Preparation method and application of streptomycin electrochemical bionic imprinting aptamer sensor

Abstract

The invention discloses a preparation method and application of a streptomycin electrochemical bionic imprinting aptamer sensor, and the sensor combines a bionic imprinting technology with an aptamer, and successfully constructs a streptomycin electrochemical sensor with double recognition performance based on an MXene / gold nanoparticle composite sensitizing material by applying an electropolymerization method. The method is used for high-sensitivity analysis of trace streptomycin residues in animal-derived food. Under the optimal detection condition, the detection limit of the sensor is 0.0316 pmol / L, the linear range is 1.0 * 10 <-12 > mol / L to 1.0 * 10 <-4 > mol / L, the adding standard recovery rate is 88.0% to 105.8%, and the relative standard deviation is 1.7% to 2.3%. The constructed dual-recognition electrochemical sensor has the characteristics of strong specificity, high sensitivity, good repeatability and the like, and has wide adaptability and wide application prospects in the field of analysis and detection of trace substances in complex matrixes.

Description

Technical Field

[0001] The present invention belongs to the technical field of animal-derived food inspection, and particularly relates to a preparation method and application of a streptomycin electrochemical bionic imprinted aptamer sensor. Background Art

[0002] Streptomycin (STR) is one of the aminoglycoside antibiotics, which has strong inhibitory and killing effects on a variety of Gram-negative bacteria, thereby restricting the synthesis of their proteins. Due to its low cost and good therapeutic effect on bacterial infections, it has been widely used in livestock, aquaculture, beekeeping and crop production. However, due to the large-scale misuse and abuse of STR, many serious food safety incidents have been reported. The presence of STR residues and their related resistance genes in animal-derived foods poses a serious threat to consumers' health.

[0003] At present, the detection of STR mainly includes thin-layer chromatography, high-performance liquid chromatography, high-performance liquid chromatography-mass spectrometry, capillary electrophoresis, enzyme-linked immunosorbent assay, colloidal gold immunochromatography and microbiological methods, etc. However, due to the cumbersome, complex and time-consuming sample pretreatment process, these methods require professional operators and expensive equipment, and are affected by many factors, often unable to achieve satisfactory detection results. Therefore, there is an urgent need to develop more efficient and sensitive new methods for detecting STR residues in animal-derived foods.

[0004] Electrochemical sensing detectors have the advantages of good selectivity, high sensitivity, simple operation, short time consumption, wide adaptability and low price, and are a very promising practical sample analysis technology. Traditional SPR sensors mainly use antibodies as recognition elements. Although the detection specificity and sensitivity are good, the cost is high, the stability of the sensing chip is poor, it is more sensitive to environmental conditions, and the storage conditions are harsh, making it difficult to meet the actual detection needs.

[0005] The emergence of bionic imprinting technology and its breakthrough progress in antibody substitutes provide new ideas for solving the above problems. This technology is to prepare a polymer with specific recognition for the target molecule by artificial methods from the perspective of bionics. Its remarkable characteristics are predictability, recognition and practicability. By applying this technology, biomimetic antibodies with strong specificity and good stability, namely MIPs, can be easily obtained. During the imprinting polymerization process, the recognition performance of MIPs mainly depends on the interaction between the target molecule and the functional monomer. Therefore, introducing specific recognition groups or molecules during the pre-polymerization process and completing imprinting using a dual recognition mode is a feasible way to improve the substrate recognition specificity of MIPs, and nucleic acid aptamers, as a new type of recognition element, have the advantages of convenient preparation, easy modification and good specificity. Summary of the Invention

[0006] To solve the above problems, the present invention provides a preparation method and application of a streptomycin electrochemical bionic imprinted aptamer sensor. The sensor has high sensitivity and selectivity for the determination of trace streptomycin. The sensor has a low detection limit and a wide linear range, and can be used for the rapid and accurate monitoring of streptomycin residues in animal-derived foods.

[0007] The present invention is achieved through the following technical solutions: On the one hand, the present invention provides a preparation method of a streptomycin electrochemical bionic imprinted aptamer sensor, including the following steps: S1. Drop the anhydrous ethanol dispersion of the prepared metal carbide / gold nanoparticle composite onto the surface of a pretreated glassy carbon electrode to obtain a metal carbide / gold nanoparticle / glassy carbon electrode; S2. Mix the streptomycin solution and the streptomycin aptamer solution, incubate to prepare a streptomycin aptamer complex, and drop the prepared streptomycin aptamer complex solution onto the surface of the metal carbide / gold nanoparticle / glassy carbon electrode and dry it to obtain a streptomycin aptamer / metal carbide / gold nanoparticle / glassy carbon electrode; S3. After continuously incubating streptomycin on the surface of the streptomycin aptamer / metal carbide / gold nanoparticle / glassy carbon electrode, place the surface of the streptomycin aptamer / metal carbide / gold nanoparticle / glassy carbon electrode in a phosphate buffer solution containing a functional monomer and perform electro-polymerization by cyclic voltammetry to construct a three-dimensional bionic imprinted membrane; S4. Place the above electrode in a polar eluent and wash it with magnetic stirring, and finally obtain an imprinted polymer-aptamer / metal carbide / gold nanoparticle / glassy carbon electrode, that is, a streptomycin electrochemical bionic imprinted aptamer sensor.

[0008] Further, the pretreatment method of the glassy carbon electrode in S1 is: polish it 20 - 50 times on a suede cloth with alumina powders with particle sizes of 0.3 μm and 0.05 μm in sequence until the electrode surface is smooth, and then ultrasonically clean it with 50% nitric acid aqueous solution, 90% methanol acetic acid solution, absolute ethanol and ultrapure water in sequence.

[0009] Further, the streptomycin solution in S2 is a phosphate buffer solution of 5 μmol / L - 20 μmol / L streptomycin; The streptomycin aptamer solution is a buffer solution of 3 μmol / L - 10 μmol / L aptamer.

[0010] Further, the streptomycin aptamer sequences in S2 are one or a part of 5’-ATCCCAACCCGTCGACGGATGGGTCTGGTGTTCTGCTTTGTTCT GT-3’, 5’-TATTGCTTGGAGCCGGATCATTTGCCCTGGCTCAGGAGGACGAGGCATACGCGG-3’, 5’-TCGTCGACGGATCCGAATTCTGGTGTACTGCTACGTAC TGTCGCAGGTCGTCGCATGCGCAG-3’, 5’-TAACCCGTCGACGCGGGTCTGTTATGCTTGTACTGTCTCTTACTGCAGGTCGACGCTTGCCTG-3’, 5’-SH-(CH 2 ) 6 - TAGGATTCGTCGACGATCGGGTCGGTTCTGCTTGTTGTCGCTCGTCTGCAGTCGACGCATGCGCG-3’, 5’-SH-(CH 2 ) 6 -TAGCGATATCGTGGATCGGCCATGCTT GGTACTGTCGATCGTCTGCATCGACG-3’, 5’-SH-(CH 2 ) 6 -TACCGATGTCGTCG ACGCATACTGGCTTTGTTCTGCACGTCCGCACACGCAG-3’, 5’-SH-(CH 2 ) 6 -TA GAGTCATCGTCTGTGTCTGCCTACTGCAGCTCGACGCATGGGCTG-3’, 5’-SH- (CH 2 ) 6 -TAGGGAATTCGTCGACGGATCCGGGGTCTGGTGTTCTGCTTTGTTCT GTCGGGTCGTCTGCAGGTCGACGCATGCGCCG-3’.

[0011] Further, the incubation temperature in S3 is 30 °C - 40 °C, and the incubation time is 1 h - 3 h.

[0012] Further, the functional monomer in S3 is one of thiophene, styrene, o-phenylenediamine, p-phenylenediamine, aniline, pyrrole, and dopamine or their structural derivatives, and the pH value of the phosphate buffer solution is 5.5 - 9.5.

[0013] Further, the parameters of cyclic voltammetry electro-polymerization in S3 are as follows: the potential range is -0.5 V - +1.0 V, the scanning rate is one of 25 mV / s, 50 mV / s, 75 mV / s and 100 mV / s, and the number of polymerization cycles is 10 - 30 cycles.

[0014] Further, the polar eluent in S4 is a mixed solution of methanol and acetic acid, and the elution time is 10 min - 30 min.

[0015] On the one hand, the present invention also provides a streptomycin electrochemical bionic imprinted aptamer sensor prepared by the above preparation method.

[0016] On the other hand, the present invention also provides the application of the streptomycin electrochemical bionic imprinted aptamer sensor in the detection of streptomycin.

[0017] The beneficial effects of the present invention are as follows: 1. The present invention combines bionic imprinting with high selectivity and sensitivity and aptamers with high specificity to construct a dual-recognition electrochemical bionic imprinted aptamer sensor for detecting trace streptomycin residues in animal-derived foods. Introducing aptamers into the preparation system of MIPs can promote the improvement of the performance of MIPs to a greater extent. Combining aptamers with bionic imprinting technology can not only rearrange and optimize the recognition fragments or sites of aptamers within MIPs, improve the specificity and affinity of recognition, reduce ineffective fragments, and promote their efficient utilization, but also fix the structure of aptamers by placing them in polymer matrices, enhance stability, and improve the tolerance to environmental conditions; 2. The present invention uses the MXene / AuNPs composite material as a sensitizing material, STR as a template molecule, and dopamine as a functional monomer, and prepares a streptomycin electrochemical bionic imprinted aptamer sensor by cyclic voltammetry electro-polymerization.

[0018] 3. The streptomycin electrochemical bionic imprinted aptamer sensor prepared by the present invention has good selectivity for streptomycin residues in animal-derived foods, with a detection limit of 0.0316 pmol / L and a linear range of 1.0×10 -12 mol / L - 1.0×10 -4 mol / L. The spiked recovery rate in actual samples is 88.0% - 105.8%, and the relative standard deviation is 1.7% - 2.3%, providing a new electrochemical method for the quantitative detection of STR residues in animal-derived foods. Description of the Drawings

[0019] Figure 1 is the process flow chart of the preparation method described in the present invention; Figure 2(A) is the linear relationship between the peak current difference and the logarithm of the concentration after the MIP-Apt / MXene / AuNPs / GCE in Example 1 of the present invention adsorbs different concentrations (1×10 -12 mol / L - 1×10 -4 mol / L) of STR; Figure 2 (B) is the DPV diagram of the MIP-Apt / MXene / AuNPs / GCE adsorbing different concentrations of STR; Figure 3 is the selective detection result of the streptomycin and streptomycin structural analogs by the bionic imprinting electrochemical aptasensor in Example 1 of the present invention; Figure 4 (A) is the linear relationship between the peak current difference and the logarithm of the concentration after the MIP-Apt / MXene / AuNPs / GCE in Example 2 of the present invention adsorbes different concentrations (1×10 -12 mol / L - 1×10 -4 mol / L) of STR; Figure 4 (B) is the DPV diagram of the MIP-Apt / MXene / AuNPs / GCE adsorbing different concentrations of STR; Figure 5 is the selective detection result of the streptomycin and streptomycin structural analogs by the bionic imprinting electrochemical aptasensor in Example 2 of the present invention; Figure 6 (A) is the linear relationship between the peak current difference and the logarithm of the concentration after the MIP-Apt / MXene / AuNPs / GCE in Example 3 of the present invention adsorbes different concentrations (1×10 -12 mol / L - 1×10 -4 mol / L) of STR; Figure 6 (B) is the DPV diagram of the MIP-Apt / MXene / AuNPs / GCE adsorbing different concentrations of STR; Figure 7 is the selective detection result of the streptomycin and streptomycin structural analogs by the bionic imprinting electrochemical aptasensor in Example 3 of the present invention. Detailed implementation manners

[0020] A preparation method of a streptomycin electrochemical bionic imprinting aptasensor includes the following steps: (1) Preparation of composite materials Synthesize MXene and MXene / AuNPs composites.

[0021] The method for synthesizing MXene is: Add 6 - 12 mol / L HCl to the inner lining of a polytetrafluoroethylene reactor, then add 1 g of LiF and react for 10 - 25 min. After that, add 1 g of Ti 3 AlC2 The powder was added to the mixed solution in batches, and this process needed to be completed in an ice bath to avoid heat release due to intense reaction; the above solution was magnetically stirred at 40 - 50 °C for 18 - 24 h, and the resulting solution was centrifuged to obtain a black powdery solid, which was repeatedly rinsed with deionized water until the pH of the supernatant reached about 6; 120 mL of ethanol was added to the precipitate, nitrogen was injected into it and then sealed, and it was ultrasonically treated in ice water; centrifuged (8000 - 10000 rpm, 15 - 25 min), the precipitate was redispersed in 150 mL of deionized water, sealed after nitrogen was passed through, and ultrasonically treated in an ice bath; finally, the unetched Ti 3 AlC 2 The bulk material was separated from the relatively larger Ti 3 C 2 T x The flaky material, and the upper black liquid was the Ti 3 C 2 T x MXene nanosheet solution.

[0022] The upper MXene nanosheet solution was freeze-dried into a powder. The preparation steps of MXene / AuNPs were as follows: Weigh 10 - 20 mg of MXene solid powder and add it to 30 - 50 mL of ultrapure water, and disperse it evenly using ultrasound. Under the condition of slight shaking, slowly add 300 - 600 μL of chloroauric acid solution. After reacting for 10 - 30 min, centrifuge (5000 rpm, 20 min) to remove the supernatant, and freeze-dry the precipitate to obtain the MXene / AuNPs composite material.

[0023] (2) Preparation of the modified electrode The anhydrous ethanol dispersion of the MXene / AuNPs composite was drop-coated on the surface of the pretreated glassy carbon electrode to obtain MXene / AuNPs / GCE.

[0024] The method for pretreating the glassy carbon electrode was: The GCE was polished on a suede cloth with alumina powder of particle sizes 0.3 μm and 0.05 μm for 20 - 50 times in sequence until the electrode surface was smooth, and after rinsing, the water droplets were semicircular; ultrasonically cleaned with 50% nitric acid aqueous solution, anhydrous ethanol, and ultrapure water for 3 min in sequence to remove contamination impurities, and finally the electrode was placed in 1 mol / L H 2 SO 4 solution for activation, and then the electrode was placed in 5 mmol / L K 3 [Fe(CN) 6 / K 4 [Fe(CN) 6CV scans were performed in a solution (containing 0.1 mol / L KCl) with a scanning range of -0.2 V to +0.6 V. When the scanning potential difference was less than or equal to 90 mV, it was reserved for subsequent use.

[0025] (3) Preparation of STR Electrochemical Bionic Imprinted Aptasensor Add 10 μL of 3 - 10 μmol / L Apt in TB buffer to 10 μL of 5 - 20 μmol / L STR in PBS and keep it at 37 °C for 1 h to obtain the Apt[STR] complex; the obtained Apt[STR] complex solution was drop-coated onto the surface of MXene / AuNPs / GCE and dried to obtain Apt[STR] / MXene / AuNPs / GCE.

[0026] After continuing to incubate STR on the surface of Apt[STR] / MXene / AuNPs / GCE, wash the surface of Apt[STR] / MXene / AuNPs / GCE with 0.1 mol / L PBS with a pH of 7.4 to remove the unbound Apt on the modified electrode surface.

[0027] Place the surface of Apt[STR] / MXene / AuNPs / GCE in a phosphate buffer solution containing dopamine and perform electro-polymerization using cyclic voltammetry. The potential range is -0.5 V to +1.0 V, and the scanning rate is one of 25 mV / s, 50 mV / s, 75 mV / s, and 100 mV / s, and the number of polymerization cycles is 10 - 30 cycles to construct a three-dimensional bionic imprinted membrane.

[0028] Place the above electrode in a polar eluent and stir it magnetically for a certain time to remove STR in the pores on the surface of electro-polymerized Apt[STR] / MXene / AuNPs / GCE, generating imprinted cavities in the three-dimensional bionic imprinted membrane. Wash away non-specifically adsorbed molecules, residual solvents, and eluents with PBS and deionized water, and finally obtain MIP-Apt / MXene / AuNPs / GCE. The polar eluent is a mixed solution of methanol and acetic acid, and the elution time is 10 - 30 min. Prepare a non-imprinted electrode (NIP-Apt / MXene / AuNPs / GCE). The preparation method of the NIP electrode is the same as that of the MIP, except that the template molecule STR is not added.

[0029] The specific steps for using the streptomycin electrochemical bionic imprinted aptamer sensor described in the present invention for the residual analysis of streptomycin in animal-derived foods are as follows: Collect 5 g of animal-derived food samples. After extraction with an organic solvent, add 2.5% (v / v) trichloroacetic acid solution, mix well, and adjust the pH value. Vortex and mix the mixture evenly and perform ultrasonic treatment. Centrifuge to collect the supernatant, and make up the volume with acetonitrile. Centrifuge the mixed solution, take the supernatant, dilute it with phosphate buffer solution, and load it for detection.

[0030] The present invention will be further described below in conjunction with the accompanying drawings and specific preferred embodiments, but the protection scope of the present invention is not limited thereby.

[0031] Example 1 The present invention uses an electropolymerization method to prepare and detect a bionic imprinted membrane on the electrode surface. The specific preparation steps are as follows: (1) Add 20 mL of 9 mol / L HCl to the inner lining of a polytetrafluoroethylene reactor, and then add 1 g of LiF and react for 10 min. Then, add 1 g of Ti 3 AlC 2 powder in batches to the mixed solution. This process needs to be completed in an ice bath to avoid heat release due to intense reaction. Magnetically stir the above solution at 40 °C for 24 h. After centrifugation of the obtained solution, a black powdery solid is obtained, which is repeatedly rinsed with deionized water until the pH of the supernatant reaches about 6. Add 120 mL of ethanol to the precipitate, inject nitrogen and seal it, and perform ultrasonic treatment in ice water. Centrifuge (10000 rpm, 15 min), redisperse the precipitate in 150 mL of deionized water, inject nitrogen and seal it, and perform ultrasonic treatment in an ice bath. Finally, separate the unetched Ti 3 AlC 2 blocky substances from the relatively large Ti 3 C 2 T x flake-like substances. The upper black liquid is the Ti 3 C 2 T x MXene nanosheet solution.

[0032] (2) Freeze-dry the upper-layer MXene nanosheet solution into a powder. The preparation steps of MXene / AuNPs are as follows: Weigh 20 mg of MXene solid powder and add it to 50 mL of ultrapure water, and disperse it evenly using ultrasound. Under mild shaking conditions, slowly add 600 μL of chloroauric acid solution. After reacting for 10 min, centrifuge (5000 rpm, 20 min) to remove the supernatant, and freeze-dry the precipitate to obtain the MXene / AuNPs composite material.

[0033] (3) The GCE was polished 20 times successively with alumina powders of 0.3 μm and 0.05 μm particle sizes on a suede cloth and then polished until the electrode surface was smooth. After rinsing, the water droplets were semicircular. It was ultrasonically cleaned with 50% nitric acid aqueous solution, absolute ethanol, and ultrapure water for 3 min in turn to remove contaminating impurities. Finally, the electrode was placed in 1 mol / L H 2 SO 4 solution for activation. After that, the electrode was placed in 5 mmol / L K 3 [Fe(CN) 6 / K 4 [Fe(CN) 6 solution (containing 0.1 mol / L KCl) for CV scanning. The scanning range was -0.2 V - +0.6 V. When the scanning potential difference was less than or equal to 90 mV, it was prepared for subsequent use.

[0034] (4) The MXene / AuNPs composite material was dispersed evenly in absolute ethanol, and 5 μL of the dispersion was pipetted and dropped onto the surface of the pretreated GCE.

[0035] (5) 5 μmol / L 10 μL of Apt TB buffer solution was added to 10 μmol / L 10 μL of STR in PBS and kept at 37 °C for 1 h to obtain the Apt[STR] complex. 10 μL of the obtained complex solution was pipetted and dropped onto the surface of MXene / AuNPs / GCE and dried for 5 h to obtain Apt[STR] / MXene / AuNPs / GCE. In order to make the free Apt on the electrode surface fully saturated, 10 μmol / L 10 μL of STR was further incubated on the surface of Apt[STR] / MXene / AuNPs / GCE for 1 h. The surface of Apt[STR] / MXene / AuNPs / GCE was washed with PBS of pH 7.4 and 0.1 mol / L to remove the unbound Apt on the surface of the modified electrode.

[0036] (6) The surface of Apt[STR] / MXene / AuNPs / GCE was placed in a phosphate buffer solution of dopamine with pH 7.4 and 5 mmol / L, and electro-polymerization was carried out by cyclic voltammetry. The potential range was -0.5 V - +1.0 V, the scanning rate was 50 mV / s, and the number of polymerization cycles was 20 times to construct a three-dimensional biomimetic imprinting membrane.

[0037] (7) Place the above electrode in a methanol / acetic acid (9 / 1, v / v) eluent and wash it with magnetic stirring for 20 min to remove STR in the pores of the surface of the electro-polymerized Apt[STR] / MXene / AuNPs / GCE, generating an imprinted cavity in the three-dimensional biomimetic imprinted membrane. Wash away non-specifically adsorbed molecules, residual solvents, eluents, etc. with PBS and deionized water to obtain MIP-Apt / MXene / AuNPs / GCE. Prepare a non-imprinted electrode (NIP-Apt / MXene / AuNPs / GCE). The preparation method of the NIP electrode is the same as that of the MIP, except that the template molecule STR is not added.

[0038] (8) Sample pretreatment Use the acid precipitation method to remove milk proteins from milk. Add 2.5% (v / v) trichloroacetic acid solution to milk, mix well, and adjust the pH to 4.7. Vortex and mix the mixture evenly and perform ultrasonic treatment, centrifuge to collect the supernatant, and make up the volume with acetonitrile. Centrifuge the mixed solution, take the supernatant, and dilute it with phosphate buffer solution for standby.

[0039] (9) The constructed MIP-Apt / MXene / AuNPs / GCE re-adsorbs different concentrations of STR (from a to i, with STR concentrations of 1×10 -12 mol / L - 1×10 -4 mol / L), record the current response values before and after adsorption by DPV method, and analyze the performance of the sensor.

[0040] As can be seen from Figure 2 (A), the difference in current response shows a linear correlation with the logarithm of the STR concentration in the range of 1×10 -12 mol / L - 1×10 - 4 mol / L. The linear regression equation is (μA) = 4.8189×lgC (pmol / L) + 36.6043 ( r = 0.9956), and the detection limit is 3.16×10 -14 mol / L. Figure 2 (B) shows that as the STR concentration increases from 1×10 -12 mol / L to 1×10 -4 mol / L, the current response value continuously decreases.

[0041] (10) Apply the established method to the detection of STR in milk samples, and the spiked concentrations are 1×10 3 pmol / L, 1×10 4 pmol / L and 5×10 4pmol / L. Each sample was measured in parallel three times, and the results are shown in Table 1. The average recovery rate of STR in the samples was 88.0% - 105.8%, and the RSD was less than or equal to 3.1%.

[0042] Table 1 Detection of streptomycin in milk samples using an electrochemical bionic imprinted aptasensor The present invention further detected the selectivity, stability and repeatability of the streptomycin electrochemical bionic imprinted aptasensor.

[0043] Interference substances with structures similar to streptomycin were selected for control experiments to evaluate the selectivity of the constructed sensor. Figure 3 Shows the values after MIP-Apt / MXene / AuNPs / GCE was incubated in 1 nmol / L STR and 100-fold concentrations of interference substances (i.e., 100 nmol / L dihydrostreptomycin, 100 nmol / L neomycin, and 100 nmol / L kanamycin), respectively. It can be seen that the selective recognition of the sensor for STR is much higher than that of other analogues and is not affected by other substances.

[0044] The MIP-Apt / MXene / AuNPs / GCE electrode was stored at 4°C in a refrigerator for 14 days, and measurements were performed every 2 days to determine the stability of the sensor. After 14 days, the response current value decreased to 94.21% of the original value. Under the same conditions, three GCEs were selected to construct streptomycin electrochemical bionic imprinted aptasensors and the same concentration of STR was measured. The RSD calculated from the obtained data was 4.15%.

[0045] Example 2: The present invention uses electro-polymerization method to prepare and detect a bionic imprinted membrane on the electrode surface. The specific preparation steps are as follows: (1) Add 15 mL of 12 mol / L HCl to the inner lining of a polytetrafluoroethylene reactor, then add 1 g of LiF and react for 15 min. Then add 1 g of Ti 3 AlC 2The powder was added to the mixed solution in batches, and this process needed to be completed in an ice bath to avoid heat release due to intense reaction. The above solution was magnetically stirred at 45 °C for 20 h. The resulting solution was centrifuged to obtain a black powdery solid, which was repeatedly rinsed with deionized water until the pH of the supernatant reached about 6.5. 120 mL of ethanol was added to the precipitate, and nitrogen was injected into it and then sealed, followed by ultrasonic treatment in ice water. Centrifugation (9000 rpm, 18 min) was carried out, and the precipitate was redispersed in 150 mL of deionized water, sealed after nitrogen was passed through, and ultrasonic treatment was carried out in an ice bath. Finally, the unetched Ti 3 AlC 2 bulk material was separated from the relatively larger Ti 3 C 2 T x flake material. The upper black liquid was the Ti 3 C 2 T x MXene nanosheet solution.

[0046] (2) The upper MXene nanosheet solution was freeze-dried into a powder. The preparation steps of MXene / AuNPs were as follows: Weigh 10 mg of MXene solid powder and add it to 30 mL of ultrapure water, and disperse it evenly using ultrasound. Under the condition of slight shaking, slowly add 500 μL of chloroauric acid solution. After reacting for 10 min, centrifuge (5000 rpm, 20 min) to remove the supernatant, and freeze-dry the precipitate to obtain the MXene / AuNPs composite material.

[0047] (3) The GCE was polished 35 times successively with alumina powders with particle sizes of 0.3 μm and 0.05 μm on suede until the electrode surface was smooth. After rinsing, the water droplets were in a semi-circular shape. It was ultrasonically cleaned for 3 min successively with 50% nitric acid aqueous solution, absolute ethanol, and ultrapure water to remove contaminating impurities. Finally, the electrode was placed in 1 mol / L H 2 SO 4 solution for activation, and then the electrode was placed in 5 mmol / L K 3 [Fe(CN) 6 / K 4 [Fe(CN) 6 solution (containing 0.1 mol / L KCl) for CV scanning. The scanning range was -0.2 V - +0.6 V. When the scanning potential difference was less than or equal to 90 mV, it was prepared for subsequent use.

[0048] (4) The MXene / AuNPs composite material was dispersed evenly in absolute ethanol, and 8 μL of the dispersion was pipetted and dropped onto the surface of the pretreated GCE.

[0049] (5) Add 8 μmol / L 10 μ L of Apt TB buffer solution to 8 μmol / L 10 μ L of STR in PBS, and keep it at 35 °C for 2 h to obtain the Apt[STR] complex. Take 10 μL of the obtained Apt[STR] complex solution and drop-coat it onto the surface of MXene / AuNPs / GCE and dry for 5 h to obtain Apt[STR] / MXene / AuNPs / GCE. In order to fully saturate the free Apt on the electrode surface, continue to incubate 8 μmol / L 10 μL of STR on the surface of Apt[STR] / MXene / AuNPs / GCE for 1 h. Wash the surface of Apt[STR] / MXene / AuNPs / GCE with PBS with a pH of 7.4 and 0.1 mol / L to remove the unbound Apt on the modified electrode surface.

[0050] (6) Place the surface of Apt[STR] / MXene / AuNPs / GCE in a phosphate buffer solution containing 5 mmol / L dopamine with a pH of 6.5, and perform cyclic voltammetry electro-polymerization. The potential range is -0.5 V - +1.0 V, the scanning rate is 75 mV / s, and the number of polymerization cycles is 25 times to construct a three-dimensional biomimetic imprinted membrane.

[0051] (7) Place the above electrode in a methanol / acetic acid (8 / 2, v / v) eluent and stir magnetically for 15 min to remove STR in the pores on the surface of electro-polymerized Apt[STR] / MXene / AuNPs / GCE, generating an imprinted cavity in the three-dimensional biomimetic imprinted membrane. Wash away non-specifically adsorbed molecules, residual solvents, eluents, etc. with PBS and deionized water to obtain MIP-Apt / MXene / AuNPs / GCE. Prepare a non-imprinted electrode (NIP-Apt / MXene / AuNPs / GCE). The preparation method of the NIP electrode is the same as that of the MIP, except that the template molecule STR is not added.

[0052] (8) Sample pretreatment Use the acid precipitation method to remove proteins in pork. Add 2.5% (v / v) trichloroacetic acid solution to pork, mix evenly, and adjust the pH to 4.7. Vortex and mix the mixture evenly and perform ultrasonic treatment, centrifuge to collect the supernatant, and make up the volume with acetonitrile. Centrifuge the mixed solution, take the supernatant, and dilute it with phosphate buffer solution for standby.

[0053] (9) The constructed MIP-Apt / MXene / AuNPs / GCE re-adsorbs different concentrations of STR (from a to i, the STR concentrations are 1×10 -12 mol / L - 1×10-4 mol / L), and the current response values before and after adsorption were recorded by DPV method to analyze the performance of the sensor.

[0054] From Figure 4 Figure (A), it can be seen that the difference in current response and the logarithm of the STR concentration are linearly correlated in the range of 1×10 -12 mol / L - 1×10 - 4 mol / L. The linear regression equation is (μA) = 5.2357×lgC (pmol / L) + 34.2817 ( r = 0.9955), and the detection limit is 0.0416 pmol / L. Figure 4 Figure (B) shows that as the STR concentration increases from 1×10 -12 mol / L to 1×10 -4 mol / L, the current response value continuously decreases.

[0055] (10) The established method was applied to the detection of STR in pork samples. The spiked concentrations were 1×10 3 pmol / L, 1×10 4 pmol / L and 5×10 4 pmol / L respectively. Each sample was measured in parallel 3 times. The results are shown in Table 2. The average recovery rate of STR in the samples was 95.0% - 104.2%, and the RSD was less than or equal to 5.5%.

[0056] Table 2 Detection of streptomycin in pork samples by the electrochemical bionic imprinted aptasensor The present invention further detected the selectivity, stability and repeatability of the streptomycin electrochemical bionic imprinted aptasensor.

[0057] Interference substances with structures similar to streptomycin were selected for control experiments to evaluate the selectivity of the constructed sensor. Figure 5 Figure shows the values after MIP-Apt / MXene / AuNPs / GCE was incubated in 1 nmol / L STR and 100-fold concentrations of interference substances (i.e., 100 nmol / L dihydrostreptomycin, 100 nmol / L neomycin and 100 nmol / L kanamycin) respectively. It can be seen that the selective recognition of the sensor for STR is much higher than that of other analogues and is not affected by other substances.

[0058] The MIP-Apt / MXene / AuNPs / GCE electrode was stored in a refrigerator at 4 °C for 14 days, and measurements were taken every 2 days to determine the stability of the sensor. After 14 days, the response current value dropped to 92.36% of the original value. Under the same conditions, three GCEs were selected to construct streptomycin electrochemical bionic imprinted aptasensors and the same concentration of STR was measured. The RSD calculated from the obtained data was 5.32%.

[0059] Example 3: In the present invention, an electro-polymerization method is used to prepare and detect a bionic imprinted membrane on the electrode surface. The specific preparation steps are as follows: (1) Add 30 mL of 6 mol / L HCl to the inner lining of a polytetrafluoroethylene reactor, and then add 1 g of LiF. After reacting for 25 min, add 1 g of Ti 3 AlC 2 powder in batches to the mixed solution. This process needs to be completed in an ice bath to avoid heat release due to intense reaction. Stir the above solution magnetically at 50 °C for 18 h. The resulting solution is centrifuged to obtain a black powdery solid, which is repeatedly rinsed with deionized water until the pH of the supernatant reaches about 7. Add 120 mL of ethanol to the precipitate, inject nitrogen and seal it, and perform ultrasonic treatment in ice water. Centrifuge (8000 rpm, 25 min), redisperse the precipitate in 150 mL of deionized water, inject nitrogen and seal it, and perform ultrasonic treatment in an ice bath. Finally, separate the unetched Ti 3 AlC 2 blocky substances and relatively large Ti 3 C 2 T x flake-like substances. The upper black liquid is the Ti 3 C 2 T x MXene nanosheet solution.

[0060] (2) Freeze-dry the upper-layer MXene nanosheet solution into a powder. The preparation steps of MXene / AuNPs are as follows: Weigh 15 mg of MXene solid powder and add it to 40 mL of ultrapure water, and disperse it evenly by ultrasonic treatment. Under mild shaking conditions, slowly add 300 μL of chloroauric acid solution. After reacting for 30 min, centrifuge (5000 rpm, 20 min) to remove the supernatant, and freeze-dry the precipitate to obtain the MXene / AuNPs composite material.

[0061] (3) Polish the GCE successively with alumina powders of 0.3 μm and 0.05 μm particle sizes on suede cloth for 45 times until the electrode surface is smooth. After rinsing, the water drops form a semi-circular shape. Ultrasonically clean the electrode successively with 50% nitric acid aqueous solution, absolute ethanol, and ultrapure water for 3 min to remove contamination impurities. Finally, place the electrode in 1 mol / L H 2 SO 4 solution for activation. Then, place the electrode in 5 mmol / L K 3 [Fe(CN) 6 / K 4 [Fe(CN) 6 solution (containing 0.1 mol / L KCl) for CV scanning. The scanning range is -0.2 V - +0.6 V. When the scanning potential difference is less than or equal to 90 mV, it is prepared for subsequent use.

[0062] (4) Disperse the MXene / AuNPs composite material evenly in absolute ethanol, and pipette 10 μL of the dispersion and drop-coat it on the surface of the pretreated GCE.

[0063] (5) Add 9 μmol / L 10 μL Apt TB buffer solution to 15 μmol / L 10 μL STR in PBS and keep it at 40 °C for 3 h to obtain the prepared Apt[STR] complex. Pipette 10 μL of the obtained Apt[STR] complex solution and drop-coat it on the surface of MXene / AuNPs / GCE and dry it for 5 h to obtain Apt[STR] / MXene / AuNPs / GCE. To fully saturate the free Apt on the electrode surface, incubate 15 μmol / L 10 μL of STR on the surface of Apt[STR] / MXene / AuNPs / GCE for 1 h. Wash the surface of Apt[STR] / MXene / AuNPs / GCE with PBS of pH 7.4 and 0.1 mol / L to remove the unbound Apt on the modified electrode surface.

[0064] (6) Place the surface of Apt[STR] / MXene / AuNPs / GCE in a phosphate buffer solution containing 5 mmol / L dopamine with pH 8.5, and electro-polymerize it by cyclic voltammetry. The potential range is -0.5 V - +1.0 V, the scanning rate is 100 mV / s, and the number of polymerization cycles is 30 times to construct a three-dimensional biomimetic imprinting membrane.

[0065] (7) The above electrodes were placed in a methanol / acetic acid (7 / 3, v / v) eluent and washed by magnetic stirring for 25 min to remove STR in the pores on the surface of the electro-polymerized Apt[STR] / MXene / AuNPs / GCE, generating imprinted cavities in the three-dimensional biomimetic imprinted membrane. Non-specifically adsorbed molecules, residual solvents, eluents, etc. were washed away with PBS and deionized water to obtain MIP-Apt / MXene / AuNPs / GCE. A non-imprinted electrode (NIP-Apt / MXene / AuNPs / GCE) was prepared. The preparation method of the NIP electrode was the same as that of the MIP, except that the template molecule STR was not added.

[0066] (8) Sample pretreatment The acid precipitation method was used to remove proteins in eggs. A 2.5% (v / v) trichloroacetic acid solution was added dropwise to the eggs, mixed evenly, and the pH was adjusted to 4.7. The mixture was vortexed and mixed evenly and then ultrasonicated, centrifuged to collect the supernatant, and made up to volume with acetonitrile. The mixed solution was centrifuged, the supernatant was taken, and diluted with a phosphate buffer solution for standby.

[0067] (9) The constructed MIP-Apt / MXene / AuNPs / GCE was re-adsorbed with different concentrations of STR (from a to i, the STR concentrations were 1×10 -12 mol / L - 1×10 -4 mol / L) in sequence, and the current response values before and after adsorption were recorded by DPV method to analyze the performance of the sensor.

[0068] As can be seen from Figure 6 (A), the difference in current response and the logarithm of the STR concentration were linearly correlated in the range of 1×10 -12 mol / L - 1×10 - 4 mol / L. The linear regression equation was (μA) = 5.1733×lgC (pmol / L) + 34.0741 ( r = 0.9910), and the detection limit was 0.0723 pmol / L. Figure 6 (B) shows that as the STR concentration increased from 1×10 -12 mol / L to 1×10 -4 mol / L, the current response value continuously decreased.

[0069] (10) The established method was applied to the detection of STR in egg samples, and the spiked concentrations were 1×10 3 pmol / L, 1×10 4 pmol / L and 5×10 4pmol / L. Each sample was measured in parallel three times, and the results are shown in Table 3. The average recovery rate of STR in the samples was 85.0% - 103.6%, and the RSD was less than or equal to 4.2%.

[0070] Table 3 Detection of streptomycin in egg samples using an electrochemical bionic imprinted aptasensor The present invention further detected the selectivity, stability, and repeatability of the streptomycin electrochemical bionic imprinted aptasensor.

[0071] Interferents with structures similar to streptomycin were selected for control experiments to evaluate the selectivity of the constructed sensor. Figure 7 Shows the values after MIP-Apt / MXene / AuNPs / GCE was incubated in 1 nmol / L STR and 100-fold concentrations of interferents (i.e., 100 nmol / L dihydrostreptomycin, neomycin, and kanamycin), respectively. It can be seen that the selective recognition of the sensor for STR is much higher than that of other analogs and is not affected by other substances.

[0072] The MIP-Apt / MXene / AuNPs / GCE electrode was stored at 4 °C in a refrigerator for 14 days, and measurements were performed every 2 days to determine the stability of the sensor. After 14 days, the response current value decreased to 90.45% of the original value. Under the same conditions, three GCEs were respectively selected to construct streptomycin electrochemical bionic imprinted aptasensors and the same concentration of STR was measured. The RSD calculated from the obtained data was 6.57%.

[0073] In summary, the present invention combines the STR-specific aptamer with bionic imprinting technology, enhances the specificity of the prepolymerization system, improves the specificity of imprinting and recognition, and constructs a dual recognition mode based on aptamer and bionic imprinting. The research idea adopted has certain universality, the research method has good popularization value and broad application prospects, helps to enrich the theoretical connotation of MIPs design, and solves the problem of insufficient specificity of traditional MIPs. The established electrochemical sensing and analysis method can provide a powerful technical means for the residue monitoring of STR and also helps to better ensure food safety and human health.

[0074] It should be noted that although the present invention has been described through the above embodiments, the present invention can also have many other embodiments. Without departing from the spirit and scope of the present invention, those skilled in the art can obviously make various corresponding changes and deformations to the present invention, but these changes and deformations should all fall within the scope protected by the appended claims of the present invention and their equivalents.

Claims

1. A method for preparing a streptomycin electrochemical biomimetic imprinted aptamer sensor, characterized in that: The following steps are involved: S1, applying a droplet of anhydrous ethanol dispersion of the prepared metal carbide / gold nanoparticle composite on the surface of the pretreated glassy carbon electrode to obtain a metal carbide / gold nanoparticle / glassy carbon electrode; S2, mixing the streptomycin solution with the streptomycin aptamer solution, incubating to prepare a streptomycin aptamer complex, drop-coating the prepared streptomycin aptamer complex solution onto the surface of the metal carbide / gold nanoparticles / glassy carbon electrode and drying to obtain a streptomycin aptamer / metal carbide / gold nanoparticles / glassy carbon electrode; S3, after continuing to incubate streptomycin on the surface of streptomycin aptamer / metal carbide / gold nanoparticles / glassy carbon electrode, the surface of streptomycin aptamer / metal carbide / gold nanoparticles / glassy carbon electrode is placed in a phosphate buffer solution containing functional monomers and electropolymerized by cyclic voltammetry to construct a three-dimensional biomimetic imprinted membrane; S4. The above-mentioned electrode is placed in a polar elution solution for magnetic stirring and washing, and finally an imprinted polymer-aptamer / metal carbide / gold nanoparticle / glassy carbon electrode is obtained, namely, a streptomycin electrochemical biomimetic imprinted aptamer sensor.

2. The method for preparing a streptomycin electrochemical biomimetic imprinted aptamer sensor according to claim 1, characterized in that: The pretreatment method of the glassy carbon electrode in S1 is: polishing with alumina powder with a particle size of 0.3 μm and 0.05 μm on suede cloth 20-50 times in turn until the electrode surface is smooth, and then ultrasonically cleaning with 50% nitric acid aqueous solution, 90% methanol acetic acid solution, anhydrous ethanol and ultrapure water in turn.

3. The method for preparing a streptomycin electrochemical biomimetic imprinted aptamer sensor according to claim 1, characterized in that: The streptomycin solution in S2 is a phosphate buffer solution of 5 μmol / L - 20 μmol / L streptomycin; The streptomycin aptamer solution is a buffer solution of 3 μmol / L to 10 μmol / L aptamer.

4. The method for preparing a streptomycin electrochemical biomimetic imprinted aptamer sensor according to claim 1, characterized in that: The streptomycin aptamer sequence in S2 is 5'-ATCCCAACCCGTCGACGGATGGGTCTGGTGTTCTGCTTTGTTCTGT-3', 5'-TATTGCTTGGAGCCGGATCATTTGCCCTGGCTCAGGAGGACGAGG CATACGCGG-3', 5'-TCGTCGACGGATCCGAATTCTGGTGTACTGCTACGTAC TGTCGCAGGTCGTCGCATGCGCAG-3', 5'-TAACCCGTCGACGCGGGTCTGT TATGCTTGTACTGTCTCTTACTGCAGGTCGACGCTTGCCTG-3', 5'-SH-(CH2)6- TAGGATTCGTCGACGATCGGGTCGGTTCTGCTTGTTGTCGCTCGTCTGCAGTCGACGCATGCGCG-3', 5'-SH-(CH2)6-TAGCGATATCGTGGATCGGCCATGCTT GGTACTGTCGATCGTCTGCATCGACG-3', 5'-SH-(CH2)6-TACCGATGTCGTCG ACGCATACTGGCTTTGTTCTGCACGTCCGCACACGCAG-3', 5'-SH-(CH2)6-TA GAGTCATCGTCTGTGTCTGCCTACTGCAGCTCGACGCATGGGCTG-3', 5'-SH- One or part of (CH2)6-TAGGGAATTCGTCGACGGATCCGGGGTCTGGTGTTCTGCTTTGTTCT GTCGGGTCGTCTGCAGGTCGACGCATGCGCCG-3'.

5. The method for preparing a streptomycin electrochemical biomimetic imprinted aptamer sensor according to claim 1, characterized in that: The incubation temperature in S3 is 30 ℃ - 40 ℃, and the incubation time is 1 h - 3 h.

6. The method for preparing a streptomycin electrochemical biomimetic imprinted aptamer sensor according to claim 1, characterized in that: The functional monomer in S3 is one of thiophene, styrene, o-phenylenediamine, p-phenylenediamine, aniline, pyrrole and dopamine or their structural derivatives, and the pH value of the phosphate buffer solution is 5.5-9.

5.

7. The method for preparing a streptomycin electrochemical biomimetic imprinted aptamer sensor according to claim 1, characterized in that: The parameters of cyclic voltammetry electropolymerization in S3 are: potential range -0.5 V - +1.0 V, scan rate is one of 25 mV / s, 50 mV / s, 75 mV / s and 100 mV / s, and the number of polymerization cycles is 10 to 30 cycles.

8. The method for preparing a streptomycin electrochemical biomimetic imprinted aptamer sensor according to claim 1, characterized in that: The polar eluent in S4 is a mixed solution of methanol and acetic acid, and the elution time is 10 min - 30 min.

9. The streptomycin electrochemical biomimetic imprinted aptamer sensor prepared by the preparation method according to any one of claims 1 to 8.

10. Use of the streptomycin electrochemical biomimetic imprinted aptamer sensor according to claim 9 in detecting streptomycin.

Images