Tin dioxide transistor biosensor, preparation method thereof and cortisol concentration detection method

By forming a tin dioxide thin film layer on the transistor channel surface and covering the polymethyl methacrylate material layer, the problem of complex and low sensitivity of cortisol detection methods in the prior art is solved, and fast, accurate and low-cost cortisol concentration detection is achieved.

CN120064403APending Publication Date: 2025-05-30HUBEI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510166827.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-14
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

The prior art has problems in the detection of cortisol concentrations, the detection method is expensive and the sensitivity is low. Especially in aqueous solution environments, traditional methods are difficult to achieve rapid, non-invasive, and low-cost quantitative detection.

Method used

A tin dioxide transistor biosensor is used to form a thin film layer of tin dioxide on the surface of the transistor channel and cover a polymethyl methacrylate material layer with partial ester-based ester hydrolyzed into carboxylic groups on its surface to form an activation interface for carboxylic acid functionalization, thereby improving the specificity and sensitivity of the sensor.

Benefits of technology

Fast, accurate and quantitative detection of cortisol concentrations is achieved, with detection limits as low as fg/mL, and is highly selective and specific in complex biological samples, suitable for the detection of saliva, urine and blood.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120064403A_ABST
    Figure CN120064403A_ABST
Patent Text Reader

Abstract

The invention provides a tin dioxide transistor biosensor, a preparation method thereof and a cortisol concentration detection method. According to the tin dioxide transistor biosensor, the tin dioxide thin film layer is used as a channel material of the transistor to establish the activation layer; a channel is functionalized by using the PMMAA material layer to form a carboxylic acid functionalized activated interface, and meanwhile, the biocompatibility of the interface can be increased, the tin dioxide film is protected from being invaded and disturbed by the external environment, and the specificity and sensitivity of the tin dioxide transistor are improved; and after the target substance is tested on the tin dioxide thin film transistor, the recycled tin dioxide thin film transistor can be obtained again by washing off the PMMAA material layer on the tin dioxide thin film layer. According to the cortisol concentration detection method disclosed by the invention, along with the change of the concentration of the target substance cortisol, the cortisol concentration detection method has good linearity at 1-106pg / mL, and the detection limit is as low as fg / mL level.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of transistor biosensing, and particularly to a tin dioxide transistor biosensor, a preparation method thereof, and a cortisol concentration detection method. Background Art

[0002] Cortisol is a steroid hormone mainly secreted by the adrenal cortex, commonly known as the "stress hormone". Its level increases during stress or crisis, helping to regulate the stress response, and it is closely related to Cushing's syndrome and Addison's disease. In daily life, exercise significantly affects cortisol levels: short-term high-intensity exercise can lead to a significant increase in cortisol, while regular moderate exercise helps to lower the cortisol baseline level and improve the stress response.

[0003] In addition, the cortisol content level in the human body can fluctuate significantly in response to psychological and physiological stress in a short period of time. Therefore, it is crucial to develop a general, rapid, non-invasive, and low-cost quantitative detection device and method. Currently, in clinical and commercial settings, the detection of cortisol concentration mainly relies on the analysis of human blood samples using traditional methods such as enzyme-linked immunosorbent assay (ELISA) and colorimetry. However, these methods face various limitations including sample collection. For example, ELISA is costly and has complex operating procedures. Colorimetry has problems such as insufficient specificity, low sensitivity, and difficulty in quantification.

[0004] In recent years, the newly developed field-effect transistor (FET) sensor, a type of novel sensor, can operate stably in an aqueous solution environment at low voltage, and has characteristics such as a simple structure, good biocompatibility, easy miniaturization, fast response speed, and inherent signal amplification. By modifying the channel surface or gate surface of the FET and then biofunctionalizing it, when a specific target is captured, the channel current of the device will change significantly. This gives it a great advantage in solving the problems of low sensitivity and narrow detection range in biomolecule detection. For this type of sensor device that indirectly changes the channel current by specifically capturing the target substance, the electrical signal is amplified due to the applied gate voltage, and the sensitivity of the device is greatly improved. At the same time, recent scientific research has shown that field-effect transistor (FET) biosensors have been able to accurately determine the cortisol content in human saliva. Compared with conventional colorimetry, FET biosensors have obvious advantages, including fast response time, high sensitivity, versatility, easy integration, and simple operation. These characteristics make field-effect transistor biosensors particularly suitable for detecting and monitoring complex biological systems. Therefore, FET can be used as a promising biosensor for the specific, rapid, and quantitative detection of salivary cortisol.

[0005] For the application of electrochemical field-effect transistor sensors, the sensing channel is crucial. Compared with inorganic semiconductor materials, organic semiconductor materials possess excellent mechanical compliance, easier solution processability, and intrinsic stretchability that can be improved through molecular design. Therefore, they have attracted extensive attention in flexible electronics in recent years. However, the unique advantages of inorganic semiconductors are also irreplaceable for organic semiconductors. The high carrier mobility of inorganic semiconductors means that electrons or holes can move quickly within the transistor, enabling it to provide stable performance during high-speed operation. Thus, inorganic semiconductor devices and circuits feature fast response, signal amplification, multifunctionality, and fault tolerance. This makes inorganic semiconductor devices an ideal choice for detecting and monitoring complex biological systems. Various one-dimensional, two-dimensional, and three-dimensional nanomaterials, such as silicon nanowires, carbon nanotubes, nanoribbons, nanosheets, and two-dimensional materials like graphene and molybdenum disulfide, have been applied to transistors. Although these inorganic nanostructure field-effect transistors exhibit high sensitivity, one of the most significant challenges in their production and application is the large device-to-device variability and complex process integration. For example, due to their excellent properties, two-dimensional semiconductor materials are one of the research focuses in the field of field-effect transistor sensors currently. However, the inherent phase properties of these two-dimensional semiconductor materials (graphene, molybdenum disulfide, and black phosphorus) limit the further development of such sensors. For instance, the semi-metallic property (zero bandgap), low on / off ratio, and difficulty in large-scale industrial preparation of graphene restrict its sensing applications, and MoS 2 has a suitable direct bandgap (1.8 eV), but there are also problems in large-scale preparation, and the internal noise is relatively high; black phosphorus has a suitable bandgap and high carrier mobility, but its instability in air and water limits its practical applications. Therefore, exploring stable and effective sensing channel materials is of great significance for improving the sensing performance of electrochemical transistor sensors.

[0006] Oxide semiconductors are the main candidates for n-type transistors and microelectronic devices with high yield and uniformity. The high electron mobility (>10 cm 2 V -1 S -1 ) in oxide field-effect transistors ensures the high sensitivity and high signal-to-noise ratio of biosensor devices. At the same time, solution processing methods also provide a convenient and feasible way for large-scale low-cost deposition of high-performance oxide semiconductors. For example, In 2 O 3 , SnO 2The above are often used in the preparation of transistor devices. However, in actual test applications, metal oxide semiconductors still face various stress factors, such as voltage bias and environmental pollutants, which lead to a decline in electrical performance, thus hindering the use of materials in various scenarios. Specifically, external impurities, such as oxygen and moisture, can adsorb on the channel surface of metal oxide thin film transistors, capture electrons from the conduction band and form a depletion region. These factors will lead to a reduction in device stability and the hysteresis of current-voltage performance, ultimately reducing the overall performance of the device and affecting the detection accuracy.

[0007] Based on the defects of current oxide semiconductor devices, it is necessary to improve them. Summary of the Invention

[0008] In view of this, the present invention proposes a tin dioxide transistor biosensor, its preparation method, and a cortisol concentration detection method to solve or at least partially solve the defects existing in the prior art.

[0009] In a first aspect, the present invention provides a tin dioxide transistor biosensor, including:

[0010] A substrate;

[0011] At least one transistor unit, the transistor unit is located on the surface of the substrate; each transistor unit includes a plurality of source electrodes and drain electrodes arranged alternately on the substrate; wherein, a transistor channel is formed between the source electrode, the drain electrode, and the substrate;

[0012] A tin dioxide thin film layer is provided on the surface of the transistor channel;

[0013] A polymethyl methacrylate material layer in which part of the ester groups are hydrolyzed to carboxyl groups is provided on the surface of the tin dioxide thin film layer.

[0014] Preferably, the material of the source electrode includes at least one of Au, Ag, and Cr;

[0015] The material of the drain electrode includes at least one of Au, Ag, and Cr;

[0016] The substrate is a ceramic substrate;

[0017] Each transistor unit further includes a gate electrode, and the gate electrode is any one of an Ag / AgCl electrode and a glassy carbon electrode;

[0018] The preparation method of the polymethyl methacrylate in which part of the ester groups are hydrolyzed to carboxyl groups includes:

[0019] Add polymethyl methacrylate to tetrahydrofuran, heat up to dissolve the polymethyl methacrylate, then add an aqueous sodium hydroxide solution, stir and react for 45-50 h, add dichloromethane, after layering, collect the lower layer solution;

[0020] Hydrochloric acid is added to the lower-layer solution, and after acidification for 30 - 35 min, layering is carried out to obtain the lower-layer liquid;

[0021] The solvent in the lower-layer liquid is evaporated to dryness to obtain polymethyl methacrylate in which part of the ester groups are hydrolyzed into carboxyl groups;

[0022] Among them, the mass-volume ratio of polymethyl methacrylate, tetrahydrofuran, aqueous sodium hydroxide solution, dichloromethane, and hydrochloric acid is (0.5 - 1) g : (15 - 20) mL : (15 - 20) mL : (15 - 20) mL : (10 - 15) mL;

[0023] The concentration of the aqueous sodium hydroxide solution is 2 - 3 mol / L;

[0024] The concentration of hydrochloric acid is 1 - 2 mol / L.

[0025] In a second aspect, the present invention also provides a preparation method of the tin dioxide transistor biosensor described above, including the following steps:

[0026] At least one transistor unit is prepared on the surface of the substrate, and each transistor unit includes a plurality of source electrodes and drain electrodes arranged alternately with each other, and a transistor channel is formed between the source electrode, the drain electrode, and the substrate;

[0027] Prepare a methoxyethanol solution containing SnCl 2 ;

[0028] The methoxyethanol solution containing SnCl 2 is coated in the transistor channel and annealed to form a tin dioxide thin film layer on the surface of the transistor channel;

[0029] Prepare an N,N-dimethylformamide solution containing polymethyl methacrylate in which part of the ester groups are hydrolyzed into carboxyl groups;

[0030] The N,N-dimethylformamide solution containing polymethyl methacrylate in which part of the ester groups are hydrolyzed into carboxyl groups is coated on the surface of the tin dioxide thin film layer and dried to form a polymethyl methacrylate material layer in which part of the ester groups are hydrolyzed into carboxyl groups on the surface of the tin dioxide thin film layer.

[0031] Preferably, after forming a polymethyl methacrylate material layer in which part of the ester groups are hydrolyzed into carboxyl groups on the surface of the tin dioxide thin film layer, a mixed aqueous solution containing EDC and NHS is further dropped onto the surface of the polymethyl methacrylate material layer in which part of the ester groups are hydrolyzed into carboxyl groups to activate the carboxyl functional groups of the polymethyl methacrylate material layer in which part of the ester groups are hydrolyzed into carboxyl groups.

[0032] Preferably, when the methoxyethanol solution containing SnCl 2The methoxyethanol solution is coated inside the transistor channel. In the annealing step, the SnCl 2 in the methoxyethanol solution of SnCl 2 has a concentration of 0.3 - 1.5 g / mL, the annealing temperature is 620 - 625 °C, and the time is 150 - 160 min;

[0033] And / or, the N,N - dimethylformamide solution containing polymethyl methacrylate with partial ester groups hydrolyzed to carboxyl groups is coated on the surface of the tin dioxide thin film layer. In the drying step, the concentration of polymethyl methacrylate with partial ester groups hydrolyzed to carboxyl groups in the N,N - dimethylformamide solution containing polymethyl methacrylate with partial ester groups hydrolyzed to carboxyl groups is 0.05 - 0.06 g / mL, the drying temperature is 120 - 130 °C, and the time is 20 - 30 min.

[0034] Preferably, a mixed aqueous solution containing EDC and NHS is dropped onto the surface of the polymethyl methacrylate material layer with partial ester groups hydrolyzed to carboxyl groups and reacted for 20 - 40 min. Among them, the concentration of EDC in the mixed aqueous solution containing EDC and NHS is 74 - 75 mg / mL, and the concentration of NHS is 11 - 12 mg / mL.

[0035] In the third aspect, the present invention also provides an application of the tin dioxide transistor biosensor as described above or the tin dioxide transistor biosensor prepared by the preparation method as described above in detecting the cortisol concentration solution.

[0036] In the fourth aspect, the present invention also provides a method for detecting cortisol concentration, which uses the tin dioxide transistor biosensor as described above or the tin dioxide transistor biosensor prepared by the preparation method as described above for detection, and includes the following steps:

[0037] The cortisol aptamer DNA solution is dropped onto the surface of the polymethyl methacrylate material layer with partial ester groups hydrolyzed to carboxyl groups, incubated, and the cortisol aptamer DNA is fixed; the incubated tin dioxide transistor biosensor is placed in a PBS buffer solution, under a fixed voltage between the source and drain electrodes, the gate electrode voltage is changed, the channel current curve is measured, and the current value I at Vgs = 0.8 V is read 0 ;

[0038] The test sample is dropped onto the surface of the polymethyl methacrylate material layer with partial ester groups hydrolyzed to carboxyl groups after fixing the cortisol aptamer DNA, and incubated; the incubated tin dioxide transistor biosensor is placed in a PBS buffer solution, under a fixed voltage between the source and drain electrodes, the gate electrode voltage is changed, the channel current curve is measured, and the current value I at Vgs = 0.8 V is read;

[0039] Calculate the current change amount ΔIds = |(I - I 0 ) / I 0 |;

[0040] Calculate the cortisol concentration in the sample to be measured based on the change in current;

[0041] The Vgs represents the voltage between the gate and the source.

[0042] Preferably, the gene sequence of the cortisol aptamer DNA is GGAATGGATCCACATCCATGGATGGGCAATGCGGGGTGGAGAATGGTTGCCGCACTTCG GCTTCACTGCAGACTTGACGAAGCTT-(CH 2 ) 6 -NH 2 .

[0043] Preferably, when the cortisol aptamer DNA solution is dropped onto the surface of the polymethyl methacrylate material layer where part of the ester groups are hydrolyzed into carboxyl groups and incubated, the incubation temperature is 20 - 25 °C and the time is 1 - 2 h;

[0044] When the sample to be measured is dropped onto the surface of the polymethyl methacrylate material layer where part of the ester groups are hydrolyzed into carboxyl groups after immobilizing the cortisol aptamer DNA and incubated, the incubation temperature is 35 - 37 °C and the time is 20 - 30 min;

[0045] The preparation method of the cortisol aptamer DNA solution is: adding cortisol aptamer DNA into PBS buffer solution to obtain the cortisol aptamer DNA solution;

[0046] The concentration of cortisol aptamer DNA in the cortisol aptamer DNA solution is 1 - 2 μM.

[0047] The tin dioxide transistor biosensor, its preparation method, and the cortisol concentration detection method of the present invention have the following beneficial effects compared with the prior art:

[0048] 1. For the tin dioxide transistor biosensor of the present invention, a tin dioxide thin film layer is provided on the surface of the transistor channel; a PMMAA material layer is provided on the surface of the tin dioxide thin film layer; the tin dioxide thin film layer is used as the channel material of the transistor to establish an activation layer; the PMMAA material layer is used to functionalize the channel to form a carboxylic acid-functionalized activation interface, which can also increase the biocompatibility of the interface and protect the tin dioxide thin film from the interference of the external environment, improving the specificity and sensitivity of the tin dioxide transistor; and after the tin dioxide thin film transistor finishes testing the target substance, the PMMAA material layer on the tin dioxide thin film layer can be washed off to obtain the recycled tin dioxide thin film transistor again;

[0049] 2. The cortisol concentration detection method of the present invention uses a method of spin-coating and annealing a methoxyethanol solution containing SnCl 2 ·2H 2 O to prepare a tin dioxide thin film as a transistor channel material to establish an activation layer; uses a PMMAA material layer to functionalize the channel to form a carboxylic acid-functionalized activation interface, which can also increase the biocompatibility of the interface and protect the tin dioxide thin film from external environmental interference, improving the specificity and sensitivity of the tin dioxide electrochemical transistor; fixes the cortisol aptamer DNA to the transistor activation layer through an amide bond. As the cortisol concentration changes, the electronegativity of the sensing interface changes, and the change amount of the channel current of the device changes, so as to achieve the purpose of quantitative analysis. In the cortisol concentration detection method of the present invention, as the concentration of the target substance cortisol changes, it has good linearity in the range of 1-10 6 pg / mL, and the detection limit is as low as the fg / mL level. For the detection of cortisol in the complex environments of human saliva, urine, and blood, it has high selectivity and specificity. These studies show that the reusable tin dioxide transistor biosensor of the present invention can be effectively applied to aspects such as saliva, urine, blood diagnosis, and postoperative monitoring. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0051] Figure 1 is a schematic structural diagram of the tin dioxide transistor biosensor of the present invention;

[0052] Figure 2 is a scanning electron microscope image of the source electrode and the drain electrode prepared on the substrate, and a transistor channel is formed between the source electrode, the drain electrode, and the substrate;

[0053] Figure 3 is Figure 2 an enlarged view of;

[0054] Figure 4 is a schematic diagram of the tin dioxide transistor biosensor of the present invention for detecting cortisol;

[0055] Figure 5 is a scanning electron microscope image of the tin dioxide thin film layer prepared in Example 1;

[0056] Figure 6 is a scanning electron microscope image of the PMMAA material layer prepared in Example 1;

[0057] Figure 7 The current curve graph before and after cortisol testing;

[0058] Figure 8 The linear relationship graph of the change in current against the logarithm of cortisol concentration;

[0059] Figure 9 The graph showing the relationship between the channel current value of the reusable tin dioxide transistor biosensor in Example 1 and the number of cycles of reuse;

[0060] Figure 10 The graph showing the relationship between the transconductance value of the reusable tin dioxide transistor biosensor in Example 1 and the number of cycles of reuse;

[0061] Figure 11 The change value of the detection current for the same concentration of cortisol after the reusable tin dioxide transistor biosensor in Example 1 is reused for one cycle;

[0062] Figure 12 The Raman spectra of the channel materials of the reusable tin dioxide transistor biosensor in Example 1 before and after reuse. Detailed implementation manners

[0063] Next, in combination with the embodiments of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of the present invention.

[0064] It should be noted that the description order of the following embodiments does not limit the preferred order of the embodiments. Additionally, in the description of this application, the term "comprising" means "including but not limited to". The various embodiments of the present invention may exist in a range format; it should be understood that the description in a range format is only for convenience and brevity and should not be construed as a rigid limitation on the scope of the present invention; therefore, it should be considered that the described range description has specifically disclosed all possible sub-ranges and individual values within that range. For example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and individual numbers within the range, such as 1, 2, 3, 4, 5, and 6, regardless of the range. Additionally, whenever a numerical range is indicated herein, it means including any cited number (fraction or integer) within the indicated range.

[0065] The embodiments of this application provide a tin dioxide transistor biosensor, as Figures 1 - 2As shown, it includes:

[0066] Substrate 1;

[0067] At least one transistor unit 5, and the transistor unit 5 is located on the surface of the substrate 1; each transistor unit 5 includes a plurality of source electrodes 2 and drain electrodes 3 that are arranged in an interlaced manner on the substrate; wherein, a transistor channel 4 is formed between the source electrode 2, the drain electrode 3 and the substrate 1;

[0068] A tin dioxide thin film layer is provided on the surface of the transistor 1 channel;

[0069] A polymethyl methacrylate material layer (i.e., PMMAA material layer) in which part of the ester groups are hydrolyzed into carboxyl groups is provided on the surface of the tin dioxide thin film layer.

[0070] Specifically, the tin dioxide transistor biosensor of the present invention includes a substrate 1, and at least one transistor unit 5 is arranged in an array on the surface of the substrate 1. The number of transistor units 5 is determined according to actual situations. For example, the number can be 1, 2, 3, 4... n; each transistor unit 5 includes a plurality of source electrodes 2 and drain electrodes 3 that are arranged in an interlaced manner. A transistor channel 4 is formed between the source electrode 2, the drain electrode 3 and the substrate 1; the source electrode 2 and the drain electrode 3 constitute an interdigital array electrode; a tin dioxide thin film layer is provided on the surface of the transistor channel 4; a polymethyl methacrylate material layer (i.e., PMMAA material layer) in which part of the ester groups are hydrolyzed into carboxyl groups is provided on the surface of the tin dioxide thin film layer. The tin dioxide thin film layer serves as a channel material of the transistor to establish an activation layer; the PMMAA material layer is used to functionalize the channel to form a carboxylic acid-functionalized activation interface, and at the same time, it can also increase the biocompatibility of the interface and protect the tin dioxide thin film from external environmental interference, thereby improving the specificity and sensitivity of the tin dioxide electrochemical transistor.

[0071] In order to improve the stability and detection accuracy of inorganic oxide semiconductor devices, it is necessary to effectively compensate for the defects in the channel layer and block the influence of environmental pollutants on the semiconductor layer. A relatively direct solution is to deposit a passivation layer on the surface of the metal oxide semiconductor. This passivation layer prevents the intrusion of external impurities and compensates for the defect states, thereby reducing defects similar to acceptors or donors. This process protects the semiconductor thin film and stabilizes the device performance. The composition of the passivation layer can be divided into inorganic compounds and organic compounds. However, inorganic layers are usually limited by high preparation costs and strict manufacturing requirements. In contrast, organic polymers are widely used because of their ability to be prepared by methods such as gel technology, as well as their lower cost and simpler processing. The present invention uses the PMMAA material layer to prevent the tin dioxide thin film from being invaded by the external environment, improve the specificity and sensitivity of the tin dioxide electrochemical transistor, and ultimately improve the device performance.

[0072] In some embodiments, the material of the source electrode 2 includes at least one of Au, Ag, and Cr. Preferably, the material of the source electrode 2 is Au.

[0073] In some embodiments, the material of the drain electrode 3 includes at least one of Au, Ag, and Cr. Preferably, the material of the drain electrode 3 is Au.

[0074] In some embodiments, the substrate 1 is a ceramic substrate.

[0075] In some embodiments, each transistor unit 5 further includes a gate electrode 6, and the gate electrode 6 is any one of an Ag / AgCl electrode and a glassy carbon electrode. Preferably, the gate electrode is an Ag / AgCl electrode.

[0076] In some embodiments, the tin dioxide transistor biosensor includes a single transistor unit 5, and each transistor unit 5 includes a plurality of source electrodes 2 and drain electrodes 3 that are alternately arranged. A transistor channel 4 is formed between the source electrode 2, the drain electrode 3, and the substrate 1. The length of the transistor channel 4 is 2 - 3 mm, the width is 0.1 - 0.3 mm, and the channel depth is 1 - 8 μm.

[0077] In some embodiments, the thickness of the tin dioxide thin film layer is 300 - 700 nm, and the thickness of the PMMAA material layer is 300 - 700 nm.

[0078] Based on the same inventive concept, the present invention also provides a preparation method of the above-mentioned tin dioxide transistor biosensor, including the following steps:

[0079] S1. Prepare at least one transistor unit on the surface of the substrate. Each transistor unit includes a plurality of source electrodes and drain electrodes that are alternately arranged. A transistor channel is formed between the source electrode, the drain electrode, and the substrate;

[0080] S2. Prepare a methoxyethanol solution containing SnCl 2 ;

[0081] S3. Coat the methoxyethanol solution containing SnCl 2 in the transistor channel, and anneal to form a tin dioxide thin film layer on the surface of the transistor channel. The thickness of the tin dioxide thin film layer is 300 - 700 nm;

[0082] S4. Prepare an N,N - dimethylformamide solution containing polymethyl methacrylate with some ester groups hydrolyzed to carboxyl groups;

[0083] S5. Coat the N,N - dimethylformamide solution containing polymethyl methacrylate with some ester groups hydrolyzed to carboxyl groups on the surface of the tin dioxide thin film layer, and dry to form a polymethyl methacrylate material layer with some ester groups hydrolyzed to carboxyl groups on the surface of the tin dioxide thin film layer. The thickness of the PMMAA layer is 300 - 700 nm.

[0084] Specifically, in step S1, a mask plate is placed on the substrate and evaporation deposition is performed to form the source electrode and the drain electrode.

[0085] Specifically, the source electrode and the drain electrode are prepared on the substrate, and a transistor channel is formed between the source electrode, the drain electrode, and the substrate. The electron microscope scanning image is as Figure 2 shown. It can be seen from Figure 2 that a transistor channel 4 is formed between the source electrode 2 and the drain electrode 3; Figure 3 is Figure 2 an enlarged view of.

[0086] In some embodiments, SnCl 2 (or SnCl 2 ·2H 2 O) is added to methoxyethanol (CAS No. 32718-54-0, molecular formula C 3 H 8 O 2 ) to obtain a methoxyethanol solution containing SnCl 2 . The methoxyethanol solution containing SnCl 2 is coated in the source electrode, the drain electrode, and the transistor channel, and annealed to form a tin dioxide thin film layer on the surface of the transistor channel; the concentration of SnCl 2 in the methoxyethanol solution containing SnCl 2 (or SnCl 2 ·2H 2 O) is 0.3 - 1.5 g / mL, the annealing temperature is 620 - 625 °C, and the time is 150 - 160 min; preferably, the concentration of SnCl 2 in the methoxyethanol solution containing SnCl 2 ·2H 2 O is 0.4 g / mL, the annealing temperature is 620 °C, and the time is 150 min.

[0087] In some embodiments, polymethyl methacrylate with partial ester groups hydrolyzed into carboxyl groups is added to N,N-dimethylformamide (DMF) to obtain an N,N-dimethylformamide solution containing polymethyl methacrylate with partial ester groups hydrolyzed into carboxyl groups, that is, a DMF solution containing PMMAA; the N,N-dimethylformamide solution containing polymethyl methacrylate with partial ester groups hydrolyzed into carboxyl groups is coated on the surface of the tin dioxide thin film layer and dried to form a polymethyl methacrylate material layer with partial ester groups hydrolyzed into carboxyl groups on the surface of the tin dioxide thin film layer; the concentration of polymethyl methacrylate with partial ester groups hydrolyzed into carboxyl groups in the N,N-dimethylformamide solution containing polymethyl methacrylate with partial ester groups hydrolyzed into carboxyl groups is 0.05 - 0.06 g / mL, the drying temperature is 120 - 130 °C, and the time is 20 - 30 min; preferably, the concentration of polymethyl methacrylate with partial ester groups hydrolyzed into carboxyl groups is 0.05 g / mL, the drying temperature is 120 °C, and the time is 20 min.

[0088] Specifically, the preparation method of polymethyl methacrylate with partial ester groups hydrolyzed into carboxyl groups (PMMAA) is as follows:

[0089] Polymethyl methacrylate is added to tetrahydrofuran, and the temperature is raised (the temperature is 60 - 70 °C) to dissolve the polymethyl methacrylate. Then, an aqueous sodium hydroxide solution is added, and the mixture is stirred and reacted for 45 - 50 h. Dichloromethane is added. After stratification, the lower layer (dichloromethane is the lower layer) solution is collected;

[0090] Hydrochloric acid is added to the lower layer solution, and after acidification for 30 - 35 min, stratification is carried out to obtain the lower layer liquid (dichloromethane is also in the lower layer);

[0091] The solvent in the lower layer liquid is evaporated to dryness to obtain polymethyl methacrylate with partial ester groups hydrolyzed into carboxyl groups;

[0092] Among them, the mass-volume ratio of polymethyl methacrylate, tetrahydrofuran, aqueous sodium hydroxide solution, dichloromethane, and hydrochloric acid is (0.5 - 1) g : (15 - 20) mL : (15 - 20) mL : (15 - 20) mL : (10 - 15) mL;

[0093] The concentration of the aqueous sodium hydroxide solution is 2 - 3 mol / L;

[0094] The concentration of hydrochloric acid is 1 - 2 mol / L.

[0095] In some embodiments, after a polymethyl methacrylate material layer in which partial ester groups are hydrolyzed into carboxyl groups is formed on the surface of the tin dioxide thin film layer, a mixed aqueous solution containing EDC and NHS is further dropped onto the surface of the polymethyl methacrylate material layer in which partial ester groups are hydrolyzed into carboxyl groups to activate the carboxyl functional groups of the polymethyl methacrylate material layer in which partial ester groups are hydrolyzed into carboxyl groups; specifically, 10-20 μL of the mixed aqueous solution containing EDC and NHS is dropped onto the surface of the polymethyl methacrylate material layer in which partial ester groups are hydrolyzed into carboxyl groups and reacted for 20-40 min to activate the carboxyl functional groups on the surface of the PMMAA material layer, and finally the residual EDC / NHS mixed aqueous solution is rinsed with 1×PBS solution (0.1 M, pH 7.4).

[0096] Specifically, the preparation method of the mixed aqueous solution containing EDC and NHS is as follows: 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) and N-hydroxysuccinimide (NHS) are added to water to obtain the mixed aqueous solution containing EDC and NHS; the concentration of EDC in the mixed aqueous solution containing EDC and NHS is 74-75 mg / mL, and the concentration of NHS is 11-12 mg / mL. Preferably, the concentration of EDC is 74.5 mg / mL and the concentration of NHS is 11.6 mg / mL.

[0097] In some embodiments, the PMMAA layer is rinsed with organic solvents such as DCM (dichloromethane) and DMF, dried, and then the PMMAA layer can be thoroughly cleaned to obtain a reusable tin dioxide transistor biosensor; after the detection of cortisol, the tin dioxide transistor is rinsed with DCM to remove the PMMAA material layer on the surface of the tin dioxide thin film layer, and then a DMF solution containing PMMAA is spin-coated again to reform the PMMAA material layer. After activation with a mixed aqueous solution of EDC and NHS, it can be used again, and a recycled tin dioxide thin film transistor can be obtained.

[0098] In the preparation method of the tin dioxide transistor biosensor of the present invention, first, a small amount of ester groups in polymethyl methacrylate (PMMA) are hydrolyzed into carboxyl groups to obtain PMMAA, and then it is configured into a solution and coated on the surface of the tin dioxide thin film layer for modifying and linking the aptamer for specific detection of cortisol. After use, it can be rinsed with organic solvents such as dichloromethane (DCM) and N,N-dimethylformamide to obtain the tin dioxide transistor again, achieving the purpose of reuse. In the cortisol concentration detection method of the present invention, first, a small amount of hydrolyzed PMMAA spin-coated on the surface of the transistor channel is activated, and then the 5'-modified amino group (-NH 2) The cortisol-specific aptamer is connected to the surface of the transistor channel through amide bond modification. When the aptamer captures the target substance cortisol, its surface conformation changes, resulting in a decrease in the device current. As the cortisol concentration changes, the electronegativity of the sensing interface changes, and the number of effective carriers in the transistor semiconductor layer decreases, thus achieving the purpose of quantitative analysis. After the reusable transistor of the present invention is reused multiple times, after rinsing the PMMAA material layer on the surface of the tin dioxide thin film layer with organic solvents such as dichloromethane (DCM) and N,N-dimethylformamide (DMF), the tin dioxide transistor can still maintain good device performance. After being reused multiple times, the cortisol biosensor prepared using it can still accurately detect the cortisol concentration. In the cortisol concentration detection method of the present invention, as the concentration of the target substance cortisol changes, it has good linearity in the concentration range of 1-10 6 pg / mL, and the detection limit is as low as the fg / mL level. In the detection of cortisol in the complex environments of human saliva, urine, and blood, it has high selectivity and specificity.

[0099] Based on the same inventive concept, the present invention also provides an application of the above-mentioned tin dioxide transistor biosensor or the tin dioxide transistor biosensor prepared by the above-mentioned preparation method in detecting a cortisol concentration solution.

[0100] Based on the same inventive concept, the present invention also provides a cortisol concentration detection method, which uses the above-mentioned tin dioxide transistor biosensor or the tin dioxide transistor biosensor prepared by the above-mentioned preparation method for detection, and includes the following steps:

[0101] S1. Drop the cortisol aptamer DNA solution onto the surface of the polymethyl methacrylate material layer in which part of the ester groups are hydrolyzed into carboxyl groups, incubate to fix the cortisol aptamer DNA; place the incubated tin dioxide transistor biosensor in a PBS buffer solution, fix the voltage between the source electrode and the drain electrode (the fixed voltage is 0.05V), change the gate electrode voltage (the voltage range is 0-0.8V), measure the channel current curve, and read the current value I gs at V 0 =0.8V; during the process of changing the gate electrode voltage, the voltage between the gate electrode and the source electrode also changes, and read the current value I gs at V gs =0.8V, that is, the current between the source electrode and the drain electrode; 0

[0102] S2. Drop the sample to be tested onto the surface of the polymethyl methacrylate material layer where partial ester groups of the fixed cortisol aptamer DNA are hydrolyzed into carboxyl groups, and incubate. Place the incubated tin dioxide transistor biosensor in a PBS buffer solution. Under a fixed voltage between the source and drain, change the gate electrode voltage, measure the channel current curve, and read the current value I at Vgs = 0.8V.

[0103] S3. Calculate the current change ΔI ds = |(I - I 0 ) / I 0 |;

[0104] S4. Calculate the cortisol concentration in the sample to be tested based on the current change.

[0105] Specifically, in step S1, add the cortisol aptamer DNA to a PBS buffer solution to obtain a cortisol aptamer DNA solution with a concentration of 1 - 2 μM. Drop the cortisol aptamer DNA solution onto the surface of the polymethyl methacrylate material layer (PMMAA material layer) where partial ester groups are hydrolyzed into carboxyl groups, and incubate at room temperature (20 - 25 °C) for 1 - 2 h to immobilize the cortisol aptamer DNA through an amide reaction.

[0106] In some embodiments, drop the sample to be tested onto the surface of the polymethyl methacrylate material layer where partial ester groups of the fixed cortisol aptamer DNA are hydrolyzed into carboxyl groups, and incubate at a temperature of 35 - 37 °C for 20 - 30 min.

[0107] In some embodiments, the PBS buffer solution is a 1×PBS solution (0.1 M, pH 7.4).

[0108] In some embodiments, Figure 4 is a schematic diagram of the detection of cortisol by the tin dioxide transistor biosensor of the present invention. Place the incubated tin dioxide transistor biosensor in a PBS buffer solution. As shown in the reference Figure 4 , insert the gate 6 into the PBS buffer solution 7. Under a fixed voltage between the source and drain (i.e., Vds), change the gate electrode voltage (0 - 0.8V), measure the transistor channel current curve, and read the current value I at Vgs = 0.8V 0 ; where, during the test, connect the source, drain, and gate to a digital source meter, set the source-drain voltage V DS of the digital source meter to 0.05V, the scanning voltage of the gate is 0 - 0.8V, and read the current value I at Vgs = 0.8V when the detection reaches equilibrium 0; In the present invention, a carboxyl-functionalized PMMAA interface is formed in the transistor channel by spin coating, and the cortisol aptamer DNA is fixed as a linker to recognize the target substance cortisol. The target substance cortisol specifically recognizes the aptamer DNA, affecting the effective number of carriers in the semiconductor layer, thereby reducing the device current and realizing the detection of the target substance cortisol.

[0109] In some embodiments, the change amount ΔI of the channel current is calculated ds = |(I - I 0 ) / I 0 |, and the cortisol concentration in the sample to be measured is calculated based on the change amount of the channel current; specifically, the change amount ΔI of the channel current is calculated ds has a linear relationship with the cortisol concentration in the sample to be measured; before actual testing, samples with known cortisol concentrations are prepared, and the corresponding change amount ΔI of the calculated channel current is measured simultaneously ds to calculate the change amount ΔI of the channel current ds as the ordinate, and the logarithm of the cortisol concentration as the abscissa, to establish a linear relationship curve between ΔI ds and the cortisol concentration. According to this linear relationship curve and the calculated ΔI ds , the cortisol concentration in the sample to be measured can be calculated.

[0110] In some embodiments, the cortisol in the sample to be measured is hydrocortisone, also known as cortisol, which is an organic compound with the chemical formula C 21 H 30 O 5 .

[0111] In some embodiments, the gene sequence of the cortisol aptamer DNA is as shown in SEQ ID NO:1, specifically: GGAAT GGATC CACAT CCATG GATGG GCAAT GCGGG GTGGA GAATG GTTGC CGCAC TTCGGCTTCACTGCAGACTT GACGAAGCTT-(CH 2 ) 6 -NH 2 .

[0112] Among them, the 5' end of the cortisol aptamer DNA is modified with an amino group, i.e., 5'-NH 2 -(CH 2 ) 6 -.

[0113] The cortisol concentration detection method of the present invention uses a solution containing SnCl 2 ·2H 2A method of preparing a tin dioxide thin film as a transistor channel material by spin-coating and annealing a methoxyethanol solution of O to establish an activation layer; functionalizing the channel with a PMMAA material layer to form a carboxylic acid-functionalized activation interface, which can also increase the biocompatibility of the interface and protect the tin dioxide thin film from external environmental interference, improving the specificity and sensitivity of the tin dioxide electrochemical transistor; immobilizing the cortisol aptamer DNA to the transistor activation layer through an amide bond. As the concentration of cortisol changes, the electro-negativity of the sensing interface changes, and the change in the channel current of the device changes, thus achieving the purpose of quantitative analysis. In the cortisol concentration detection method of the present invention, as the concentration of the target substance cortisol changes, it has good linearity in the range of 1 to 10 6 pg / mL, and the detection limit is as low as the fg / mL level. In the detection of cortisol in the complex environments of human saliva, urine, and blood, it has high selectivity and specificity. These studies show that the reusable tin dioxide transistor biosensor of the present invention can be effectively applied to aspects such as saliva, urine, blood diagnosis, and postoperative monitoring.

[0114] Specifically, the cortisol concentration detection method of the present invention can achieve quantitative analysis of cortisol, and the detection limits are 0.54 pg / mL respectively.

[0115] The following further describes the tin dioxide transistor biosensor of the present application, its preparation method, and the cortisol concentration detection method. This part further illustrates the content of the present invention in combination with specific embodiments, but should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means adopted in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the art.

[0116] Example 1

[0117] The embodiment of the present application provides a tin dioxide transistor biosensor, including:

[0118] A substrate;

[0119] A single transistor unit, which is disposed on the surface of the substrate. The transistor unit includes a plurality of source electrodes and drain electrodes that are alternately arranged on the substrate; wherein, a transistor channel is formed between the source electrode, the drain electrode, and the substrate;

[0120] A tin dioxide thin film layer is provided on the surface of the transistor channel;

[0121] A PMMAA material layer is provided on the surface of the tin dioxide thin film layer;

[0122] The materials of the source electrode and the drain electrode are both Au;

[0123] The substrate is a ceramic substrate;

[0124] Each transistor unit further includes a gate, which is an Ag / AgCl electrode;

[0125] One source electrode and one drain electrode are arranged in an interlaced manner to form one transistor channel; the average length of the transistor channel is 2.6 mm, the average width is 0.2 mm, and the average depth is 6 μm;

[0126] The average thickness of the tin dioxide thin film layer is 500 nm, and the average thickness of the PMMAA material layer is 550 nm.

[0127] This embodiment also provides a preparation method of the above-mentioned tin dioxide transistor biosensor, including the following steps:

[0128] S1. Fabricate one transistor unit on a substrate, where the transistor unit includes a plurality of source electrodes and drain electrodes arranged in an interlaced manner; among them, a transistor channel is formed between the source electrode, the drain electrode, and the substrate;

[0129] S2. Dissolve 0.4 g of SnCl 2 ·2H 2 O in 1 mL of methoxyethanol to obtain a methoxyethanol solution containing SnCl 2 ; Take 10 μL of the methoxyethanol solution containing SnCl 2 and spin-coat it on the surface of the transistor channel, and dry it at 120 °C for 20 min; then put it into a tube furnace and anneal it at 620 °C for 150 min to form a tin dioxide thin film layer on the surface of the transistor channel;

[0130] S3. Dissolve 0.05 g of PMMAA in DMF solution to prepare a DMF solution containing PMMAA (i.e., an N,N-dimethylformamide solution of polymethyl methacrylate with some ester groups hydrolyzed to carboxyl groups); the concentration of PMMAA in the DMF solution containing PMMAA is 0.05 g / mL;

[0131] The preparation method of PMMAA is as follows:

[0132] Add 0.5 g of polymethyl methacrylate to 15 mL of tetrahydrofuran, heat it to 60 °C to dissolve the polymethyl methacrylate, then add 15 mL of 2 mol / L sodium hydroxide aqueous solution, stir and react for 48 h, add 15 mL of dichloromethane, after stratification, collect the lower layer solution;

[0133] Add 15 mL of 2 mol / L hydrochloric acid to the lower layer solution, acidify it for 30 min and then stratify to obtain the lower layer liquid;

[0134] Evaporate the solvent in the lower layer liquid to obtain polymethyl methacrylate (PMMAA) with some ester groups hydrolyzed to carboxyl groups;

[0135] S4. Spin-coat the DMF solution containing PMMAA in S3 onto the surface of the tin dioxide thin film layer, dry it at 120 °C for 20 min, and form a PMMAA material layer on the surface of the tin dioxide thin film layer to obtain a tin dioxide transistor with a carboxylated sensing interface for standby.

[0136] S5. Drop 10 μL of a mixed aqueous solution containing EDC and NHS onto the surface of the PMMAA material layer prepared in S4 and react for 30 min to activate the carboxyl functional groups on the surface of the PMMAA material layer. Finally, rinse the residual EDC / NHS mixed aqueous solution with 1×PBS solution (0.1 M) to obtain a tin dioxide transistor biosensor. The concentration of EDC in the mixed aqueous solution containing EDC and NHS is 74.5 mg / mL, and the concentration of NHS is 11.6 mg / mL.

[0137] Wash the tested tin dioxide transistor with organic solvents such as DCM. After testing cortisol, rinse the PMMAA material layer on the surface of the tin dioxide thin film layer of the tin dioxide transistor with DCM to obtain a recycled tin dioxide thin film transistor.

[0138] Example 2

[0139] This example provides a method for detecting cortisol concentration, which uses the tin dioxide transistor biosensor prepared in Example 1 for detection, including the following steps:

[0140] S1. Drop 10 μL of 1 μM cortisol aptamer DNA solution onto the surface of the polymethyl methacrylate material layer with partial ester groups hydrolyzed to carboxyl groups, incubate at room temperature of 25 °C for 1 h, and fix the cortisol aptamer DNA through an amide reaction. Place the incubated tin dioxide transistor biosensor in a PBS buffer solution, under a fixed voltage between the source and drain (the fixed voltage is 0.05 V), change the gate electrode voltage (the voltage range is 0 - 0.8 V), measure the channel current curve, and read the current value I at V gs = 0.8 V. V 0 is the voltage between the gate and the source; gs

[0141] S2. Drop the sample to be tested onto the surface of the PMMAA material layer after fixing the cortisol aptamer DNA in S2, and incubate at 37 °C for 1 h. Place the incubated tin dioxide transistor biosensor in a PBS buffer solution, under a fixed voltage between the source and drain (the fixed voltage is 0.05 V), change the gate electrode voltage (the voltage range is 0 - 0.8 V), measure the channel current curve, and read the current value I at Vgs = 0.8 V;

[0142] S3. Calculate the current change amount ΔI ds = |(I - I0 ) / I 0 |;

[0143] S4. Calculate the cortisol concentration in the sample to be measured based on the change in current;

[0144] Add cortisol aptamer DNA to the PBS buffer solution to obtain a cortisol aptamer DNA solution with a concentration of 1 μM;

[0145] The PBS buffer solution is 1×PBS solution (0.1 M, pH 7.4);

[0146] The gene sequence of cortisol aptamer DNA is GGAAT GGATC CACAT CCATG GATGG GCAAT GCGGGGTGGA GAATG GTTGC CGCAC TTCGG CTTCA CTGCA GACTT GACGA AGCTT-(CH 2 ) 6 -NH 2 .

[0147] Comparative Example 1

[0148] This comparative example provides a transistor biosensor, including:

[0149] A substrate;

[0150] A single transistor unit, which is disposed on the surface of the substrate. The transistor unit includes a plurality of source electrodes and drain electrodes that are alternately arranged on the substrate; wherein, a transistor channel is formed between the source electrode, the drain electrode, and the substrate;

[0151] A tin dioxide thin film layer is provided on the surface of the transistor channel;

[0152] The substrate is a ceramic substrate;

[0153] Each transistor unit further includes a gate electrode, and the gate electrode is an Ag / AgCl electrode;

[0154] One source electrode and one drain electrode are alternately arranged to form one transistor channel; the average length of the transistor channel is 2.6 mm, the average width is 0.2 mm, and the average depth is 6 μm;

[0155] The average thickness of the tin dioxide thin film layer is 500 nm.

[0156] This comparative example also provides a preparation method of the above transistor biosensor, including the following steps:

[0157] S1. Fabricate one transistor unit on a substrate. The transistor unit includes a plurality of alternately arranged source electrodes and drain electrodes. Among them, a transistor channel is formed between the source electrode, the drain electrode, and the substrate.

[0158] S2. Dissolve 0.4 g of SnCl 2 ·2H 2 O in 1 mL of methoxyethanol to obtain a methoxyethanol solution containing SnCl 2 . Take 10 μL of the methoxyethanol solution containing SnCl 2 and spin-coat it on the surface of the transistor channel. Dry it at 120 °C for 20 min, and then anneal it in a tube furnace at 620 °C for 150 min to form a tin dioxide thin film layer on the surface of the transistor channel.

[0159] Performance Characterization

[0160] Figure 5 is the scanning electron microscope image of the tin dioxide thin film layer prepared in Example 1. It can be seen from the surface electron microscope scan of tin dioxide that a complete semiconductor thin film layer of tin dioxide is formed on the surface of the gold electrode by the spin-coating method.

[0161] Figure 6 is the scanning electron microscope image of the PMMAA material layer prepared in Example 1. It can be seen from the surface electron microscope scan of PMMAA that a complete PMMAA organic dielectric layer is formed on the surface of the tin dioxide thin film by the spin-coating method.

[0162] Place the tin dioxide transistor biosensor prepared in Example 1 in a PBS buffer solution. With the voltage between the source electrode and the drain electrode fixed (fixed voltage is 0.05 V), change the gate electrode voltage (voltage range 0 - 0.8 V), measure the channel current curve, and read the current value I gs at V 0 = 0.8 V (without immobilizing cortisol aptamer DNA); and after each test, rinse the PMMAA material layer on the surface of the tin dioxide thin film layer with DCM, then spin-coat the DMF solution containing PMMAA again to form a PMMAA material layer, and use a mixed aqueous solution containing EDC and NHS to obtain a newly recyclable tin dioxide transistor biosensor. Test the current value according to the same method and repeat the cycle 7 times; similarly, place the transistor biosensor prepared in Comparative Example 1 in a PBS buffer solution. With the voltage between the source electrode and the drain electrode fixed (fixed voltage is 0.05 V), change the gate electrode voltage (voltage range 0 - 0.8 V), measure the channel current curve, and read the current value I gs at V 0 = 0.8 V (without immobilizing cortisol aptamer DNA), and repeat the cyclic test 7 times. The test results are as shown in Figure 9 shown.

[0163] Figure 9 Relationship diagram of the channel current values of the reusable tin dioxide transistor biosensor in Example 1 and the transistor biosensor in Comparative Example 1 with respect to the number of recycling times; Figure 9 In, different color regions represent a cycle period, and the vertical axis represents the gate voltage V gs = 0.8V, the channel current of the device; From Figure 9 It can be seen that before and after cycling the devices in Example 1 and Comparative Example 1, the current values of the channel current at V gs = 0.8V are not much different. The RSD of the current values of the transistor biosensor in Comparative Example 1 in 7 cycle periods is 0.89% (RSD represents relative standard deviation), demonstrating good recyclability of the device.

[0164] Figure 10 Relationship diagram of the transconductance value (g m , unit millisiemens (mS)) of the transistor biosensor in Comparative Example 1 with respect to the number of recycling times; It can be seen from the figure that after seven cycle periods, the transistor biosensor in Comparative Example 1 still maintains good device performance, and its transconductance curves before and after each cycle period are stable, demonstrating good recyclability of the device.

[0165] Figure 11 Detection current change values of the reusable tin dioxide transistor biosensor in Example 1 for the same concentration of cortisol after cycling once according to the methods of S1 - S3 in Example 2; After each test, the PMMAA material layer on the surface of the tin dioxide thin film layer was rinsed with DCM, and then the DMF solution containing PMMAA was spin-coated again to form the PMMAA material layer, and a mixed aqueous solution containing EDC and NHS was used to obtain a newly recycled tin dioxide transistor biosensor, and the detection current change values for the same concentration of cortisol were measured again. The detection results are as Figure 11 shown.

[0166] From Figure 11 It can be seen that in the 50 - cycle reuse experiment, the device shows good detection ability for the same concentration of cortisol, and the difference is within a reasonable range. The RSD in the 50 - cycle detection experiment is 2.80%. It shows that the device can still maintain good detection ability for the target substance cortisol during the recycling process.

[0167] Figure 12 Raman spectra of the channel materials of the reusable tin dioxide transistor biosensor in Example 1 before and after cycling; Figure 12The Raman spectrum of Sn-FET in the middle represents the Raman spectrum after forming a tin dioxide thin film layer on the surface of the transistor channel in step S2 of Example 1; Channel PMMAA represents the Raman spectrum after forming a PMMAA material layer on the surface of the tin dioxide thin film layer in step S4 of Example 1; Electrobe PMMAA represents the Raman spectrum after forming a PMMAA material layer on the source and drain electrodes after spin coating in Example 1; After cleaning Sn-FET represents the Raman spectrum after rinsing the PMMAA material layer on the surface of the tin dioxide thin film layer with DCM. In the Raman spectrum of tin dioxide, E g 、A g 、B 2g peaks respectively represent different vibration modes. The E g peak represents the enhanced symmetry mode, the A g peak represents the symmetry active mode, and the B 2g peak represents the antisymmetric mode. As can be seen from Figure 12 , through the spin coating method, corresponding peaks of PMMAA appear in both the transistor channel and the source and drain electrodes, indicating that a uniform thin film is formed on the substrate surface. Then, no corresponding peak of PMMAA appears on the surface of the tin dioxide thin film layer after cleaning, indicating that there is no residue of PMMAA on the surface of the tin dioxide thin film layer after cleaning.

[0168] Specifically, referring to Figure 7 shown, it is the current curve before and after cortisol testing; among them, the orange curve is the current curve (without immobilizing cortisol aptamer DNA) of the transistor biosensor in Comparative Example 1 placed in a PBS buffer solution and tested according to the same method as above, that is, corresponding to Figure 7 the Sn-FET in. The green curve is the current curve (without immobilizing cortisol aptamer DNA) of the tin dioxide transistor biosensor in Example 1 tested according to the same method as above, that is, corresponding to Figure 7 the PSn-FET in. The blue curve is the current curve of the tin dioxide transistor biosensor in Example 1 tested after immobilizing cortisol aptamer according to the method of step S2 in Example 2, that is, corresponding to Figure 7 the APSn-FET in. The pink curve is the current curve of the tin dioxide transistor biosensor in Example 1 tested after capturing cortisol according to the method of step S3 in Example 2, that is, corresponding to Figure 7 the Cortisol in.

[0169] As can be seen from Figure 7 , the addition of cortisol causes the channel current of the channel tin dioxide transistor to decrease, indicating that the number of effective carriers in the semiconductor layer at the channel of the tin dioxide thin film transistor decreases at this time, resulting in a decrease in the device current.

[0170] Further, Figure 8 When the tin dioxide transistor biosensor in Example 1 was used to test cortisol in the sample to be tested according to Example 2, when the concentrations of cortisol in the sample to be tested were 1 pg / mL, 10 pg / mL, 100 pg / mL, 1 ng / mL, 10 ng / mL, 100 ng / mL, and 1 μg / mL respectively, the linear relationship diagram of the current change amount with respect to the logarithm of the cortisol (i.e., M cort ) concentration.

[0171] Example 3

[0172] In order to investigate the practicability of the method of the present invention, the reusable tin dioxide transistor biosensor in Example 1 was placed in saliva, urine environments before and after human movement and in human serum for detection. The urine and serum were centrifuged and diluted 10 times for testing, and the saliva was directly used for testing after centrifugation. The testing was carried out according to the method in Example 2. The source-drain voltage V DS of the digital source meter was set to 0.05 V, and the gate scanning voltage was 0 - 0.8 V. The change amount of the channel current in different samples was recorded. The test results are shown in Tables 5 - 6 below.

[0173] Table 5 - Detection results of cortisol in saliva and urine before and after movement by the tin dioxide transistor biosensor

[0174]

[0175]

[0176] In Table 5: CL represents the content of cortisol in the sample tested by the standard chemiluminescence method, sensor (ng / mL) represents the concentration of the target cortisol detected by the tin dioxide transistor biosensor in Example 1, RSD (%) represents the relative standard deviation, and Recovery (%) represents the recovery rate.

[0177] Table 6 - Detection results of cortisol in human serum by the reusable tin dioxide transistor biosensor

[0178]

[0179] CL represents the content of cortisol in the sample tested by the standard chemiluminescence method, sensor (ng / mL) represents the concentration of the target cortisol detected by the reusable tin dioxide transistor biosensor in Example 1, RSD (%) represents the relative standard deviation, and Recovery (%) represents the recovery rate.

[0180] As can be seen from Tables 5 to 6, the reusable tin dioxide transistor biosensor of the present invention has a relatively small relative standard deviation measured in the detection of actual samples, has high accuracy, and realizes sensitive detection of cortisol.

[0181] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A tin dioxide transistor biosensor, characterized in that: include: substrate; At least one transistor unit, the transistor unit is located on the surface of the substrate; each of the transistor units includes a plurality of mutually staggered source electrodes and drain electrodes located on the substrate; wherein a transistor channel is formed between the source electrodes, the drain electrodes and the substrate; A tin dioxide thin film layer is provided on the surface of the transistor channel; A polymethyl methacrylate material layer in which part of the ester groups are hydrolyzed into carboxyl groups is disposed on the surface of the tin dioxide film layer.

2. The tin dioxide transistor biosensor according to claim 1, characterized in that: The material of the source electrode includes at least one of Au, Ag, and Cr; The material of the drain electrode includes at least one of Au, Ag, and Cr; The substrate is a ceramic substrate; Each of the transistor units further includes a gate, and the gate is any one of an Ag / AgCl electrode and a glassy carbon electrode; The preparation method of polymethyl methacrylate in which part of the ester groups are hydrolyzed into carboxyl groups comprises: Add polymethyl methacrylate to tetrahydrofuran, raise the temperature to dissolve the polymethyl methacrylate, then add sodium hydroxide aqueous solution, stir and react for 45 to 50 hours, add dichloromethane, separate the layers, and collect the lower layer solution; Add hydrochloric acid to the lower solution, acidify for 30-35 minutes, and then separate the layers to obtain the lower liquid; The solvent in the lower layer of liquid is evaporated to dryness, thereby obtaining polymethyl methacrylate in which part of the ester groups are hydrolyzed into carboxyl groups; The mass volume ratio of polymethyl methacrylate, tetrahydrofuran, sodium hydroxide aqueous solution, dichloromethane and hydrochloric acid is (0.5-1) g: (15-20) mL: (15-20) mL: (15-20) mL: (10-15) mL; The concentration of sodium hydroxide aqueous solution is 2-3 mol / L; The concentration of hydrochloric acid is 1-2 mol / L.

3. A method for preparing a tin dioxide transistor biosensor as claimed in any one of claims 1 to 2, characterized in that: The following steps are involved: Prepare at least one transistor unit on the surface of the substrate, each transistor unit comprising a plurality of source electrodes and drain electrodes arranged alternately with each other, and a transistor channel is formed between the source electrodes, the drain electrodes and the substrate; Prepare a methoxyethanol solution containing SnCl2; Applying a methoxyethanol solution containing SnCl2 into a transistor channel and annealing to form a tin dioxide film layer on the surface of the transistor channel; preparing an N,N-dimethylimide solution containing polymethyl methacrylate in which some ester groups are hydrolyzed into carboxyl groups; An N,N-dimethylimide solution of polymethyl methacrylate containing a part of ester groups hydrolyzed into carboxyl groups is coated on the surface of the tin dioxide film layer and dried to form a polymethyl methacrylate material layer containing a part of ester groups hydrolyzed into carboxyl groups on the surface of the tin dioxide film layer.

4. The method for preparing the tin dioxide transistor biosensor according to claim 3, characterized in that: After a polymethyl methacrylate material layer in which some ester groups are hydrolyzed into carboxyl groups is formed on the surface of the tin dioxide film layer, a mixed aqueous solution containing EDC and NHS is also added to the surface of the polymethyl methacrylate material layer in which some ester groups are hydrolyzed into carboxyl groups to activate the carboxyl functional groups of the polymethyl methacrylate material layer in which some ester groups are hydrolyzed into carboxyl groups.

5. The method for preparing the tin dioxide transistor biosensor according to claim 3, characterized in that: The methoxyethanol solution containing SnCl2 is coated in the transistor channel. In the annealing step, the concentration of SnCl2 in the methoxyethanol solution containing SnCl2 is 0.3-1.5 g / mL, the annealing temperature is 620-625°C, and the time is 150-160 min; And / or, the N,N-dimethylimide solution of polymethyl methacrylate containing part of its ester groups hydrolyzed into carboxyl groups is coated on the surface of the tin dioxide film layer, and in the drying step, the concentration of polymethyl methacrylate containing part of its ester groups hydrolyzed into carboxyl groups in the N,N-dimethylimide solution of polymethyl methacrylate containing part of its ester groups hydrolyzed into carboxyl groups is 0.05-0.06 g / mL, the drying temperature is 120-130° C., and the time is 20-30 min.

6. The method for preparing the tin dioxide transistor biosensor according to claim 4, characterized in that: A mixed aqueous solution containing EDC and NHS is added dropwise to the surface of the polymethyl methacrylate material layer in which some ester groups are hydrolyzed into carboxyl groups and reacted for 20 to 40 minutes, wherein the EDC concentration in the mixed aqueous solution containing EDC and NHS is 74 to 75 mg / mL and the NHS concentration is 11 to 12 mg / mL.

7. Use of the tin dioxide transistor biosensor as claimed in any one of claims 1 to 2 or the tin dioxide transistor biosensor prepared by the preparation method as claimed in any one of claims 3 to 6 in detecting cortisol concentration solution.

8. A method for detecting cortisol concentration, characterized in that: The method of using the tin dioxide transistor biosensor according to any one of claims 1 to 2 or the tin dioxide transistor biosensor prepared by the preparation method according to any one of claims 3 to 6 for detection comprises the following steps: The cortisol aptamer DNA solution is dropped onto the surface of the polymethyl methacrylate material layer in which part of the ester groups are hydrolyzed into carboxyl groups, and the cortisol aptamer DNA is fixed by incubation; the incubated tin dioxide transistor biosensor is placed in a PBS buffer solution, the voltage between the source and the drain is fixed, the gate electrode voltage is changed, the channel current curve is measured, and the current value I0 at Vgs = 0.8V is read; The sample to be tested is added dropwise to the surface of the polymethyl methacrylate material layer in which some ester groups are hydrolyzed into carboxyl groups after fixing the cortisol aptamer DNA, and incubated; the incubated tin dioxide transistor biosensor is placed in a PBS buffer solution, the voltage between the source and the drain is fixed, the gate electrode voltage is changed, the channel current curve is measured, and the current value I at Vgs = 0.8V is read; Calculate the current change ΔI ds =|(I-I0) / I0|; Calculate the cortisol concentration in the sample to be tested based on the change in current; The Vgs represents the voltage between the gate and the source.

9. The method for detecting cortisol concentration according to claim 8, wherein: The gene sequence of the cortisol aptamer DNA is GGAATGGATCCACATCCATGGATGGGCAATGCGGG GTGGAGAATGGTTGCCGCACTTCGGCTTCACTGCAGACTTGACGAAGCTT-(CH2)6-NH2.

10. The method for detecting cortisol concentration according to claim 8, wherein: The cortisol aptamer DNA solution is added dropwise to the surface of the polymethyl methacrylate material layer in which some ester groups are hydrolyzed into carboxyl groups, and in the incubation step, the incubation temperature is 20 to 25° C. and the time is 1 to 2 hours; The sample to be tested is added dropwise onto the surface of the polymethyl methacrylate material layer in which some ester groups are hydrolyzed into carboxyl groups after fixing the cortisol aptamer DNA, and in the incubation step, the incubation temperature is 35-37° C. and the time is 20-30 min; The preparation method of the cortisol aptamer DNA solution is as follows: adding the cortisol aptamer DNA into a PBS buffer solution to obtain the cortisol aptamer DNA solution; The concentration of the cortisol aptamer DNA in the cortisol aptamer DNA solution is 1-2 μM.