An SNP molecular marker, primer for identifying pork quality and its application

By detecting the SNP loci of the pig FSD2 gene and designing specific primers for PCR amplification, the problem of improving the quality of Songlei black pork was solved, and the pork quality difference was quickly identified, which improved breeding efficiency and meat quality performance.

CN120060493BActive Publication Date: 2025-08-05JILIN ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510305125.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-14
Publication Date
2025-08-05
Estimated Expiration
2045-03-14

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the thawing and water loss rate and intramuscular fat content of Songlei black pork, resulting in a low breeding intensity and difficult to meet market demand.

Method used

By detecting the SNP site of the 4th exon of the pig FSD2 gene, designing specific primers for PCR amplification, using SNP molecular markers to identify pork quality, providing kits and identification methods, quickly identifying polymorphisms, and guiding breeding.

Benefits of technology

It has achieved rapid identification of pork quality differences, improved the breeding efficiency of Songlei black pigs, and can improve the thawing and water loss rate and intramuscular fat content of pork in the short term, meeting market demand.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060493B_ABST
    Figure CN120060493B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of pig breeding, and particularly to a SNP molecular marker, primers and applications thereof for identifying pork quality. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the N at position 140 of the sequence is a SNP site with a polymorphism of T or C. Pork with the CC genotype at the site has a higher thawing water loss rate and intramuscular fat content than pork with the TT and CT genotypes at the site. The molecular marker can be used to detect differences in pork quality and is applied to the continuous breeding of Songlei black pigs and early seed selection in production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of pig breeding, and in particular to a SNP molecular marker, a primer and an application thereof for identifying pork quality. Background Art

[0002] With economic development and improved living standards, consumers are increasingly concerned about pork quality. Traditional breeding methods are difficult to improve muscle quality in the short term. Modern molecular breeding technology offers new avenues for pig selection. Molecular biology techniques, which detect population-specific molecular markers, can predict individual growth, meat quality, and reproductive performance at an early stage. Combined with traditional performance measurement techniques, this can increase selection intensity and improve population production performance over a relatively short period of time.

[0003] Songlei Black Pig is a new breed (strain) of black pig that is being cultivated by hybridizing the paternal Songliao Black Pig with the Leixiang Pig. It has excellent genetic characteristics such as good meat quality, all-black coat, and resistance to roughage. However, the current breeding intensity is low, and there is a separation between production performance and meat quality within the group. It is urgently needed to carry out breeding to meet market demand.

[0004] Fibronectin III and SPRY domain-containing 2 (FSD2) is a member of the fibronectin III / SPRY family, located on porcine chromosome 7. Members of this family mediate cell-matrix interactions and participate in various biological processes, including cell adhesion, growth, migration, and differentiation. Currently, the FSD2 gene is associated with muscle water content, intramuscular fat content, and meat color. However, further research is needed to develop SNP molecular markers corresponding to these two phenotypes: thawing water loss and intramuscular fat content. Summary of the Invention

[0005] The purpose of the present invention is to provide a SNP molecular marker, primer and application thereof for identifying pork quality, so as to solve the above technical problems.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] The present invention provides a SNP molecular marker for identifying pork quality. The nucleotide sequence of the marker is shown in SEQ ID NO.1. The N at position 140 of the sequence is a SNP site with a polymorphism of T or C. The thawing water loss rate and intramuscular fat content of pork from pigs with the CC genotype at the site are higher than those from pigs with the TT and CT genotypes at the site.

[0008] The present invention collects the longissimus dorsi muscle of Songlei black pigs, conducts meat quality trait analysis, uses direct sequencing to detect the polymorphism of exon 4 of the FSD2 gene, analyzes the correlation between the existing polymorphic sites and meat quality traits, and obtains molecular markers related to pork quality, which can be applied to the continuous breeding of Songlei black pigs and early selection in production.

[0009] The present invention also provides a specific primer for amplifying the above-mentioned SNP molecular marker, comprising an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.

[0010] The present invention also provides a kit for identifying pork quality, which comprises the above-mentioned specific primers.

[0011] The kit further comprises 2×Premix buffer.

[0012] The present invention also provides the use of the SNP molecular marker, the specific primer or the kit in identifying pork meat color and intramuscular fat content.

[0013] The present invention also provides the use of the SNP molecular marker, the specific primer or the kit in pig breeding or assisted pig breeding, wherein the assisted pig breeding is to cultivate pork with high intramuscular fat content and low thawing water loss rate.

[0014] The present invention also provides a method for identifying pork quality, comprising the following steps:

[0015] S1, extracting the pig genomic DNA to be tested;

[0016] S2, using the pig genomic DNA to be tested as a template, amplifying using the specific primers to obtain an amplified product;

[0017] S3, identifying the genotype at position 140 of the amplified product, and determining the thawing water loss rate and intramuscular fat content of the pork according to the genotype;

[0018] S4. The judgment method is: when the SNP site at position 140 of the amplified product is CC genotype, the thawing water loss rate and intramuscular fat content of pork are higher than those of pigs with TT genotype and CT genotype at the same site.

[0019] Furthermore, the amplification reaction system is: 0.4-0.6 μL of upstream and downstream primers, 0.4-0.6 μL of pig genomic DNA to be tested, 9-11 μL of 2×Premix buffer, and 10-12 μL of water;

[0020] The reaction procedure is as follows:

[0021] (1) Pre-denaturation at 94-98°C for 4-6 minutes;

[0022] (2) Denaturation at 94-97°C for 25-35 seconds;

[0023] (3) Annealing at 55-65°C for 25-35 seconds;

[0024] (4) 70-74°C for 35-45 seconds;

[0025] (5) Repeat (2) to (4) for 25 to 35 cycles;

[0026] (6) Extend at 70-74°C for 4-6 minutes.

[0027] The present invention has the following beneficial effects:

[0028] In the present invention, a single nucleotide T / C mutation occurs on the 4th exon of pig FSD2 on chromosome 7 of the pig genome. PCR amplification of the target sequence containing the single nucleotide mutation site using primers can quickly identify the polymorphism of the FSD2 gene, thereby detecting differences in pork quality, and accelerating the breeding process of breeding pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0030] Figure 1 The following are the sequencing maps of different genotypes of the porcine FSD2 gene SNP site. A is the sequencing map of the TT genotype, B is the sequencing map of the CT genotype, and D is the sequencing map of the CC genotype. DETAILED DESCRIPTION

[0031] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0032] Example 1: Development of SNP molecular markers for identifying pork quality.

[0033] 1. Experimental setup.

[0034] The experimental pig breed for this application is Songlei Black Pig, and the samples were obtained from Jilin Xinghui Qipan Agricultural Technology Co., Ltd. 139 Songlei Black Pigs weighing approximately 100 kg were slaughtered and the longissimus dorsi muscles were collected 24 hours after slaughter. Thawing water loss was determined by measuring the water loss of the longissimus dorsi muscles before and after thawing. Initial moisture was determined using a 65°C drying method. Meat color and pH were determined using a meat color meter and pH meter. Pressurized water loss was determined using the pressurized weight method. Intramuscular fat content and shear force were determined using extraction and cutting methods.

[0035] The porcine genomic DNA was extracted by first mincing the tissue with sterilized ophthalmic scissors, homogenizing it, and then extracting it using the genomic DNA kit (DP304) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0036] 2. Research and development of SNP molecular markers.

[0037] 1. Primer design and synthesis.

[0038] Primers were designed based on the sequence of exon 4 of the porcine FSD2 gene in Ensemble (Ensembl No.: ENSSSCT00000002022.5) and synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The primer sequence information is shown in Table 1.

[0039] Table 1: Primer sequences of porcine FSD2 gene

[0040] Primers Sequence 5′-3′ SEQ ID NO. F AAACGTCTCTGGAGAGGCAC 2 R ACCTACTCTGGCCACAACCA 3

[0041] 2. PCR amplification.

[0042] PCR amplification was performed using the above primers in pooled genomic DNA from 60 Songlei Black pigs. The PCR reaction system consisted of 0.5 μL of each upstream and downstream primer, 0.5 μL of pooled genomic DNA, 10 μL of 2× Premix buffer, and 11 μL of water. The PCR program was as follows: 95°C for 5 min; 30 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 40 s; and 72°C for 5 min. The SNP molecular marker sequence is shown in SEQ ID NO. 1:

[0043] SEQ ID NO. 1: AAACGTCTCTGGAGAGGCACATTTCATGTCCCCAAA.

[0044] 2. Detection of porcine FSD2 gene polymorphism.

[0045] SeqMan in DNASTAR was used to compare the Ensemble database sequence with the sequenced nucleotide sequence to screen for polymorphic sites. The fragment containing the polymorphic site was PCR amplified using the system and procedure as shown above. After amplification, the PCR product was sequenced. The SeqMan alignment sequencing results are shown in Figure 2. Figure 1 As shown, a SNP site was found at 140 bp in the PCR product sequencing results, and there were three genotypes: TT, TC, and CC.

[0046] 3. Verification of association analysis between SNP molecular markers and pork quality.

[0047] 1. Genotype frequency and gene frequency.

[0048] The genotype and gene frequencies of the above SNPs were analyzed, with TT and T being the dominant alleles and T being the dominant alleles, respectively. The chi-square test showed that the above SNPs were in a state of Hartmann-Wenzhou equilibrium (P>0.05).

[0049] Table 2: Genotype frequency and gene frequency analysis

[0050]

[0051] 2. Verification of the association between SNP sites and meat quality.

[0052] The meat quality traits of 139 Songlei black pigs weighing about 100 kg were statistically analyzed, and the T-TEST was used to analyze the significance of the differences in meat quality traits among different genotype groups. As shown in Table 3, the thawing water loss rate, shear force, and intramuscular fat content of TT genotype individuals were significantly lower than those of CC genotype individuals, and the initial moisture content was significantly higher than that of CC genotype individuals. Selecting TT genotype black pigs can reduce the thawing water loss rate and improve tenderness and initial moisture content. Selecting CC genotype individuals can increase the intramuscular fat content, which can be used for early breeding, thereby accelerating the breeding process of breeding pigs.

[0053] Table 3: Association analysis and verification of SNP loci and meat quality

[0054] TT CT CC Number of individuals (head) 65 65 9 Thawing water loss rate (%) <![CDATA[6.85±2.91 B ]]> <![CDATA[6.73±2.90 B ]]> <![CDATA[9.87±3.11 A ]]> brightness 45.02±3.34 45.69±3.94 46.08±3.40 Redness 5.92±1.13 5.98±1.46 5.30±0.74 Yellowness 3.96±1.61 3.82±1.53 3.63±1.36 Initial moisture (%) <![CDATA[72.53±1.59 A ]]> <![CDATA[72.16±1.69 A ]]> <![CDATA[70.56±2.27 B ]]> Intramuscular fat content (%) <![CDATA[2.40±0.60 B ]]> <![CDATA[2.88±0.76 B ]]> <![CDATA[3.17±0.86 A ]]> Pressurized water loss rate (%) 26.19±5.00 27.35±5.32 27.84±2.81 pH 5.94±0.17 5.91±0.17 5.92±0.17 Shear force (N) <![CDATA[33.60±8.80 B ]]> <![CDATA[35.97±9.39 AB ]]> <![CDATA[44.14±7.50 A ]]>

[0055] Note: Different capital letters indicate extremely significant differences (P<0.01).

[0056] Although preferred embodiments of the present invention have been described, additional changes and modifications to these embodiments may occur to those skilled in the art once the basic inventive concepts become known.

[0057] Obviously, those skilled in the art may make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if such modifications and variations fall within the scope of the claims and their equivalents, the present invention is intended to include such modifications and variations.

Claims

1. Application of a pair of specific primers or a kit comprising the specific primers in identifying the quality of Songlei black pork, characterized in that: The specific primers are the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.

3. The genomic DNA of Songlei black pig is amplified by the specific primers, and the pig genome Sscrofa11.1 is used as a reference. When the genotype at the 140th position of the amplified product is detected to be the CC genotype, it indicates that the Songlei black pork has a high thawing water loss rate and a high intramuscular fat content. When the 140th position of the amplified product is detected to be the TT genotype or the CT genotype, it indicates that the Songlei black pork has a low thawing water loss rate and a low intramuscular fat content.

2. A method for identifying the quality of Songlei black pork, characterized in that: The following steps are involved: S1. Extracting the genomic DNA of the Songlei black pig to be tested; S2. Using the genomic DNA of the Songlei black pig to be tested as a template, amplification is performed using the specific primers according to claim 1 to obtain an amplified product; S3. Using the pig genome Sscrofa11.1 as a reference, identifying the genotype at position 140 of the amplified product, and determining the thawing water loss rate and intramuscular fat content of the pork according to the genotype; S4. The judgment method is: when the SNP site at position 140 of the amplified product is CC genotype, the thawing water loss rate and intramuscular fat content of pork are higher than those of pigs with TT genotype and CT genotype at the same site.

3. The method for identifying the quality of Songlei black pork according to claim 2, characterized in that: The amplification reaction system is as follows: 0.4-0.6µL of upstream primer and downstream primer, 0.4-0.6µL of porcine genomic DNA to be tested, 9-11µL of 2×Premix buffer, and 10-12µL of water; The reaction procedure is as follows: (1) Pre-denaturation at 94-98°C for 4-6 minutes; (2) Denaturation at 94-97°C for 25-35 seconds; (3) Annealing at 55-65°C for 25-35 seconds; (4) 70-74°C for 30-45 seconds; (5) Repeat (2) to (4) for 25 to 35 cycles; (6) Extend at 70-74°C for 4-6 minutes.