ ID NO:5 (5’→3’)

[0054] 5’ ACCCTTGCGTTAGAAATTCATTTTTGACTTGCATTCTTTATAAATATGA TTTGTCTTCTCTGTATTCTAAGATTTCCCTTTTCTTGTTCCACTTTTTAAAGCACATAAATATATGCCACCGCATGGGAGTAGTAACGAATGTCTCTTCACTTTTCATTCGACACAAAAAACCAAAAACAGAGCTGTCTGTGTTATTCCCTCTTAATTACTG 3’

[0055] Example 2

[0056] (1) Extract genomic DNA of oyster samples:

[0057] Based on 3 oyster samples with known genotypes of 0 / 0, 0 / 1, and 1 / 1 from resequencing, take adductor muscle samples, extract oyster genomic DNA using the CTAB method or other existing methods, dissolve it in 50 μL of sterile water, and detect the concentration and quality of DNA using a spectrophotometer and gel electrophoresis.

[0058] (2) Using the genomic DNA extracted above as a template, perform PCR detection with primer pairs for detecting the Chr9:8462525 molecular marker; the nucleic acid sequences of the primers for detecting the Chr9:8462525 molecular marker are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0059] The PCR system for PCR analysis is 10 μL, including 5 μL of 2×PCR Mix, 0.4 μL of each forward and reverse primer, 0.5 μL of genomic DNA, and 3.7 μL of sterile double-distilled water;

[0060] The reaction program of the PCR reaction is: pre-denaturation at 94°C for 2 minutes; then denaturation at 94°C for 30 seconds, annealing at Tm for 30 seconds, extension at 72°C for 1 minute, for a total of 30 cycles, and finally extension at 72°C for 5 minutes.

[0061] (3) The PCR amplification products are subjected to 3% agarose gel electrophoresis containing a DNA fluorescent dye, and after electrophoresis is completed, the detection results are photographed.

[0062] The amplification products of 3 individuals with a known genotype of 0 / 0 are all single bands of 224 bp (SEQ ID NO:5) ( Figure 2 ), and the phenotypic genders are all female.

[0063] The amplification products of 3 individuals with a known genotype of 0 / 1 are both bands of 224 bp (SEQ ID NO:4) and 211 bp (SEQ ID NO:5) ( Figure 2 ), and the phenotypic genders are all male.

[0064] The amplification products of 3 individuals with a known genotype of 1 / 1 are all single bands of 211 bp (SEQ ID NO:5) ( Figure 2 ), and the phenotypic genders are all male.

[0065] Example 3

[0066] Taking 60 oysters as test samples, extract the genomic DNA of the test samples, and using this as a template, detect the Chr9:8462525 molecular marker of the test oyster samples using the method of Example 2 to obtain the genotypes of different oyster samples.

[0067] When the amplification product is a single band of 224 bp (SEQ ID NO: 4), the genotype is recorded as 0 / 0.

[0068] When the amplification products are two bands of 224 bp (SEQ ID NO: 4) and 211 bp (SEQ ID NO: 5), the genotype is recorded as 0 / 1.

[0069] When the amplification product is a single band of 211 bp (SEQ ID NO: 5), the genotype is recorded as 1 / 1.

[0070] Observation was carried out using a microscope, and the phenotypic sex of the sample was determined according to the gamete morphology. The genotypes and phenotypes are shown in Table 1 below. The chi-square test showed that the significance of the association was P = 8.35821×10-8.

[0071] Table 1 Comparison of Chr9:8462525 molecular marker genotypes and phenotypes

[0072]

[0073] Example 4:

[0074] In the Fujian oyster (Crassostrea angulata) breeding population of Fuli No. 1, test samples were taken. The method described in Example 2 was used to detect the Chr9:8462525 molecular marker. Individuals with a male phenotype and a single 211 bp band in electrophoresis were selected as male parents (SEQ ID NO: 5), and individuals with a female phenotype and two bands of 224 bp (SEQ ID NO: 4) and 211 bp (SEQ ID NO: 5) in electrophoresis were selected as female parents. Five families were constructed, and the proportion of male individuals in the offspring was all above 85%.

[0075] Although the specific embodiments of the present invention have been described above, those skilled in the art of this technology should understand that the specific embodiments we described are illustrative rather than used to limit the scope of the present invention. Equivalent modifications and variations made by those skilled in the art in accordance with the spirit of the present invention should all be covered by the scope protected by the claims of the present invention.

Claims

1. A sex-linked molecular marker for oysters, characterized in that: The molecular marker is InDel marker Chr9:8462525; the nucleic acid sequence of the Chr9:8462525 molecular marker is shown in SEQ ID NO:

1.

2. A primer pair for detecting a molecular marker as claimed in claim 1, characterized in that: The nucleotide sequences thereof are shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. The use of molecular markers as claimed in claim 1, characterized in that , is at least one of the following ac: a. Used to predict the sex of oysters; b. Used to screen individuals containing male-linked alleles; c. For the cultivation of monosex oyster strains or varieties.

4. The use according to claim 3, characterized in that: The oyster is Fujian oyster.

5. The use according to claim 3, characterized in that: The screening in step b comprises the following steps: (1) Extraction of oyster DNA; (2) PCR analysis using primer pairs; (3) Using electrophoresis to detect the PCR amplification product, determine whether the oyster sample to be tested contains the male-linked allele.

6. The use according to claim 5, characterized in that: The nucleotide sequences of the primer pair in step (2) are shown in SEQ ID NO: 2 and SEQ ID NO:

3.

7. The use according to claim 5, characterized in that: The result of the judgment in step (3) is as follows: When the amplified product is a single band of 224 bp, the sample to be tested contains 0 homozygotes of male-linked alleles, and the sex is biased towards females; When the amplified products are two bands of 224 bp and 211 bp, the Fujian oyster sample to be tested is a heterozygote containing one male-linked allele, and the sex is biased towards males; When the amplified product is a single band of 211 bp, the sample to be tested is a homozygous individual containing two male-linked alleles, and the sex is biased towards males.

8. The use according to claim 5, characterized in that: The PCR system for the PCR analysis in step (2) is 10 μL, including 5 μL of 2×PCR Mix, 0.4 μL of forward and reverse primers, 0.5 μL of genomic DNA and 3.7 μL of sterile double distilled water; the reaction conditions are: pre-denaturation at 94°C for 2 minutes; then denaturation at 94°C for 30 seconds, Tm annealing for 30 seconds, extension at 72°C for 1 minute, for a total of 30 cycles, and finally extension at 72°C for 5 minutes.

Images