RPA primer group and kit for rapidly detecting salmonella pullorum based on RPA-CRISPR / Cas12a

Abstract

The invention discloses an RPA primer group and a kit for rapidly detecting salmonella pullorum based on RPA-CRISPR / Cas12a, and belongs to the technical field of salmonella pullorum visual rapid detection. A specific target gene ipaj in a salmonella pullorum genome is taken as a target spot, an RPA primer pair and a specific crRNA sequence are designed and optimized, the salmonella pullorum is detected by combining an RPA isothermal amplification method and a CRISPR / Cas12a detection method, a detection result can be interpreted by naked eyes under blue light, and the detection result is accurate. The kit has the characteristics of high sensitivity, strong specificity, accurate result, short time consumption, simplicity and convenience in operation and high practicability, and is suitable for rapid screening or detection of the pullorum disease on site.

Description

Technical Field

[0001] The present invention relates to an RPA primer set and a kit for rapid detection of Salmonella pullorum based on RPA-CRISPR / Cas12a, belonging to the technical field of visual rapid detection of Salmonella pullorum. Background Art

[0002] Pullorum disease is an acute septicemic infectious disease caused by Salmonella pullorum. This disease can infect and cause illness in chickens of any age and breed. Among them, chicks within 3 weeks of age are the most susceptible. After infection, chicks are mainly characterized by white diarrhea and necrosis of internal organs, with a very high lethality rate. Adult chickens are mostly subclinically infected, mainly asymptomatic, and when it is more serious, symptoms such as reduced fertilization rate and egg production will appear. Due to the vertical transmission characteristics of pullorum disease, it can be vertically transmitted to offspring through eggs, further increasing the prevention and control difficulty of this disease and seriously endangering the healthy development of China's livestock and poultry industry.

[0003] Currently, the detection methods of Salmonella pullorum mainly include traditional bacteriological diagnosis, molecular biological diagnosis and immunological diagnosis. The bacteriological diagnosis method is mainly detected according to the method specified in GB 4789.4-2023, which is divided into 5 steps: sampling and enrichment, isolation and culture, microscopic examination, biochemical test and serological test. The whole process takes 4-7 days. Although this method is known as the "gold standard" for identifying Salmonella pullorum, this detection method is time-consuming, laborious and has complex operations, and is not suitable for the detection of a large number of clinical samples. Molecular biological diagnosis mainly includes polymerase chain reaction (PCR) and quantitative fluorescence (QPCR) technology. Although PCR technology and QPCR technology take less time than traditional bacteriological diagnosis, these two methods have high requirements for operators, detection conditions and instruments, and aerosol contamination and false positive problems are more likely to occur during the operation process. The immunological diagnosis of pullorum disease mainly includes plate agglutination detection technology, colloidal gold immunochromatography technology, and enzyme-linked immunosorbent assay (ELISA) technology. The plate agglutination detection method is simple to operate, low in cost and does not require additional equipment, and is currently the preferred method for pullorum disease purification in China. However, the specificity and sensitivity of this method are relatively low, and false positives often occur. The colloidal gold immunochromatography technology has the advantages of simple operation and rapidity, but there is also the problem of high cost. The ELISA method has the characteristics of strong specificity and high sensitivity, but the operation process is relatively complex and false positives are also likely to occur. Therefore, it is urgent to develop a more convenient and rapid method suitable for on-site real-time detection, which is of great significance for the detection of Salmonella pullorum. Summary of the Invention

[0004] To solve the problem of detecting the presence of Salmonella pullorum, one object of the present invention is to provide an RPA primer set for rapid detection of Salmonella pullorum based on RPA-CRISPR / Cas12a. The RPA primer set includes an RPA upstream primer F3 and an RPA downstream primer R3. The sequence of the RPA upstream primer F3 is: GCGTTTTAGCGGTGCGTACAATAAGGGATTA; the sequence of the RPA downstream primer R3 is: TTGGTGGGCGATGAGTTGCGCAGAGCGCTGC.

[0005] Another object of the present invention is to provide a kit for rapid detection of Salmonella pullorum based on RPA-CRISPR / Cas12a. The kit includes an RPA upstream primer F3, an RPA downstream primer R3, and a crRNA sequence. The crRNA sequence is: UAAUUUCUACUAAGUGUAGAUGCGGUGCGUACAAUAAGGGA.

[0006] Preferably, the kit further includes: cas12a enzyme, ssDNA probe, 10× Cleavage Buffer, and ddH 2 O.

[0007] The present invention also provides a method for rapid detection of Salmonella pullorum based on RPA-CRISPR / Cas12a, which specifically includes the following steps:

[0008] (1) Extract the DNA of the sample to be tested.

[0009] (2) Using the target DNA as a template, amplify the DNA with the RPA upstream primer F3 and the RPA downstream primer R3.

[0010] (3) Prepare a CRISPR / Cas12a reaction system with the amplified product, crRNA, and Cas12a enzyme. After the reaction ends, test the fluorescence. If fluorescence can be generated, it is determined that the test sample contains Salmonella pullorum.

[0011] Preferably, in step (1), the genomic DNA of Salmonella pullorum is extracted by the boiling method.

[0012] Preferably, step (3) is carried out at 42 °C for 20 min.

[0013] The technical effects of the present invention:

[0014] (1) The present invention targets the specific gene ipaj in the genome of Salmonella pullorum, designs a set of RPA specific primers and crRNA, optimizes the reaction system, and establishes an RPA-CRISPR / Cas12a rapid detection method for Salmonella pullorum, which has strong specificity and high sensitivity, realizes visual detection through blue light, and the detection limit can reach 10 copies / μL.

[0015] (2) Compared with other molecular detection technologies, the method of the present invention has simple equipment, simple operation, short time consumption, and does not require electrophoresis after amplification, which can save the time for preparing the gel and running the gel. The detection result can be visually judged by the naked eye under blue light, realizing visual detection. The whole detection time can be controlled within 1 hour, which is suitable for rapid on-site screening or detection of Salmonella pullorum. Description of the Drawings

[0016] Figure 1 It is the gel electrophoresis diagram of each group of amplification products in the RPA primer screening.

[0017] Figure 2 It is the fluorescence value diagram of the RPA amplification primer and crRNA primer combination screening.

[0018] Figure 3 It is the verification diagram of the cleavage activity of the CRISPR / Cas12a system.

[0019] Figure 4 It is the fluorescence value of the RPA-CRISPR / Cas12a sensitivity determination result.

[0020] Figure 5 It is the visual observation result of the RPA-CRISPR / Cas12a sensitivity.

[0021] Figure 6 It is the fluorescence value in the specific detection.

[0022] Figure 7 It is the visual observation result in the specific detection.

[0023] Figure 8 It is the detection result of 40 clinical samples. Detailed Embodiments

[0024] The present invention will be further described in detail below in conjunction with the drawings and specific embodiments, but the protection scope of the present invention is not limited to the content described.

[0025] In the specific embodiments of the present invention, the crRNA was synthesized by Sangon Biotech (Shanghai) Co., Ltd.; the RPA rapid amplification kit was purchased from Zhongce Biotechnology Co., Ltd., product batch number: S001ZC; the bacterial genomic DNA extraction kit was purchased from Acclab Biotech Co., Ltd., product batch number: AG21007; the Cas12a enzyme (LbCas12a Nuclease) and 10× Cleavage Buffer were both purchased from Guangzhou Aidy Gene Technology Co., Ltd., product batch number EDE0005-B; the ssDNA reporter (ssDNA probe) was purchased from Shenzhen Eazybiotech Co., Ltd., product batch number DFBH-24C20;

[0026] Example 1

[0027] 1. RPA Primer Design

[0028] In the present invention, the specific gene ipaj of Salmonella pullorum was used as the target. By consulting the literature and downloading the gene fragments of Salmonella pullorum from the NCBI database, through sequence alignment, and in accordance with the principles of RPA primer design, 4 pairs of primers were designed. The specific sequences are shown in Table 1, and the best primer combination was screened as F3 and R3 (see Figure 1 ), the sequence of F3 is GCGTTTTAGCGGTGCGTACAATAAGGGATTA, and the sequence of R3 is TTGGTGGGCGATGAGTTGCGCAGAGCGCTGC. The specific sequences are shown in Table 1:

[0029] Table 1 Primers for RPA Amplification

[0030]

[0031] 2. RPA Amplification Reaction

[0032] First, the 4 pairs of designed RPA primers were combined, namely F1 / R1, F1 / R2, F1 / R3, F1 / R4, F2 / R1, F2 / R2, F2 / R3, F2 / R4, F3 / R1, F3 / R2, F3 / R3, F3 / R4, F4 / R1, F4 / R2, F4 / R3, F4 / R4. Using the Salmonella pullorum DNA sample stored in our laboratory as the template, and at the same time setting a negative control (ddH 2 0), the RPA primers in Table 1 above were used for RPA amplification respectively. The total volume of the RPA amplification system was 50 μl, and the reaction system was as follows: A Buffer was 25 μl, the upstream primer with a concentration of 10 μm was 2 μl, the downstream primer with a concentration of 10 μm was 2 μl, ddH 2O is 13.5 μl, the DNA template is 5 μl, and B Buffer is 2.5 μl. After mixing, quickly transfer it to the reaction tube containing the dry powder of the amplification reaction enzyme. The reaction system reacts at 39 °C for 30 min. After the RPA amplification is completed, finally add 50 μL of DNA purifying agent to the reaction tube, centrifuge for 10 min to mix evenly. Prepare a 2% agarose gel, with a voltage of 120 V, a current of 220 mA, and the time set to 30 min. Electrophoretically detect the amplification product and observe the results through a gel imager.

[0033] The results are as Figure 1 shown, Figure 1 in which, M is Marker, and lanes 1 - 16 represent 16 primer combinations, which are F1 / R1, F1 / R2, F1 / R3, F1 / R4, F2 / R1, F2 / R2, F2 / R3, F2 / R4, F3 / R1, F3 / R2, F3 / R3, F3 / R4, F4 / R1, F4 / R2, F4 / R3, and F4 / R4 in sequence, and N represents the negative control. The results show that the amplification efficiency of the F3 / R3 combination is the best.

[0034] Example 2

[0035] 1. Design of crRNA

[0036] According to the RPA primer set F3 / R3 with better amplification effect above, 3 pairs of crRNAs are designed, namely crRNA1, crRNA2, and crRNA3, as shown in Table 2 specifically, and the best RPA and crRNA combination F3 / R3 - crRNA2 is screened out, as shown specifically in Figure 2 shown.

[0037] Table 2 crRNA sequences

[0038] Name Sequence (5’-3') crRNA1 UAAUUUCUACUAAGUGUAGAUTCAGGCGCGATCGCGGCAGT crRNA2 UAAUUUCUACUAAGUGUAGAUGCGGUGCGUACAAUAAGGGA crRNA3 UAAUUUCUACUAAGUGUAGAUCCTGTCTGCTGCCGTGATCG

[0039] 2. Establishment and verification of the RPA - CRISPR / Cas12a detection system

[0040] The RPA reaction system and reaction conditions are the same as in Example 1. The RPA products obtained from the RPA amplification reaction are respectively mixed with crRNA, ssDNA probe, and Cas12a enzyme for the Cas12a fluorescence detection reaction. The total system of the fluorescence detection reaction is 30 μL. First, add 1 μL of Cas12a enzyme with a concentration of 100 μM and 1 μL of crRNA with a concentration of 50 nM, mix evenly, and incubate at room temperature for 10 min. Then, add 3 μL of 10×Cleavage Buffer, 1.2 μL of ssDNA probe, and 20.8 μL of ddH 2O, mix well, and finally add 3 μL of the RPA product. Incubate at 42 °C for 20 minutes and take a photo under blue light. The verification results are as Figure 3 , indicating that the established method can activate ssDNA cleavage in the system, release fluorescence signals, and enable rapid visual detection of Pullorum disease.

[0041] Example 3

[0042] A kit for rapid detection of Salmonella pullorum, comprising: an RPA rapid amplification kit, an RPA primer set (sequences are F3, R3), crRNA (sequence is crRNA2), 10×Cleavage Buffer, Cas12a enzyme, ssDNA probe, and ddH 2 O.

[0043] Example 4

[0044] A method for rapid visual detection of Salmonella pullorum:

[0045] (1) Extract the DNA sample to be tested by the boiling method.

[0046] (2) Use an RPA rapid amplification kit and perform an RPA amplification reaction with the RPA primer set (sequences are F3, R3): The total volume of the RPA reaction system is 50 μL, including 25 μl of A Buffer, 2 μl of the upstream primer with a concentration of 10 μm, 2 μl of the downstream primer with a concentration of 10 μm, ddH 2 O is 13.5 μl, the DNA template is 5 μl, B Buffer is 2.5 μl, and the reaction program is 39 °C for 30 min. After the reaction, take out the RPA reaction product.

[0047] (3) Prepare the CRISPR / Cas12a reaction system: The system is 30 μL, including 1 μL of Cas12a enzyme with a concentration of 100 μM, 1 μL of crRNA with a concentration of 50 nM, 3 μL of 10×Cleavage Buffer, 1.2 μL of ssDNA probe, 20.8 μL of ddH 2 O, and 3 μL of the RPA product. React at 42 °C for 20 min. If there is a fluorescence reaction, it is determined to be positive for Salmonella pullorum, otherwise it is negative.

[0048] Example 5

[0049] Sensitivity detection of the RPA-CRISPR / Cas12a fluorescence detection system

[0050] Gradient dilute the plasmid standard containing the ipaj target fragment of Salmonella pullorum to 1×10 6 copies / μL, 1×105 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL and 1×10 0 copies / μL were simultaneously used as ddH 2 O as the negative control. The reaction system was prepared according to the method in Example 4, and the reaction system was placed in QPCR for reaction and real-time fluorescence signals were collected. The reaction results were as Figure 4 and Figure 5 shown. Figure 5 From left to right were the negative control, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL and 1×10 0 copies / μL. It can be seen from the figure that this reaction can detect plasmid standards as low as 1×10 1 copies / μL.

[0051] Example 6

[0052] Specificity detection of the RPA-CRISPR / Cas12a fluorescence detection system

[0053] Salmonella pullorum and 5 other pathogenic microorganisms were specifically tested. The 5 pathogenic microorganisms were Salmonella gallinarum, Salmonella kentucky, Proteus mirabilis, Acinetobacter, and Escherichia coli. The above strains were inoculated into 5 mL of LB medium, placed in a constant temperature incubator at 37°C and shaken overnight. 1 - 5 mL of the bacterial solution was taken, and different bacterial solution samples were detected according to the method shown in Example 4; the negative control group used ddH 2 O to replace the DNA template for the reaction; the results were as Figure 6 and Figure 7 shown. Figure 7 In it, numbers 1 - 6 were Salmonella pullorum, Salmonella gallinarum, Salmonella kentucky, Proteus mirabilis, Acinetobacter, and Escherichia coli in sequence. The results showed that there were fluorescence signals in the detection results of Salmonella pullorum, and no fluorescence was detected in the detection results of other bacterial samples, indicating that the detection method described in the present invention has good specificity and can well distinguish Salmonella pullorum from the other 5 bacteria.

[0054] Example 7

[0055] Actual sample detection

[0056] Forty suspected pullorum disease samples were used as test samples and detected using the RPA-CRISPR / Cas12a detection technique, with ddH 2 O as the negative control. The different sample solutions were detected according to the method shown in Example 4, and the test results were interpreted under blue light. The results are as Figure 8 shown. Among the 40 samples, 16 were positive samples, and the negative control was (the first sample in the first row). Fluorescence appeared in a total of 16 samples from the second sample in the first row to the first sample in the third row, so they were determined to be positive pullorum disease samples. From the second sample in the third row to the eighth sample in the fifth row, a total of 23 samples showed no fluorescence and were determined to be negative pullorum disease samples. The above results indicate that the test results are normal, and the test results of 16 samples and 23 negative samples among the 40 actual samples are all negative.

Claims

1. An RPA primer set for rapid detection of Salmonella pullorum based on RPA-CRISPR / Cas12a, characterized in that: The RPA primer set includes an RPA upstream primer F3 and an RPA downstream primer R3; wherein the sequence of the RPA upstream primer F3 is: GCGTTTAGCGGTGCGTACAATAAGGGATTA; and the sequence of the RPA downstream primer R3 is: TTGGTGGGCGATGAGTTGCGCAGAGCGCTGC.

2. A kit for rapid detection of Salmonella pullorum based on RPA-CRISPR / Cas12a, characterized in that: The kit comprises an RPA upstream primer F3, an RPA downstream primer R3 and a crRNA sequence; wherein the crRNA sequence is: UAAUUUCUAAGUGUAGAUGCGGUGCGUACAAUAAGGGA.

3. The kit according to claim 2, characterized in that: The kit also includes Cas12a enzyme, ssDNA probe, 10×Cleavage Buffer and ddH2O.

Images