Primer probe combination, kit, detection method and application for detecting avian mycoplasma

By using multiplex quantitative PCR technology and specific primer-probe combinations, simultaneous single-tube quantitative detection of MG and MS was achieved, solving the problem of identification difficulties in existing technologies, improving detection efficiency and accuracy, and reducing the incidence of avian mycoplasma infection.

CN120060519BActive Publication Date: 2026-05-15WENS FOODSTUFF GROUP CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
WENS FOODSTUFF GROUP CO LTD
Filing Date
2025-03-26
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Current technologies cannot quickly and accurately identify Mycoplasma gallisepticum (MG) and Mycoplasma synoviae (MS) infections, especially lacking single-tube simultaneous quantitative detection methods, which makes it difficult to meet the needs of farms for mixed infections, and cannot distinguish between current infections and antibodies produced by vaccines.

Method used

We designed a multiplex quantitative PCR detection technology to achieve simultaneous quantitative detection of MG, MS and mixed infections in a single tube through specific primer and probe combinations, and combined antibody detection to distinguish between vaccine strains and clinical strains.

Benefits of technology

It enables rapid and accurate single-tube simultaneous quantitative detection, which can distinguish between current infection and vaccine-induced antibodies, improves the efficiency of avian mycoplasma control, and reduces morbidity and economic losses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060519B_ABST
    Figure CN120060519B_ABST
Patent Text Reader

Abstract

The application discloses a primer probe combination for detecting avian mycoplasma, wherein the avian mycoplasma comprises one or more of MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH or MS clinical strain, and the sequence of the primer probe is shown as SEQ ID NO. 1-SEQ ID NO. 8. The primer probe combination can be used for rapidly and accurately detecting the MG attenuated vaccine strain F-36, the MG clinical strain, the MS attenuated vaccine strain MSH and the MS clinical strain, and has high specificity, high sensitivity and good repeatability. The detection of one sample and the result interpretation can be completed in about 1 hour, and the detection cost can be controlled within 1-3 yuan per sample.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection technology, and in particular to a primer-probe combination, kit, detection method and application for detecting avian mycoplasma. Background Technology

[0002] Avian mycoplasma is a pathogen that seriously endangers the health of poultry. Mycoplasma gallisepticum (MG) infection primarily causes chronic respiratory disease (CRD), clinically manifested as cough, runny nose, infraorbital sinus swelling, difficulty breathing, stunted growth in chicks, and reduced feed conversion rate. Mycoplasma synoviae (MS) infection mainly leads to infectious bursitis and subclinical respiratory infection, with typical symptoms including joint swelling (tarsal joints, claw pads), lameness, and sternal cysts. Avian mycoplasma infection reduces egg production in breeder hens, deteriorates eggshell quality, and decreases hatchability. It can spread through vertical transmission (hatching eggs) and horizontal transmission (aerosols, contact). Current prevention and control in breeder hens mainly relies on live vaccine immunization, with the MG attenuated vaccine strain F-36 and the MS attenuated vaccine strain MSH playing important roles in avian mycoplasma control.

[0003] Currently, multiplex quantitative PCR has become one of the main methods for detecting pathogens and assessing vaccine efficacy. However, MG and MS require complex culture media (such as Frey's medium) for isolation, have slow growth (5-21 days), and require a CO2 environment. While plate agglutination assays (SPA) or ELISA are rapid, they cannot distinguish between current infection and vaccine antibodies, and are insensitive to early infection (before antibody production). Singlex PCR requires multiple reactions to identify pathogens, is time-consuming and prone to contamination, lacks quantitative capability, and is difficult to assess the degree of infection. Although dual quantitative PCR methods for MS vaccine strains MSH and MS clinical strains have been developed, existing methods cannot meet the needs of farms for rapid identification of MG, MS, and mixed infections, especially lacking a single-tube simultaneous quantitative detection solution. This invention, through the design of a multiplex probe-based quantitative PCR method, overcomes technical bottlenecks and provides a key tool for the precise control of avian mycoplasma infection. Summary of the Invention

[0004] The purpose of this invention is to provide a primer-probe combination, kit, detection method and application for detecting avian mycoplasma, so as to meet the need for rapid identification of MG, MS and mixed infection, especially for single-tube simultaneous quantitative detection.

[0005] According to a first aspect of the present invention, a primer-probe combination for detecting avian mycoplasma is provided, wherein the avian mycoplasma includes one or more of the following: MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, or MS clinical strain, and the sequences of the primer-probe combination are shown in SEQ ID NO.1–SEQ ID NO.8. Therefore, this primer-probe combination enables simultaneous quantitative detection in a single tube using multiplex quantitative PCR technology, allowing for rapid identification of MG, MS, and mixed infections. Furthermore, combined with antibody detection, it can distinguish between current infection and vaccine-induced antibodies (effectively differentiating between vaccine strains and clinical strains), resulting in more accurate detection, better understanding of current clinical epidemiological patterns, strengthened control of avian mycoplasma, reduced morbidity, and mitigated economic losses.

[0006] In some embodiments, the primer sequences for MG are shown in SEQ ID NO.1 and SEQ ID NO.2, the probe sequence for the MG attenuated vaccine strain F-36 is shown in SEQ ID NO.3, and the probe sequence for the MG clinical strain is shown in SEQ ID NO.4; the primer sequences for MS are shown in SEQ ID NO.5 and SEQ ID NO.6, the probe sequence for the MS attenuated vaccine strain MSH is shown in SEQ ID NO.7, and the probe sequence for the MS clinical strain is shown in SEQ ID NO.8.

[0007] In some implementations, the fluorescent reporter group for the probe against the MG attenuated vaccine strain F-36 is CY5, the fluorescent reporter group for the probe against the MG clinical strain is FAM, the fluorescent reporter group for the probe against the MS attenuated vaccine strain MSH is ROX, and the fluorescent reporter group for the probe against the MS clinical strain is VIC.

[0008] According to a second aspect of the present invention, a kit for simultaneously detecting different species of avian mycoplasma is provided, the kit comprising the aforementioned primer-probe combination. This kit enables rapid and accurate detection of MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, and MS clinical strain, exhibiting high specificity, high sensitivity, and good repeatability. Furthermore, it allows for simultaneous quantitative detection in a single tube, enabling rapid identification of MG, MS, and mixed infections. Combined with antibody detection, it can distinguish between current infection and vaccine-induced antibodies (effectively differentiating between vaccine strains and clinical strains), resulting in more accurate detection, better understanding of current clinical epidemiological patterns, strengthened control of avian mycoplasma, reduced morbidity, and mitigated economic losses.

[0009] In some embodiments, the kit may also include other reagents for enabling multiplex quantitative PCR detection.

[0010] According to a third aspect of the present invention, the application of the primer-probe combination or kit described herein is provided for the simultaneous detection of different species of avian mycoplasma, including one or more of the following: MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, or MS clinical strain. This application is not for disease diagnosis or treatment. This application enables rapid and accurate detection of four different species of avian mycoplasma, allowing for timely discovery and diagnosis of pathogen infection, which helps in taking appropriate prevention and control measures and effectively mitigating the impact of avian mycoplasma.

[0011] According to a fourth aspect of the invention, the primer-probe combination is provided for use in the preparation of products for detecting one or more of the following mycoplasma infections: MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, or MS clinical strain. Through this application, products can be prepared for detecting one or more of the following mycoplasma infections: MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, or MS clinical strain. The use of this product can improve the detection efficiency in poultry farms, enabling rapid and accurate detection of four different species of avian mycoplasma, timely discovery and diagnosis of pathogen infection, and facilitating the implementation of corresponding prevention and control measures to effectively mitigate the impact of avian mycoplasma.

[0012] According to a fifth aspect of the present invention, a method for simultaneously detecting different species of avian mycoplasma is provided, the method comprising the following steps:

[0013] S1: Synthesize the primer-probe combination as described above, or use the kit described above;

[0014] S2: Establishment of multiplex quantitative PCR system: The final concentration of primers in the multiplex quantitative PCR detection reaction system is 0.4 μmol / L, and the final concentration of probe is 0.2 μmol / L;

[0015] S3: The reaction procedure for multiplex quantitative PCR detection is as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 sec, 62.2℃ annealing and extension for 30 sec, 40 cycles, and fluorescence signal acquisition is performed after each extension.

[0016] S4: The result of multiplex quantitative PCR detection is determined as follows: if the Cq value of the sample is ≤37 and the amplification curve shows an obvious exponential growth phase, the result is valid and the sample is considered positive; if the Cq value of the sample is >37 or the Cq value of the sample cannot be detected, the sample is considered negative.

[0017] Therefore, this method can improve the detection efficiency and accuracy of avian mycoplasma, and track the immunization effect on chicken flocks immunized with the F-36 or MSH strains, exhibiting high specificity and sensitivity. It enables a better understanding of current clinical epidemiological patterns, strengthens the prevention and control of avian mycoplasma, reduces morbidity, and mitigates economic losses.

[0018] In some embodiments, the positive control plasmid used for multiplex quantitative PCR detection is a pMD18T recombinant plasmid, which is constructed by inserting the sequence shown in SEQ ID NO.9 into the pMD18T vector.

[0019] In some embodiments, the multiplex quantitative PCR is performed by detecting whether the sample contains at least one of the following target genes: Mycoplasma gallisepticum attenuated vaccine strain F-36, MG clinical strain, Mycoplasma synovitis attenuated vaccine strain MSH, or MS clinical strain.

[0020] The beneficial effects of this invention are:

[0021] 1. The primer-probe combination, kit, or detection method disclosed in this invention can simultaneously detect four different avian mycoplasmas. From the detection perspective, identifying four types of avian mycoplasma in a single system is much more difficult than identifying one or two. Furthermore, since MS and MG are different species within the same genus and are genetically very similar, screening for non-overlapping target sites is very challenging, making the selection of primers and probes for efficient detection even more difficult. Moreover, this invention can effectively detect vaccine strains and clinical strains, which is equivalent to distinguishing between homologous strains, requiring screening for point mutations. In this invention, over 10,000 point mutation target sites for MS and MG were constructed using bioinformatics methods. The feasibility of primer-probe sequences was then analyzed using software, and combined with the point mutation status of vaccine and clinical strains, ultimately selecting the optimal primer and probe sequence combination.

[0022] 2. The design of the probe in this invention is particularly important. The probe needs to cooperate with the primer and bind to the template before the primer. Otherwise, the DNA polymerase will not be able to cut the probe and will not generate a fluorescent signal, resulting in detection failure. At the same time, the probe needs to ensure efficient binding with the template. Otherwise, it will not be able to bind to the template effectively, which will also result in no fluorescent signal and detection failure. At the same time, it is necessary to ensure that there is no aggregation or mismatch between probes or between probes and primers.

[0023] 3. The primer-probe combination, kit, or detection method disclosed in this invention can achieve simultaneous quantitative detection in a single tube, quickly identify MG, MS, and mixed infections, and distinguish between current infection and vaccine-produced antibodies (effectively distinguishing between vaccine strains and clinical strains). The detection is more accurate, enabling better understanding of current clinical epidemiological patterns, strengthening the prevention and control of avian mycoplasma, reducing morbidity, and mitigating economic losses.

[0024] 4. The primer-probe combination, kit, or detection method disclosed in this invention can rapidly and accurately detect four different types of avian mycoplasma, promptly identify and diagnose pathogen infection, and help to take corresponding prevention and control measures to effectively reduce the impact of avian mycoplasma.

[0025] 5. The primer-probe combination, kit, or detection method disclosed in this invention can improve the detection efficiency and accuracy of avian mycoplasma, and track the immunization effect on chicken flocks immunized with F-36 or MSH strains. It exhibits high specificity and sensitivity. This allows for better understanding of current clinical epidemiological patterns, strengthens the prevention and control of avian mycoplasma, reduces morbidity, and mitigates economic losses.

[0026] 6. The primer-probe combination, kit, or detection method disclosed in this invention achieves 100% detection specificity and sensitivities of 8.64 copies / μL, 9.26 copies / μL, 6.67 copies / μL, and 7.11 copies / μL, respectively. Furthermore, completing the detection and result interpretation of a single sample takes only about one hour, and the detection cost can be controlled at 1-3 yuan per sample. Attached Figure Description

[0027] Figure 1 This is a graph showing the detection results when screening primer-probe combinations in Example 1 of the present invention;

[0028] Figure 2 The figure shows the specificity experimental results of four different types of avian mycoplasma primers and probes in Example 2 of the present invention: where line A is the fluorescent amplification curve of MG attenuated vaccine strain F-36 CY5, line B is the fluorescent amplification curve of MG clinical strain FAM, line C is the fluorescent amplification curve of MS attenuated vaccine strain MSH ROX, and line D is the fluorescent amplification curve of MS clinical strain VIC.

[0029] Figure 3 This is a standard curve diagram of the positive control plasmids for four different species of avian mycoplasma primers and probes in Example 3 of the present invention: where, Figure 3 A represents the standard curve of fluorescent labeling for the MG attenuated vaccine strain F-36 CY5. Figure 3 B represents the standard curve for FAM fluorescence labeling in the MG clinical strain. Figure 3C represents the standard curve of MSH ROX fluorescence labeling for the MS attenuated vaccine strain. Figure 3 D represents the standard curve of VIC fluorescence labeling in the MS clinical strain;

[0030] Figure 4 The figure shows the intra-batch and inter-batch repeatability test results of four different types of avian mycoplasma primers and probes in Example 4 of this invention: [Figure showing results of intra-batch and inter-batch repeatability test results of four different types of avian mycoplasma primers and probes in Example 4 of this invention] Figure 4 A represents the standard curve of fluorescent labeling for the MG attenuated vaccine strain F-36 CY5. Figure 4 B represents the standard curve for FAM fluorescence labeling in the MG clinical strain. Figure 4 C represents the standard curve of MSH ROX fluorescence labeling for the MS attenuated vaccine strain. Figure 4 D represents the standard curve of VIC fluorescence labeling in the MS clinical strain. Detailed Implementation

[0031] The invention will now be described in further detail with reference to the accompanying drawings and embodiments.

[0032] Example 1: Establishment of a multiplex real-time PCR method for simultaneous detection of four different species of avian mycoplasma.

[0033] 1.1 Genome Preparation

[0034] DNA was extracted from four different species of avian mycoplasma, and all DNA was stored at -80℃ for later use. These four species were: Mycoplasma gallisepticum (MG) attenuated vaccine strain F-36, MG clinical strain, Mycoplasma synoviae (MS) attenuated vaccine strain MSH, and MS clinical strain. The MG attenuated live vaccine F-36 was purchased from Zhaofenghua Biotechnology Co., Ltd., product name: Hubangning, batch number: 22121001; the MS attenuated live vaccine MSH was purchased from Shandong Xinde Technology Co., Ltd., product name: MSH live vaccine, batch number: MSH213171AG; the MG clinical strain was obtained by isolating tracheal samples from incompletely shell-pecking live embryos found in hatcheries in Guangdong Province; and the MS clinical strain was obtained by isolating arthritis samples from chickens in Guangdong Province.

[0035] The steps for isolating and identifying MG and MS clinical strains are as follows: Collected samples are added to mycoplasma liquid culture medium and ground or shaken thoroughly. Then, they are filtered through a 0.45 μm bacterial filter, and an appropriate amount of mycoplasma liquid culture medium is added. The samples are then incubated at 37 ℃. Observation continues until the liquid culture medium changes color from red to orange-yellow. Then, 20 μL is added to mycoplasma solid culture medium and incubated at 37 ℃ for 5-7 days. Strains with colonies resembling a fried egg shape observed under a 200X microscope are successfully isolated. Single colonies are picked for enrichment and identification using quantitative real-time PCR.

[0036] 1.2 Design and synthesis of primers and probes:

[0037] Gene sequences of four avian mycoplasma species—MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, and MS clinical strain—were compared with those published in GenBank (GenBank gene numbers for different strain types are shown in Table 1). Pan-genome analysis of *Mycoplasma gallisepticum* and *Mycoplasma synoviae* was performed using Roary v.3.13.0 to identify differentially expressed gene fragments between the two species. Differentially expressed gene fragments were extracted using seqkit v2.8.0 software. Mutation site alignment was performed on MG attenuated vaccine strain F-36 and MG clinical strain using Snippy v4.6.0, collecting approximately 17,000 SNP sites; similarly, alignment of MS attenuated vaccine strain MSH and MS clinical strain collected 19,000 SNP sites. Subsequently, target sites were identified within the differentially expressed gene fragments. Specific regions were selected, and primers and probes were evaluated and screened using Primer Premier 5.0. Specific primers and probes were designed, with the 5' end of the probes labeled with CY5, FAM, ROX, and VIC fluorescent emitting groups, and the 3' end labeled with BHQ1 or BHQ2 fluorescent quenching groups. A total of 18 primer and probe combinations were designed. qPCR amplification was performed on the nucleic acid DNA of standard samples, namely the MG attenuated vaccine strain F-36, the MG clinical strain, the MS attenuated vaccine strain MSH, and the MS clinical strain. It was found that 17 of these combinations showed non-specific amplification of single positive samples or no amplification results. Figure 1 As shown in Table 2, only one set of optimal primer and probe sequence combinations without nonspecific amplification was finally selected. The optimal primer and probe sequence combination was shown in SEQ ID NO.1-SEQ ID NO.8. The pMD18T recombinant plasmid containing the target gene of four avian mycoplasmas (MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, and MS clinical strain) was constructed. The primers, probes and target gene sequences were synthesized by BGI Genomics.

[0038] Table 1. GenBank gene numbers of different strains

[0039] Genbank Accession strain name GCA_003147565.1 MS-H (MS vaccine strain) GCA_041680585.1 GuangXi_ctx12 (MS clinical strain) GCA_041680085.1 GuangDong_zfr57 (MS clinical strain) GCA_041680485.1 FuJian_zjq41 (MS clinical strain) GCA_041680045.1 GuangDong_tzl59 (MS clinical strain) GCA_041680345.1 Shandong_zwms135 (MS clinical strain) GCA_041680305.1 ZheJiang_dh74 (MS clinical strain) GCA_041680365.1 ZheJiang_cyx247 (MS clinical strain) GCA_041680385.1 ZheJiang_csd55 (MS clinical strain) GCA_041679865.1 XiNan_ylk67 (MS clinical strain) GCA_041679925.1 FuJian_ly49 (MS clinical strain) GCA_000025385.1 F-36 (MG vaccine strain) GCA_000092585.1 R (MG clinical strain) GCA_000211545.6 S6 (MG clinical strain) GCA_046268885.1 LC (MG clinical strain)

[0040] Table 2 Primer Table

[0041] label Primer name Primer sequence 5' fluorescent group 3' Quenching Group Remark SEQ ID NO.1 Pmg-F GTCCCCAAGCAAAACCGT none none MG upstream primer SEQ ID NO.2 Pmg-R AAAACGATCAATACTAACATCACCA none none MG downstream primer SEQ ID NO.3 Pmgf-P TTGCTGGGGTGCTT CY5 BHQ-2 MG attenuated vaccine strain F-36 SEQ ID NO.4 Pmgchina-P TTTTGCTGGGGTGTTT FAM BHQ-1 MG clinical strain SEQ ID NO.5 Rms1 / msh-F GACGTGCTAGTTTATTCACCTGA none none MS upstream primer SEQ ID NO.6 Rms1 / msh-R ACCATTTTCATAGCTCCTATTACTCTAAC none none MS downstream primers SEQ ID NO.7 Rms1 / msh-P AGTTTTTACCTAACTCAGC ROX BHQ-2 MS attenuated vaccine strain MSH SEQ ID NO.8 Rchina-P AAGTTTTTGCCTAACTCA VIC BHQ-2 MS clinical strain

[0042] The target gene sequences of four avian mycoplasmas (MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, and MS clinical strain) are shown in SEQ ID NO. 9:

[0043] GTCCCCAAGCAAAACCGTGACGGTGCTAGTTTATTCACCTGAggtcGGCGGTTTTGCTGGGGTGTTTggtaAAGTTTTGCCTAACTCATTGCTGGGGTGCTTaatgAGTTTTACCTAACTCAGCTGGTGATGTTAGTATTGATCGTTTTcctaAACTACTAGGGGAG CCTAATGATGTTAGAGTAATAGGAGCTATGAAAATGGTggctTGGCTGAGATGAACTGTTCAGACCCACAGGTGCTAATACCGCATAATggctTTATGACCTGATTTGGTTAGTACCACCGCATGGTAGATGGATGAAAGGCttagGTGCATTAGCTAGTTGGTGGG.

[0044] Construction of pMD18T recombinant plasmid: The target gene sequences of the above four avian mycoplasma species (SEQ ID NO. 9) were inserted into the pMD18T vector (TaKaRa catalog number: D101A) to construct the pMD18T recombinant plasmid. The pMD18T recombinant plasmid contains the target genes of four mycoplasma species: MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, and MS clinical strain. The nucleotide sequence of the pMD18T recombinant plasmid is shown in SEQ ID NO. 10.

[0045] 1.3 Establishment of a multiplex quantitative PCR system:

[0046] Multiplex quantitative PCR was performed using pMD18T recombinant plasmid as a positive control. The amplification reaction volume was 20 μL, containing 10 μL of ABclonal 2×Taq DNA Polymerase MIX enzyme, 0.4 μmol / L each of forward and reverse primers, 0.2 μmol / L of probe, 4 μL of template DNA, and deionized water to a final volume of 20 μL. The reaction program was: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 62.2℃ annealing and extension for 30 s, for 40 cycles. Fluorescence signal was collected after each extension. A blank control group using deionized water was also included.

[0047] Example 2: Specificity verification of primers and probes

[0048] Using MG attenuated live vaccine strain F-36, MG clinical strain, MS attenuated live vaccine strain MSH, MS clinical strain, and other pathogen cDNA or DNA as templates, including susceptible avian pathogens such as Marek's virus, avian leukosis virus, Newcastle disease virus, adenovirus, infectious bronchitis virus, Escherichia coli, Salmonella, and Staphylococcus, each reaction system consisted of 20 μL, including 10 μL of 2×Taq DNA Polymerase MIX enzyme, 0.4 μmol / L each of forward and reverse primers, 0.2 μmol / L of probe, 4 μL of template DNA, and deionized water to a final volume of 20 μL. The reaction program was: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, annealing and extension at 62.2℃ for 30 s, for 40 cycles. Fluorescence signal acquisition was performed after each extension. The pMD18T recombinant plasmid was used as a positive control, and sterile double-distilled water was used as a negative control. Experimental results showed that no amplification signal was observed in the negative control and non-target pathogen samples. The experimental results are as follows: Figure 2 As shown, Figure 2 Line A represents the fluorescence amplification curve of the MG attenuated vaccine strain F-36 CY5; line B represents the fluorescence amplification curve of the MG clinical strain FAM; line C represents the fluorescence amplification curve of the MS attenuated vaccine strain MSH ROX; and line D represents the fluorescence amplification curve of the MS clinical strain VIC. The results indicate that the specificity of the fluorescence quantitative PCR detection in this invention is 100%.

[0049] Example 3: Sensitivity Evaluation of Primers and Probes

[0050] Using the pMD18T recombinant plasmid as a template, it was diluted with sterile double-distilled water according to the strain of Mycoplasma gallisepticum attenuated vaccine F-36: 8.64 × 10⁻⁶. 5 copies / μL - 8.64 × 10 1 copies / μL; MG clinical strain: 9.26×10 5 copies / μL - 9.26 × 10 1 copies / μL; Mycoplasma synoviae attenuated vaccine strain MSH: 6.67×10 5 copies / μL - 6.67 × 10 1 copies / μL; MS clinical strain: 7.11×10 5 copies / μL - 7.11×10 1 The samples were then processed at 5-level multiplex quantitative PCR to determine the sensitivity of the multiplex quantitative PCR method.

[0051] A standard curve was plotted based on the relationship between pMD18T recombinant plasmid concentration and Cq value, and the results are as follows: Figure 3 As shown in Table 3, Figure 3 A represents the standard curve of fluorescent labeling for the MG attenuated vaccine strain F-36 CY5. Figure 3 B represents the standard curve for FAM fluorescence labeling in the MG clinical strain. Figure 3 C represents the standard curve of MSH ROX fluorescence labeling for the MS attenuated vaccine strain. Figure 3 D represents the standard curve of VIC fluorescence labeling for the MS clinical strain. The results showed that the sensitivity of this method reached 8.64 copies / μL (MG attenuated vaccine strain F-36), 9.26 copies / μL (MG clinical strain), 6.67 copies / μL (MS attenuated vaccine strain MSH), and 7.11 copies / μL (MS clinical strain), respectively.

[0052] Table 3 Standard curve parameters for each fluorescent signal primer and probe

[0053] Illustration target gene slope efficiency <![CDATA[R 2 ]]> fluorescence signal Y-axis intercept Figure 3 A MG attenuated vaccine strain F-36 -3.350 98.842% 0.999 CY5 41.388 Figure 3 B MG clinical strain -3.395 97.057% 0.999 VIC 41.330 Figure 3 C MS attenuated vaccine strain MSH -3.429 95.721% 0.998 ROX 41.776 Figure 3 D MS clinical strain -3.437 95.393% 0.998 VIC 41.379

[0054] Example 4: Evaluation of the repeatability of primers and probes

[0055] Using the pMD18T recombinant plasmid as a template, it was diluted with sterile double-distilled water according to the MG attenuated live vaccine strain F-36: 8.64 × 10⁻⁶. 5 copies / μL; MG clinical strain: 9.26×10 5 copies / μL; MS attenuated vaccine strain MSH: 6.67 × 10⁻⁶ 5 copies / μL; MS clinical strain: 7.11×10 5 Copies / μL were used for inter-batch and intra-batch repeatability testing of multiplex quantitative PCR, and the results are as follows: Figure 4 As shown, Figure 3 A represents the standard curve of fluorescent labeling for the MG attenuated vaccine strain F-36 CY5. Figure 4 B represents the standard curve for FAM fluorescence labeling in the MG clinical strain. Figure 4 C represents the standard curve of MSH ROX fluorescence labeling for the MS attenuated vaccine strain. Figure 4 D represents the standard curve for VIC fluorescence labeling in the MS clinical strain. The inter-batch and intra-batch coefficients of variation for each primer and probe are shown in Table 4. The results indicate that the inter-batch and intra-batch standard deviations of this method are small, and the coefficients of variation are all less than 1%, indicating good repeatability and significant stability.

[0056] Table 4. Results of intra- and inter-batch repeatability evaluation for each fluorescent signal primer and probe.

[0057]

[0058] Example 5: Primer and probe testing for clinical samples

[0059] Clinical samples were tested using the method established in Example 1.

[0060] A total of 60 clinical samples were collected: upper respiratory tract swabs from chickens in the Guangdong region from November 2024 to January 2025.

[0061] Nucleic acid DNA was extracted from 60 chicken upper respiratory tract swabs and multiplex quantitative PCR was performed according to the method and primer-probe combination in Example 1.

[0062] Multiplex quantitative PCR results showed that among 60 samples, 40 were identified as MG attenuated vaccine strain F-36, 5 as MG clinical strains, 55 as MG attenuated vaccine strain MSH, and 0 as MS clinical strains. Furthermore, this method can simultaneously test 94 samples, and completing one test and result interpretation takes only about one hour. The calculated testing cost is approximately 1.5 yuan per sample. This indicates that the method has high detection efficiency, can effectively distinguish between MG attenuated vaccine strain F-36, MG clinical strains, MS attenuated vaccine strain MSH, and MS clinical strains, and has low testing costs, making it suitable for large-scale application.

[0063] As can be seen from the above embodiments, the specific primer-probe combination designed in this invention for the simultaneous detection of MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, and MS clinical strain has strong specificity, and is negative for all pathogens other than these four avian mycoplasmas, with a detection specificity of 100%; it has high sensitivity, reaching 8.64 copies / μL, 9.26 copies / μL, 6.67 copies / μL, and 7.11 copies / μL for these four categories, respectively; and it has significant stability, with intra-batch and inter-batch coefficients of variation all less than 1%.

[0064] The design of the probe in this invention is particularly important. The probe needs to cooperate with the primer and bind to the template before the primer. Otherwise, the DNA polymerase will not be able to cleave the probe and will not generate a fluorescent signal, resulting in detection failure. At the same time, the probe needs to ensure efficient binding to the template. Otherwise, it will not be able to bind to the template effectively, which will also result in no fluorescent signal and detection failure. Furthermore, it is necessary to ensure that there is no aggregation or mismatch between probes or between probes and primers.

[0065] This invention features a rationally selected target gene and excellent primer and probe design and combination, enabling accurate, specific, and sensitive simultaneous detection of four different avian mycoplasmas. It provides an effective detection method for understanding avian mycoplasma infection status and vaccine efficacy, exhibiting high specificity, sensitivity, and repeatability. It allows for quantitative detection of pathogens, is rapid and convenient, saving time and effort. Furthermore, it enables simultaneous quantitative detection in a single tube, quickly identifying MG, MS, and mixed infections. Combined with antibody detection, it can distinguish between current infection and vaccine-induced antibodies (effectively differentiating between vaccine strains and clinical strains), resulting in more accurate detection, better understanding of current clinical epidemiological patterns, strengthened control of avian mycoplasma, reduced morbidity, and mitigated economic losses.

[0066] pMD18T recombinant plasmid nucleotide sequence (SEQ ID NO.10):

[0067]

Claims

1. Primer and probe combination for detecting avian mycoplasma, wherein, The avian mycoplasma includes one or more of the following: MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, or MS clinical strain. The primer-probe combination consists of the sequences shown in SEQ ID NO.1-SEQ ID NO.

8. The primer sequences for MG are shown in SEQ ID NO.1 and SEQ ID NO.2, the probe sequence for MG attenuated vaccine strain F-36 is shown in SEQ ID NO.3, and the probe sequence for MG clinical strain is shown in SEQ ID NO.

4. The primer sequences for MS are shown in SEQ ID NO.5 and SEQ ID NO.6, the probe sequence for MS attenuated vaccine strain MSH is shown in SEQ ID NO.7, and the probe sequence for MS clinical strain is shown in SEQ ID NO.

8.

2. The primer-probe combination according to claim 1, wherein, The fluorescent reporter group for the probe against the MG attenuated vaccine strain F-36 is CY5, the fluorescent reporter group for the probe against the MG clinical strain is FAM, the fluorescent reporter group for the probe against the MS attenuated vaccine strain MSH is ROX, and the fluorescent reporter group for the probe against the MS clinical strain is VIC.

3. A kit that can be used to simultaneously detect different species of avian mycoplasma, among which, The kit includes the primer-probe combination as described in claim 1 or 2.

4. The kit according to claim 3, wherein, The kit also includes other reagents for enabling multiplex quantitative PCR detection.

5. The use of the primer-probe combination as described in claim 1 or 2 in the preparation of a product for detecting one or more of the following mycoplasma infections: MG attenuated vaccine strain F-36, MG clinical strain, MS attenuated vaccine strain MSH, or MS clinical strain.