Primer group, kit and distinguishing method for distinguishing radix isatidis in different regions
PCR amplification and capillary electrophoresis were performed using primer groups such as BLGP13, BLGP12, BLGP5, BLGP20 and BLGP7, and the problem of distinguishing isatis roots was solved, and the accurate determination of isatis roots was achieved, and the cultivation and variety cultivation of isatis roots was supported.
Patent Information
- Application Number
- CN202510255303.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art studies on the genetic diversity and molecular markers of isatis root are relatively limited, and it is difficult to accurately distinguish isatis roots from different regions.
A primer set is provided, including five pairs of primers, including BLGP13, BLGP12, BLGP5, BLGP20 and BLGP7, which are used to accurately distinguish isatis roots from different regions through technical means such as PCR amplification and capillary electrophoresis.
This method can accurately distinguish and determine the origin of isatis root, providing an effective molecular marking tool to support the cultivation and cultivation of isatis roots.
Smart Images

Figure CN120060540A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to a primer set, a kit and a distinguishing method for distinguishing Isatis indigotica from different regions. Background Art
[0002] Isatis indigotica is used as medicine with its root called Banlangen and leaf called Dayeqing. Isatis indigotica is a traditional Chinese medicine with functional characteristics such as antiviral, anti-inflammatory, immunomodulatory and anti-allergic. At present, the research on Isatis indigotica mainly focuses on its biological activities and active ingredients. However, the research on the genetic diversity and molecular markers of Isatis indigotica is still relatively limited. The research and classification of the genetic information of Isatis indigotica are of great significance in the cultivation and breeding of new varieties of Isatis indigotica. Summary of the Invention
[0003] In order to accurately know the origin of Isatis indigotica, the present invention provides a primer set, a kit and a distinguishing method for distinguishing Isatis indigotica from different regions.
[0004] The primer set for distinguishing Isatis indigotica from different regions of the present invention mainly consists of five pairs of primers, namely BLGP13, BLGP12, BLGP5, BLGP20 and BLGP7;
[0005] The sequence of the BLGP13 is as follows:
[0006] SEQ ID NO.25: Forward primer: CACCATTAATAGGAATGTGGCA;
[0007] SEQ ID NO.26: Reverse primer: TTTAATGCATGGTTGGCATC;
[0008] The sequence of the BLGP12 is as follows:
[0009] SEQ ID NO.23: Forward primer: ATTTCGGTGCATTGCTTTCT;
[0010] SEQ ID NO.24: Reverse primer: TAACTTCTTCGGTCTTGCCG;
[0011] The sequence of the BLGP5 is as follows:
[0012] SEQ ID NO.9: Forward primer: AGAAGGCTGCACCAAGTGTT;
[0013] SEQ ID NO.10: Reverse primer: GAGGAAGGATCCAAATGCAA;
[0014] The sequence of BLGP20 is as follows:
[0015] SEQ ID NO.39: Forward primer: TGGGAAGGAAGAAGAAGCAA;
[0016] SEQ ID NO.40: Reverse primer: TGACGACAACGACTTCAACA;
[0017] The sequence of BLGP7 is as follows:
[0018] SEQ ID NO.13: Forward primer: TCGTTCGGTTATGACGGCTCTT;
[0019] SEQ ID NO.14: Reverse primer: CGTAAGGTCCAATGGCGAATAT.
[0020] Furthermore, the primer set further includes one or more pairs of primers selected from BLGP1, BLGP2, BLGP3, BLGP4, BLGP6, BLGP8, BLGP9, BLGP10, BLGP11, BLGP14, BLGP15, BLGP16, BLGP17, BLGP18, and BLGP19.
[0021] A kit for distinguishing Isatis indigotica Fort. from different regions according to the present invention, the kit includes five pairs of primers, namely BLGP13, BLGP12, BLGP5, BLGP20, and BLGP7.
[0022] Furthermore, the kit further includes one or more pairs of primers selected from BLGP1, BLGP2, BLGP3, BLGP4, BLGP6, BLGP8, BLGP9, BLGP10, BLGP11, BLGP14, BLGP15, BLGP16, BLGP17, BLGP18, and BLGP19.
[0023] A method for distinguishing Isatis indigotica Fort. from different regions according to the present invention, the method is carried out according to the following steps:
[0024] Step 1: Extract DNA of the sample to be tested;
[0025] Step 2: PCR amplification: Amplify the DNA of the sample to be tested with five pairs of primers, namely BLGP13, BLGP12, BLGP5, BLGP20, and BLGP7;
[0026] The PCR reaction system is as follows:
[0027]
[0028] The PCR reaction program is as follows:
[0029]
[0030] Step 3: Capillary electrophoresis;
[0031] Step 4: Data comparison: The amplification product of the sample to be tested is compared with Figure 1 If the sizes and presence / absence of the band fragments are consistent, it is the Radix Isatidis of this production area.
[0032] Furthermore, in Step 2, one or more pairs of primers from BLGP1, BLGP2, BLGP3, BLGP4, BLGP6, BLGP8, BLGP9, BLGP10, BLGP11, BLGP14, BLGP15, BLGP16, BLGP17, BLGP18, and BLGP19 are used to amplify the DNA of the sample to be tested.
[0033] Furthermore, in Step 3 of capillary electrophoresis:
[0034] 3.1 Take a 96-well reaction plate and label the detection information;
[0035] 3.2 Make an electronic STR detection form and automatically generate a loading form;
[0036] 3.3 Use a continuous pipettor to aspirate a mixture of 990 μl of HIDI (highly deionized formamide) and 10 μl of LIZ500 (LIZ-500 molecular weight internal standard) and add 10 μl to each well of the 96-well reaction plate;
[0037] 3.4 Place the 96-well plate in a plate centrifuge and centrifuge at 1200 rmp for 15 s;
[0038] 3.5 Use a 10 μL multichannel pipette and add 1 μL of the amplification product from Step 2 to the corresponding wells of the 96-well plate with reference to the STR detection form;
[0039] 3.6 Place the 96-well plate in a plate centrifuge and centrifuge at 1200 rmp for 15 s;
[0040] 3.7 Seal the 96-well plate with a sealing film, shake it, and place the 96-well plate in a plate centrifuge and centrifuge at 1200 rmp for 30 s.
[0041] Place it in a PCR instrument;
[0042] 3.8 The denaturation program is 98 °C for 5 min, without heating the hot lid. Immediately after the program ends, place the 96-well plate on an ice-water mixture for rapid cooling;
[0043] 3.9 Place the 96-well plate in a plate centrifuge and centrifuge at 1200 rmp for 15 s;
[0044] 3.10 Use the sequencer 3730xl device to detect STR samples.
[0045] Further, after capillary electrophoresis in step three, fluorescence detection is performed.
[0046] The present invention can accurately distinguish and determine the origin of Isatis indigotica Fort. only by using five pairs of primers, namely BLGP13, BLGP12, BLGP5, BLGP20, and BLGP7. Description of the Drawings
[0047] Figure 1 It is a corresponding diagram of the amplified bands of primers (BLGP13, BLGP12, BLGP5, BLGP20, and BLGP7) of Isatis indigotica Fort. from different origins;
[0048] Figures 2 - 5 It is a capillary gel electrophoresis result diagram of the amplified products of BLG-P20 in 29 Isatis indigotica Fort. materials in Example 1.
[0049] Figure 6 It is a schematic diagram of the genetic distance calculation results of 29 Isatis indigotica Fort. samples using the popgene32 software in Example 1;
[0050] Figure 7 It is a dendrogram drawn by the unweighted pair group method with arithmetic mean (UPGMA) for 29 Isatis indigotica Fort. samples based on the genetic distance using NTSYS2.10 in Example 1;
[0051] Figure 8 It is a dendrogram drawn by the unweighted pair group method with arithmetic mean (UPGMA) for 29 Isatis indigotica Fort. samples based on the genetic similarity coefficient using NTSYS2.10 in Example 1. Detailed Embodiments
[0052] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0053] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other.
[0054] Detailed Embodiment 1: This embodiment is used for a primer set to distinguish Isatis indigotica Fort. from different regions. This primer set mainly consists of five pairs of primers, namely BLGP13, BLGP12, BLGP5, BLGP20, and BLGP7;
[0055] The sequence of the said BLGP13 is:
[0056] SEQ ID NO.25: Forward primer: CACCATTAATAGGAATGTGGCA;
[0057] SEQ ID NO.26: Reverse primer: TTTAATGCATGGTTGGCATC;
[0058] The sequence of the said BLGP12 is:
[0059] SEQ ID NO.23: Forward primer: ATTTCGGTGCATTGCTTTCT;
[0060] SEQ ID NO.24: Reverse primer: TAACTTCTTCGGTCTTGCCG;
[0061] The sequence of the said BLGP5 is:
[0062] SEQ ID NO.9: Forward primer: AGAAGGCTGCACCAAGTGTT;
[0063] SEQ ID NO.10: Reverse primer: GAGGAAGGATCCAAATGCAA;
[0064] The sequence of the said BLGP20 is:
[0065] SEQ ID NO.39: Forward primer: TGGGAAGGAAGAAGAAGCAA;
[0066] SEQ ID NO.40: Reverse primer: TGACGACAACGACTTCAACA;
[0067] The sequence of the said BLGP7 is:
[0068] SEQ ID NO.13: Forward primer: TCGTTCGGTTATGACGGCTCTT;
[0069] SEQ ID NO.14: Reverse primer: CGTAAGGTCCAATGGCGAATAT.
[0070] Specific Embodiment 2: The difference between this embodiment and Specific Embodiment 1 is that: This primer set further includes one or more pairs of primers among BLGP1, BLGP2, BLGP3, BLGP4, BLGP6, BLGP8, BLGP9, BLGP10, BLGP11, BLGP14, BLGP15, BLGP16, BLGP17, BLGP18 and BLGP19;
[0071] The sequence of the said BLGP1 is as follows:
[0072] SEQ ID NO.1: Forward primer: TCTCTTGATTCTTTTTGACGGA;
[0073] SEQ ID NO.2: Reverse primer: TCGTTTCCTGTTCCCTTTTG;
[0074] The sequence of the said BLGP2 is as follows:
[0075] SEQ ID NO.3: Forward primer: GTGTTTGTGTTTCCCCCATC;
[0076] SEQ ID NO.4: Reverse primer: GAAAAACGGTGCCACAATCT;
[0077] The sequence of the said BLGP3 is as follows:
[0078] SEQ ID NO.5: Forward primer: CGAATTTACCACGAACCGAT;
[0079] SEQ ID NO.6: Reverse primer: GAAAACGGTGGCATGTCTCT;
[0080] The sequence of the said BLGP4 is as follows:
[0081] SEQ ID NO.7: Forward primer: CAAGCACAAGTGGTCCAAAA;
[0082] SEQ ID NO.8: Reverse primer: GCTTGGTTTTCAACATGAGG;
[0083] The sequence of the said BLGP6 is as follows:
[0084] SEQ ID NO.11: Forward primer: CTTCCCATTTAGCGAACCAA;
[0085] SEQ ID NO.12: Reverse primer: CTTCCGGTTCGATTTTTCAA;
[0086] The sequence of the said BLGP8 is as follows:
[0087] SEQ ID NO.15: Forward primer: CTCCAAGACCATCTTCCCAA;
[0088] SEQ ID NO.16: Reverse primer: TGGGAAAAAGACAGGCAATC;
[0089] The sequence of BLGP9 is as follows:
[0090] SEQ ID NO.17: Forward primer: ACTCTCAGGGCAGCGACAGAAA; SEQ ID NO.18: Reverse primer: TCTCCCACCACCACCACAAATA;
[0091] The sequence of BLGP10 is as follows:
[0092] SEQ ID NO.19: Forward primer: TTCGATTATTGGGCGAAGTT;
[0093] SEQ ID NO.20: Reverse primer: TAGCCACACCGAGATCAAGA;
[0094] The sequence of BLGP11 is as follows:
[0095] SEQ ID NO.21: Forward primer: TAAACCGTCGCAACAGAGAC;
[0096] SEQ ID NO.22: Reverse primer: ACCTGCCATTGCCTAACAAG;
[0097] The sequence of BLGP14 is as follows:
[0098] SEQ ID NO.27: Forward primer: TGGAGCAAGAAGAGAGGTTAGG; SEQ ID NO.28: Reverse primer: TTTGAAGCTCTGCAGGGAAAGT;
[0099] The sequence of BLGP15 is as follows:
[0100] SEQ ID NO.29: Forward primer: TGAGCATGCGAATCAAACTC;
[0101] SEQ ID NO.30: Reverse primer: CGAATTGGGGAGATATTGGA;
[0102] The sequence of BLGP16 is as follows:
[0103] SEQ ID NO.31: Forward primer: GACATTTCCACCAGCAAGGT;
[0104] SEQ ID NO.32: Reverse primer: AAGTGCTAGTTGGAAGCCGA;
[0105] The sequence of BLGP17 is as follows:
[0106] SEQ ID NO.33: Forward primer: CAAACCACCACCGGACCACTAT;
[0107] SEQ ID NO.34: Reverse primer: GCCTCTCCATCCTCGTCGTATT;
[0108] The sequence of said BLGP18 is:
[0109] SEQ ID NO.35: Forward primer: TCCCCTTCTTTCTTCTATTGC;
[0110] SEQ ID NO.36: Reverse primer: TCTCCGCCATAGATTTCTGC;
[0111] The sequence of said BLGP19 is:
[0112] SEQ ID NO.37: Forward primer: TATGTAGCCATCCCTGCCTC;
[0113] SEQ ID NO.38: Reverse primer: ATGGCGTCAATGACATACCA. Others are the same as in Embodiment 1.
[0114] Example 1
[0115] Experiment:
[0116] I. The samples submitted for inspection are tissues or organs such as roots, leaves of Isatis indigotica Fort. seedlings from different production areas. For each sample, take leaves or other equivalents (300 mg - 400 mg, leaf area not less than 1 square centimeter) of individuals not less than 100 mg, and grind and mix the same-sized tissues taken from each individual. The plant genome is extracted by the CTAB method. Specifically: Take about 100 - 150 mg of the pulverized and mixed sample and place it in a 2.0 mL centrifuge tube, add liquid nitrogen and grind thoroughly. Add 700 μL of CTAB extraction solution preheated at 65°C to each tube, mix well, and incubate in a water bath at 65°C for 30 min. During this period, gently invert and mix. Add an equal volume of chloroform / isoamyl alcohol mixture to each tube, mix well and let stand for 10 min, then centrifuge at 10,000 rpm for 10 min. Pipette the supernatant and transfer it to a new centrifuge tube, add an equal volume of pre-cooled isopropanol, gently invert and mix, place at -20°C for 60 min, centrifuge at 4°C and 10,000 rpm for 10 min, discard the supernatant, add 70% ethanol solution to wash twice, dry under natural conditions, and add 200 μL of ddH 2 O to dissolve completely, detect the concentration, and dilute the DNA to 20 ng / μL for standby. The ultraviolet absorbance OD of the DNA solution 260 and OD 280The ratio should preferably be between 1.7 and 2.0.
[0117] Step 2: PCR amplification: Use primers BLGP13, BLGP12, BLGP5, BLGP20, BLGP1, BLGP2, BLGP3, BLGP4, BLGP6, BLGP8, BLGP9, BLGP10, BLGP11, BLGP14, BLGP15, BLGP16, BLGP17, BLGP18, BLGP19, and BLGP7 to amplify the DNA of the submitted sample respectively;
[0118] The PCR reaction system is as follows:
[0119]
[0120]
[0121] The PCR reaction program is as follows:
[0122] Procedure Temperature Time Pre - denaturation 95℃ 5 min Denaturation 94℃ 30 sec Annealing 60℃-0.5 / C 30 sec Extension 72℃ 30 sec Cycles 2 - 4 10 cycles Denaturation 94℃ 30 sec Annealing 55℃ 30 sec Extension 72℃ 30 sec Cycles 6 - 8 30 cycles Repair extension 72℃ 10 min
[0123] Step 3: Capillary electrophoresis:
[0124] 3.1 Take a 96-well reaction plate and mark the detection information;
[0125] 3.2 Make an electronic STR detection form and automatically generate a sample loading form;
[0126] 3.3 Use a continuous pipettor to aspirate a mixture of 990 μl of HIDI (highly deionized formamide) and 10 μl of LIZ500 (LIZ-500 molecular weight internal standard) and add 10 μl to each well of the 96-well reaction plate;
[0127] 3.4 Place the 96-well plate in a tabletop centrifuge and centrifuge at 1200 rmp for 15 s;
[0128] 3.5 Use a 10 μL multi-channel pipette to add 1 μL of the amplification product from Step 2 to the corresponding wells of the 96-well plate with reference to the STR detection form;
[0129] 3.6 Place the 96-well plate in a tabletop centrifuge and centrifuge at 1200 rmp for 15 s;
[0130] 3.7 Seal the 96-well plate with a sealing film, shake it, and place the 96-well plate in a tabletop centrifuge and centrifuge at 1200 rmp for 30 s.
[0131] Place it in a PCR instrument;
[0132] 3.8 The denaturation program is 98 °C for 5 min, without heating the hot lid. Immediately after the program ends, place the 96-well plate on an ice-water mixture for rapid cooling;
[0133] 3.9 Place the 96-well plate in a tabletop centrifuge and centrifuge at 1200 rmp for 15 s;
[0134] 3.10 Detect STR samples using the 3730xl sequencer.
[0135] Experimental data record:
[0136] The submitted samples and the standard varieties were analyzed by electrophoresis together and the allelic variations were recorded. The genotype data of only 1 highest peak allelic variation was recorded as X / X, where X is the size of the allelic variation at this locus; the genotype data of 2 highest peak allelic variations was recorded as X / Y, where X and Y are two different allelic variations at this locus; the genotype data of 3 highest peak allelic variations was recorded as X / Y / Z, where X, Y, and Z are three different allelic variations at this locus. The genotype data of 4 highest peak allelic variations was recorded as X / Y / Z / A, where X, Y, Z, and A are four different allelic variations at this locus. And so on, with the small fragment data in the front and the large fragment data in the back. The allelic variation data of the missing locus was recorded as 0 / 0. After counting the bands, the PopGen32 software was used to perform statistics and analysis on the diversity of the Isatis indigotica Fort. population, and genetic analysis such as genetic distance and genetic identity clustering analysis was carried out.
[0137] The numbers and codes of the submitted samples are shown in Table 1.
[0138] Table 1
[0139] Variety Origin Experiment number Experiment code Isatis root Gannan, Heilongjiang 7 HLJDXALSa Isatis root Suqian, Jiangsu 8 JSSQS Small - leaf Isatis root Yunnan 9 YNHHSa Isatis root Weifang, Shandong 10 SDWFS Isatis root Henan 11 HNXYL Isatis root Huai'an, Jiangsu 12 JSHAS Isatis root Minle, Gansu 13 GSZYYLS Isatis root Lanzhou, Gansu 14 GSLZS Isatis root Bozhou, Anhui 15 AHBZS Large - leaf Isatis root Yunnan 16 YNHHSb Wild Isatis root Dumont County, Heilongjiang 17 HLJDBS Large - leaf Isatis root Shanxi 18 SXYCS Small - leaf Isatis root Shanxi 19 SXLLS Wild Isatis root Heilongjiang 20 HLJDXALSb Large - leaf Isatis root Hebei 21 HBHSL Small - leaf Isatis root Hebei 22 HBBDS Large - leaf Isatis root Zhangye, Gansu 23 GSZYSBL Small - leaf Isatis root Zhangye, Gansu 24 GSZYSBS Large - leaf Isatis root Datong, Daqing 25 HLJDQL Small - leaf Isatis root Datong, Daqing 26 HLJDQS Large - leaf Isatis root Yizhou, Shanxi 27 SXXZL Small - leaf Isatis root Yizhou, Shanxi 28 SXXZS Isatis root Xingning, Guangdong 29 GDXNL Large - leaf Isatis root Dingxi, Jiangsu 30 GSDXLa Small - leaf Isatis root Dingxi, Jiangsu 31 GSDXLb Two - year Isatis root Minle, Gansu 32 GSZYYLS2 Three - year Isatis root Minle, Gansu 33 GSZYYLS3 South Isatis root National drug standard substance C4 BNIFDC Isatis root National drug standard substance C5 INIFDCS
[0140] The information of the primer pairs used in this experiment is shown in Table 2.
[0141]
[0142]
[0143] Table 2
[0144] In this experiment, 29 Isatis indigotica Fort. materials submitted for inspection were amplified, and the products were detected by capillary gel electrophoresis, and the polymorphic bands were counted and calculated (among them, the capillary gel electrophoresis results of the amplification products of BLG-P20 in 29 Isatis indigotica Fort. materials are as Figures 2 - 5 shown).
[0145] In this experiment, 20 pairs of SSR primers were used to amplify 29 Isatis indigotica Fort. materials respectively. The amplified fragments of each primer ranged from 105 bp of BLG-P1 to 315 bp of BLG-P19. The number of polymorphic loci of the 20 pairs of primers was between 2 and 11, with an average of 5. Among them, the primer BLGP13 had the most amplified bands, which was 11 (as shown in Table 3). The observed number of alleles (Na) was between 2 and 11, with an average of 5; the effective number of alleles (Ne) was between 1.2025 and 1.7, with an average of 2.3280; the polymorphism information index (PIC) of the primers was between 0.1648 and 0.8415, with an average of 0.4654. Among them, BLGP13 had the highest PIC value, and the PIC value of BLGP1 was the lowest; Shannon's (I) was between 0.4198 and 2.1104, with an average of 0.9787.
[0146] Table 3
[0147]
[0148]
[0149] Note: na: Observed number of alleles; ne: Effective number of alleles [Kimura and Crow (1964)] In an ideal population (where all allele frequencies are equal), the number of alleles required to produce the same homozygosity at a locus as in the actual population; it is equal to the reciprocal of the homozygosity of the actual population. I: Shannon's Information index [Lewontin (1972)] The more species there are in a community and the more evenly the individuals of various species are distributed, the higher the index, indicating good community diversity.
[0150] The homozygosity and heterozygosity of the Isatis indigotica Fort. populations of different submitted samples were calculated, and the statistics are shown in Table 4. The average heterozygosity was 0.213. Among them, BLGP5 had the highest heterozygosity, with a value of 0.4138; BLGP1 and BLGP16 had the lowest heterozygosity, both being 0.069.
[0151] Table 4
[0152]
[0153]
[0154] Note: Obs_Hom: Observed homozygosity
[0155] Obs_Het: Observed heterozygosity
[0156] Exp_Hom*: Expected homozygosity
[0157] Exp_Het*: Expected heterozygosity
[0158] Nei**: Nei's expected heterozygosity
[0159] Ave_Het: Average heterozygosity
[0160] Homozygosity: The proportion of samples with homozygous alleles in the total samples
[0161] Heterozygosity: The proportion of samples with heterozygous alleles in the total samples
[0162] Expected heterozygosity (Nei): Calculated according to the formula provided by Nei (1978): nHe = 1 - ∑pi^2, where pi is the frequency of the i-th allelic form, also known as unbiased heterozygosity.
[0163] The F-index in the observed population of Radix Isatidis samples submitted for inspection is statistically shown in Table 5.
[0164] Table 5
[0165]
[0166]
[0167] Note: The F statistic, FIS, is the ratio of the reduction of HI (the average frequency of observed heterozygotes in the whole population) relative to HS (the average expected frequency of heterozygotes in the local population assuming it is an ideal population), that is, the average inbreeding coefficient of the local population.
[0168] The genetic distances were calculated using the popgene32 software (as Figure 6 shown). The genetic distances of 29 Radix Isatidis varieties ranged from 0.0389 to 0.9269, with an average of 0.5453, indicating that there were significant differences in the genetic backgrounds of the detected Radix Isatidis varieties. The closest genetic distances were between No. 30 and No. 29 Radix Isatidis (0.0389), followed by between No. 30 and No. 11 Radix Isatidis (0.0395); the largest genetic distance was between No. 23 and No. 21 materials (0.9269), followed by between No. 29 and No. 23 materials (0.9122); the standard materials C4 and C5 were closest to No. 30 material (0.1826 and 0.1789 respectively).
[0169] Using NTSYS2.10, the unweighted pair-group method with arithmetic means (UPGMA) was performed based on genetic distances and genetic similarity coefficients and a dendrogram was drawn, as Figure 7 and Figure 8 shown. From the perspective of genetic distances, among the 29 Radix Isatidis samples, No. 30 was independent of other materials, and the remaining materials could be roughly divided into 6 subcategories.
[0170] Through the readability and stability of 20 pairs of fluorescently labeled primers in capillary electrophoresis, combined with factors such as the number of polymorphic loci, peak numbers, and percentages of polymorphic loci of the fluorescently labeled SSR primers (as shown in Table 6), the 29 tested Isatis indigotica Fort. materials from different origins can be completely distinguished by using the five primer combinations of BLGP13, BLGP12, BLGP5, BLGP20, and BLGP7.
[0171] Table 6
[0172]
[0173]
[0174] Example 2
[0175] Select Isatis indigotica Fort. samples from different origins (the origins and varieties listed in Table 1), and detect them using the method of the present invention, repeating three times:
[0176] I. Extraction of DNA from samples to be tested: For each sample, take leaves or other equivalents of not less than 100 mg of an individual (300 mg - 400 mg, with a leaf area of not less than 1 square centimeter), and grind and mix the same-sized tissues taken from each individual. The plant genome is extracted by the CTAB method. Specifically: Take about 100 - 150 mg of the pulverized and mixed sample and place it in a 2.0 mL centrifuge tube, add liquid nitrogen and grind thoroughly. Add 700 μL of CTAB extraction solution preheated to 65 °C to each tube, mix well, and incubate in a water bath at 65 °C for 30 min. During this period, gently invert and mix. Add an equal volume of chloroform / isoamyl alcohol mixture to each tube, mix well, and let stand for 10 min, then centrifuge at 10,000 rpm for 10 min. Aspirate the supernatant and transfer it to a new centrifuge tube, add an equal volume of pre-cooled isopropanol, gently invert and mix, place at -20 °C for 60 min, centrifuge at 4 °C and 10,000 rpm for 10 min, discard the supernatant, wash twice with 70% ethanol solution, dry under natural conditions, and add 200 μL of ddH 2 O to dissolve completely, detect the concentration, and dilute the DNA to 20 ng / μL for standby. The ratio of the ultraviolet absorbance OD 260 of the DNA solution to OD 280 should preferably be between 1.7 and 2.0.
[0177] Step 2. PCR amplification: Use the five primer pairs of BLGP13, BLGP12, BLGP5, and BLGP20 to amplify the DNA of the submitted samples respectively;
[0178] The PCR reaction system is:
[0179]
[0180] The PCR reaction program is:
[0181] Procedure Temperature Time Pre - denaturation 95℃ 5 min Denaturation 94℃ 30 sec Annealing 60℃-0.5 / C 30 sec Extension 72℃ 30 sec Cycles 2 - 4 10 cycles Denaturation 94℃ 30 sec Annealing 55℃ 30 sec Extension 72℃ 30 sec Cycles 6 - 8 30 cycles Repair extension 72℃ 10 min
[0182] Step 3: Capillary electrophoresis:
[0183] 3.1 Take a 96-well reaction plate and label the detection information;
[0184] 3.2 Make an electronic STR detection form and automatically generate a sample loading form;
[0185] 3.3 Use a continuous pipettor to aspirate a mixture of 990 μl of HIDI (highly deionized formamide) and 10 μl of LIZ500 (LIZ-500 molecular weight internal standard), and add 10 μl to each well of the 96-well reaction plate;
[0186] 3.4 Place the 96-well plate in a plate centrifuge and centrifuge at 1200 rmp for 15 s;
[0187] 3.5 Use a 10 μL multi-channel pipette to add 1 μL of the amplification product from Step 2 to the corresponding wells of the 96-well plate according to the STR detection form;
[0188] 3.6 Place the 96-well plate in a plate centrifuge and centrifuge at 1200 rmp for 15 s;
[0189] 3.7 Seal the 96-well plate with a sealing film, shake it, and place the 96-well plate in a plate centrifuge and centrifuge at 1200 rmp for 30 s.
[0190] Place it in a PCR instrument;
[0191] 3.8 The denaturation program is 98 °C for 5 min, without heating the hot lid. Immediately after the program ends, place the 96-well plate on an ice-water mixture for rapid cooling;
[0192] 3.9 Place the 96-well plate in a plate centrifuge and centrifuge at 1200 rmp for 15 s;
[0193] 3.10 Use a 3730xl sequencer to detect the STR sample.
[0194] Step 4: Data comparison: The amplification product of the submitted sample is compared with Figure 1 If the sizes and presence / absence of the band fragments are consistent, then it is the radix isatidis of this production area.
[0195] The STR detection form shows that the detection result is completely consistent with the actual production area variety of the sample to be tested, indicating that the discrimination method of the present invention can accurately and reliably obtain the production area of the radix isatidis sample.
Claims
1. A primer set for distinguishing Radix Isatidis from different regions, characterized in that: The primer set mainly consists of five pairs of primers: BLGP13, BLGP12, BLGP5, BLGP20 and BLGP7; The sequence of BLGP13 is: SEQ ID NO.25: Forward primer: CACCATTAATAGGAATGTGGCA; SEQ ID NO.26: Reverse primer: TTTAATGCATGGTTGGCATC; The sequence of BLGP12 is: SEQ ID NO.23: Forward primer: ATTTCGGTGCATTGCTTTCT; SEQ ID NO.24: Reverse primer: TAACTTCTTCGGTCTTGCCG; The sequence of BLGP5 is: SEQ ID NO.9: Forward primer: AGAAGGCTGCACCAAGTGTT; SEQ ID NO.10: Reverse primer: GAGGAAGGATCCAAATGCAA; The sequence of BLGP20 is: SEQ ID NO.39: Forward primer: TGGGAAGGAAGAAGAAGCAA; SEQ ID NO.40: Reverse primer: TGACGACAACGACTTCAACA; The sequence of BLGP7 is: SEQ ID NO.13: Forward primer: TCGTTCGGTTATGACGGCTCTT; SEQ ID NO.14: Reverse primer: CGTAAGGTCCAATGGCGAATAT.
2. The primer set for distinguishing Radix Isatidis from different regions according to claim 1, characterized in that: The primer set also includes one or more pairs of primers selected from BLGP1, BLGP2, BLGP3, BLGP4, BLGP6, BLGP8, BLGP9, BLGP10, BLGP11, BLGP14, BLGP15, BLGP16, BLGP17, BLGP18, and BLGP19; The sequence of the BLGP1 is: SEQ ID NO.1: Forward primer: TCTCTTGATTCTTTTTGACGGA; SEQ ID NO.2: Reverse primer: TCGTTTCCTGTTCCCTTTTG; The sequence of BLGP2 is: SEQ ID NO.3: Forward primer: GTGTTTGTGTTTCCCCCATC; SEQ ID NO.4: Reverse primer: GAAAAACGGTGCCACAATCT; The sequence of BLGP3 is: SEQ ID NO.5: Forward primer: CGAATTTACCACGAACCGAT; SEQ ID NO.6: Reverse primer: GAAAAACGGTGGCATGTCTCT; The sequence of BLGP4 is: SEQ ID NO.7: Forward primer: CAAGCACAAGTGGTCCAAAA; SEQ ID NO.8: Reverse primer: GCTTGGTTTTCAACATGAGG; The sequence of BLGP6 is: SEQ ID NO.11: Forward primer: CTTCCCATTTAGCGAACCAA; SEQ ID NO.12: Reverse primer: CTTCCGGTTCGATTTTTCAA; The sequence of BLGP8 is: SEQ ID NO.15: Forward primer: CTCCAAGACCATCTTCCCAA; SEQ ID NO.16: Reverse primer: TGGGAAAAAGACAGGCAATC; The sequence of BLGP9 is: SEQ ID NO.17: forward primer: ACTCTCAGGGCAGCGACAGAAA; SEQ ID NO.18: reverse primer: TCTCCCACCACCACCACAAATA; The sequence of BLGP10 is: SEQ ID NO.19: Forward primer: TTCGATTATTGGGCGAAGTT; SEQ ID NO.20: Reverse primer: TAGCCACACCGAGATCAAGA; The sequence of BLGP11 is: SEQ ID NO.21: forward primer: TAAACCGTCGCAACAGAGAC; SEQ ID NO.22: reverse primer: ACCTGCCATTGCCTAACAAG; The sequence of BLGP14 is: SEQ ID NO.27: forward primer: TGGAGCAAGAAGAGAGGTTAGG; SEQ ID NO.28: reverse primer: TTTGAAGCTCTGCAGGGAAAGT; The sequence of BLGP15 is: SEQ ID NO.29: forward primer: TGAGCATGCGAATCAAACTC; SEQ ID NO.30: reverse primer: CGAATTGGGGAGATATTGGA; The sequence of BLGP16 is: SEQ ID NO.31: forward primer: GACATTTCCACCAGCAAGGT; SEQ ID NO.32: reverse primer: AAGTGCTAGTTGGAAGCCGA; The sequence of BLGP17 is: SEQ ID NO.33: forward primer: CAAACCACCACCGGACCACTAT; SEQ ID NO.34: reverse primer: GCCTCTCCATCCTCGTCGTATT; The sequence of BLGP18 is: SEQ ID NO.35: Forward primer: TCCCCTTCTTTCTTCTATTGC; SEQ ID NO.36: Reverse primer: TCTCCGCCATAGATTTCTGC; The sequence of BLGP19 is: SEQ ID NO.37: Forward primer: TATGTAGCCATCCCTGCCTC; SEQ ID NO.38: Reverse primer: ATGGCGTCAATGACATACCA.
3. A kit for distinguishing Radix Isatidis from different regions, characterized in that: The kit includes five pairs of primers: BLGP13, BLGP12, BLGP5, BLGP20 and BLGP7.
4. The kit for distinguishing Radix Isatidis from different regions according to claim 3, characterized in that: The kit also includes one or more pairs of primers selected from BLGP1, BLGP2, BLGP3, BLGP4, BLGP6, BLGP8, BLGP9, BLGP10, BLGP11, BLGP14, BLGP15, BLGP16, BLGP17, BLGP18 and BLGP19.
5. A method for distinguishing Radix Isatidis from different regions, characterized in that: The method proceeds as follows: Step 1: DNA extraction of samples to be tested; Step 2, PCR amplification: amplify the DNA of the sample to be tested using five pairs of primers: BLGP13, BLGP12, BLGP5, BLGP20 and BLGP7; The PCR reaction system is: The PCR reaction program is: Step 3, capillary electrophoresis; Step 4, data comparison: compare the amplified product of the sample to be tested with Figure 1. If the size of the band fragment and the band are consistent, it is the indigo root of this product.
6. The method for distinguishing Radix Isatidis from different regions according to claim 5, characterized in that: In step 2, one or more pairs of primers selected from BLGP1, BLGP2, BLGP3, BLGP4, BLGP6, BLGP8, BLGP9, BLGP10, BLGP11, BLGP14, BLGP15, BLGP16, BLGP17, BLGP18 and BLGP19 are used to amplify the DNA of the sample to be tested.
7. The method for distinguishing Radix Isatidis from different regions according to claim 5 or 6, characterized in that: Step 3: Capillary electrophoresis: 3.1 Take a 96-well reaction plate and mark the detection information; 3.2 Prepare an electronic version of the STR test form and automatically generate the table for loading; 3.3 Use a continuous pipette to pipette a mixture of 990 μl HIDI and 10 μl LIZ500 into a 96-well reaction plate, 10 μl per well; 3.4 Place the 96-well plate in a plate centrifuge and centrifuge at 1200 rpm for 15 seconds; 3.5 Use a 10 μL dispenser to add 1 μL of the amplified product from step 2 to the corresponding wells of the 96-well plate according to the STR test table; 3.6 Place the 96-well plate in a plate centrifuge and centrifuge at 1200 rpm for 15 seconds; 3.7 Seal the 96-well plate with a sealing film, shake, place the 96-well plate in a plate centrifuge, and centrifuge at 1200 rpm for 30 seconds. Place in a PCR instrument; 3.8 The denaturation program is 98°C for 5 min without heating the hot cover. After the program is completed, the 96-well plate is immediately placed on an ice-water mixture to rapidly cool down; 3.9 Place the 96-well plate in a plate centrifuge and centrifuge at 1200 rpm for 15 seconds; 3.10 Detect STR samples using the sequencer 3730xl device.