APOC3-targeting polynucleic acid molecules and uses thereof

Abstract

Disclosed herein are polynucleic acids, pharmaceutical compositions, and methods for inhibiting expression of apolipoprotein C3 (APOC3).

Description

[0001] Cross-reference

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 371,326, filed on Aug. 12, 2022, which is incorporated herein by reference in its entirety. BACKGROUND OF THE INVENTION

[0003] Apolipoprotein C3 (APOC3) is a protein encoded by the APOC3 gene. APOC3 can be secreted by the liver as well as the small intestine and can play an important role in inhibiting the uptake of triglyceride-rich particles by the liver. Thus, high plasma APOC3 is associated with high triglycerides and an increased risk of developing cardiovascular disease. Accordingly, there is a need to develop an effective, non-cytotoxic APOC3 inhibitor. The polynucleic acid molecules, their conjugates, and methods described herein meet this need and provide related advantages.

[0004] Incorporated by reference

[0005] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. If a publication, patent, or patent application incorporated by reference contradicts the disclosure contained herein, the specification is intended to supersede and / or take precedence over any such conflicting material. SUMMARY OF THE INVENTION

[0006] To meet the need for more effective APOC3 inhibitors, on the one hand, the present invention provides a polynucleic acid molecule for regulating the expression of apolipoprotein C3 (APOC3) gene, which comprises a sense strand and an antisense strand, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 1-108, 433-456, 529-534, and 553-563. In some cases, the antisense strand comprises a nucleic acid sequence that comprises at least 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive sequences of the nucleic acid sequences selected from SEQ ID NO: 1-108, 433-456, 529-534, and 553-563, with no more than 1, 2, 3, or 4 mismatches. In some cases, the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 217-324, 481-504, 541-546, and 575-585. In some cases, the sense strand comprises a nucleic acid sequence that comprises at least 14, 15, 16, 17, 18, 19, or 20 consecutive sequences of the nucleic acid sequences selected from SEQ ID NO: 217-324, 481-504, 541-546, and 575-585, with no more than 1, 2, 3, or 4 mismatches.

[0007] In some cases, the sense strand comprises the nucleic acid sequences of SEQ ID NO: 217-324, 481-504, 541-546, and 575-585, and the antisense strand comprises the nucleic acid sequences selected from SEQ ID NO: 1-108, 433-456, 529-534, and 553-563.

[0008] In some cases, the polynucleic acid molecule comprises (1) 2'-fluoro-modified nucleotides; (2) 2'-O-methyl-modified nucleotides; (3) 2'-deoxy-modified nucleotides, or (4) modified internucleotide linkages. In some cases, the polynucleic acid molecule comprises at least two consecutive modified internucleotide linkages at the 5'-end or the 3'-end.

[0009] In some cases, the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3' or 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In some cases, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3' or 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In some cases, the sense strand of the polynucleic acid molecule comprises 5'-NfnNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3', and the antisense strand of the polynucleic acid molecule comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnNfnnn-3'; the sense strand of the polynucleic acid molecule comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', and the antisense strand of the polynucleic acid molecule comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3'; the sense strand of the polynucleic acid molecule comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the antisense strand of the polynucleic acid molecule comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3'; the sense strand of the polynucleic acid molecule comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', and the antisense strand of the polynucleic acid molecule comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3'; or, the sense strand of the polynucleic acid molecule comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', and the antisense strand of the polynucleic acid molecule comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0010] In some cases, the modified internucleotide linkage is a phosphorothioate internucleotide linkage. In some cases, the modified internucleotide linkage comprises a stereochemically enriched phosphorothioate internucleotide linkage.

[0011] In some cases, the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 325 - 432, 505 - 528, 547 - 552, and 586 - 596. In some cases, the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 109 - 216, 457 - 480, 535 - 540, and 564 - 574. In some cases, the sense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 325 - 432, 505 - 528, 547 - 552, and 586 - 596, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 109 - 216, 457 - 480, 535 - 540, and 564 - 574.

[0012] On the other hand, the present disclosure provides polynucleic acid molecules for modulating the expression of apolipoprotein C3 (APOC3) gene, wherein the polynucleic acid molecule comprises: (a) an antisense strand comprising a nucleotide sequence of UUUCAGGGAACUGAAGCCAUCGG (SEQ ID NO: 529) and a sense strand comprising a nucleotide sequence of GAUGGCUUCAGUUCCCUGAAA (SEQ ID NO: 541); (b) an antisense strand comprising a nucleotide sequence of UGAAUACUGUCCCUUUUAAGCAA (SEQ ID NO: 530) and a sense strand comprising a nucleotide sequence of GCUUAAAAGGGACAGUAUUCA (SEQ ID NO: 542); (c) an antisense strand comprising a nucleotide sequence of UAGAAUACUGUCCCUUUUAAGCA (SEQ ID NO: 531) and a sense strand comprising a nucleotide sequence of CUUAAAAGGGACAGUAUUCUA (SEQ ID NO: 543); (d) an antisense strand comprising a nucleotide sequence of UUGAGAAUACUGUCCCUUUUAAG (SEQ ID NO: 532) and a sense strand comprising a nucleotide sequence of UAAAAGGGACAGUAUUCUCAA (SEQ ID NO: 544); (e) an antisense strand comprising a nucleotide sequence of UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO: 533) and a sense strand comprising a nucleotide sequence of AAAAAGGACAGUAUUCUCAGA (SEQ ID NO: 545); (f) an antisense strand comprising a nucleotide sequence of UCACUGAGAAUACUGUCCCUUUU (SEQ ID NO: 534) and a sense strand comprising a nucleotide sequence of AAGGGACAGUAUUCUCAGUGA (SEQ ID NO: 546); (g) an antisense strand comprising a nucleotide sequence of UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO: 554) and a sense strand comprising a nucleotide sequence of AAAAAGGACAGUAUUCUCAGA (SEQ ID NO: 576); (h) an antisense strand comprising a nucleotide sequence of UCUGAGAAUACUGUCCCUUUCAA (SEQ ID NO: 555) and a sense strand comprising a nucleotide sequence of GAAAGGGACAGUAUUCUCAGA (SEQ ID NO: 577); (i) an antisense strand comprising a nucleotide sequence of UCUGAGAAUACUGUCCCUUUGAA (SEQ ID NO: 556) and a sense strand comprising a nucleotide sequence of CAAAGGGACAGUAUUCUCAGA (SEQ ID NO: 578);(j) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUGCAA (SEQ ID NO: 557) and the sense strand with the nucleotide sequence containing GCAAGGGACAGUAUUCUCAGA (SEQ ID NO: 579); (k) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUCGAA (SEQ ID NO: 558) and the sense strand with the nucleotide sequence containing CGAAGGGACAGUAUUCUCAGA (SEQ ID NO: 580); (l) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO: 559) and the sense strand with the nucleotide sequence containing AAAAAGGACAGUAUUCUCAGA (SEQ ID NO: 581); (m) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUGAA (SEQ ID NO: 560) and the sense strand with the nucleotide sequence containing CAAAGGGACAGUAUUCUCAGA (SEQ ID NO: 582); (n) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO: 561) and the sense strand with the nucleotide sequence containing AAAAAGGACAGUAUUCUCAGA (SEQ ID NO: 583); (o) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO: 562) and the sense strand with the nucleotide sequence containing AAAAAGGACAGUAUUCUCAGA (SEQ ID NO: 584); or (p) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO: 563) and the sense strand with the nucleotide sequence containing AAAAAGGACAGUAUUCUCAGA (SEQ ID NO: 585).;

[0013] In another aspect, the present disclosure provides polynucleic acid molecules for modulating the expression of apolipoprotein C3 (APOC3) gene, wherein the polynucleic acid molecule comprises: (a) an antisense strand comprising the nucleotide sequence of usUfsucagGfgaacUfgAfaGfccaucsgsg (SEQ ID NO:535) and a sense strand comprising the nucleotide sequence of gsasuggcUfuCfaGfuucccugaaa (SEQ ID NO:547); (b) an antisense strand comprising the nucleotide sequence of usGfsaauaCfugucCfcUfuUfuaagcsasa (SEQ ID NO:536) and a sense strand comprising the nucleotide sequence of gscsuuaaAfaGfgGfacaguauuca (SEQ ID NO:548); (c) an antisense strand comprising the nucleotide sequence of usAfsgaauAfcuguCfcCfuUfuuaagscsa (SEQ ID NO:537) and a sense strand comprising the nucleotide sequence of csusuaaaAfgGfgAfcaguauucua (SEQ ID NO:549); (d) an antisense strand comprising the nucleotide sequence of usUfsgagaAfuacuGfuCfcCfuuuuasasg (SEQ ID NO:538) and a sense strand comprising the nucleotide sequence of usasaaagGfgAfcAfguauucucaa (SEQ ID NO:550); (e) an antisense strand comprising the nucleotide sequence of usCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO:539) and a sense strand comprising the nucleotide sequence of asasaaggGfaCfaGfuauucucaga (SEQ ID NO:551); (f) an antisense strand comprising the nucleotide sequence of usCfsacugAfgaauAfcUfgUfcccuususu (SEQ ID NO:540) and a sense strand comprising the nucleotide sequence of asasgggaCfaGfuAfuucucaguga (SEQ ID NO:552); (g) an antisense strand comprising the nucleotide sequence of vpusCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO:565) and a sense strand comprising the nucleotide sequence of asasaaggGfaCfaGfuauucucaga (SEQ ID NO:587); (h) an antisense strand comprising the nucleotide sequence of usCfsugagAfauacUfgUfcCfcuuucsasa (SEQ ID NO:566) and a sense strand comprising the nucleotide sequence of gsasaaggGfaCfaGfuauucucaga (SEQ ID NO:588);(i) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuugsasa (SEQ ID NO: 567) and the sense strand of the nucleotide sequence containing csasaaggGfaCfaGfuauucucaga (SEQ ID NO: 589); (j) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuugcsasa (SEQ ID NO: 568) and the sense strand of the nucleotide sequence containing gscsaaggGfaCfaGfuauucucaga (SEQ ID NO: 590); (k) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuucgsasa (SEQ ID NO: 569) and the sense strand of the nucleotide sequence containing csgsaaggGfaCfaGfuauucucaga (SEQ ID NO: 591); (l) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO: 570) and the sense strand of the nucleotide sequence containing (invAb)asasaaggGfaCfaGfuauucucaga (SEQ ID NO: 592); (m) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuugsasa (SEQ ID NO: 571) and the sense strand of the nucleotide sequence containing (invAb)csasaaggGfaCfaGfuauucucaga (SEQ ID NO: 593); (n) The antisense strand of the nucleotide sequence containing usCfsugdAgdAauacUfgUfcCfcuuuusasa (SEQ ID NO: 572) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO: 594); (o) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfscCfcuuuusasa (SEQ ID NO: 573) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO: 595); or (p) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcsuuuusasa (SEQ ID NO: 574) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO: 596), where "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate;"Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiolphosphate, "(invAb)" refers to reverse abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.;

[0014] In another aspect, the present disclosure provides a polynucleic acid molecule conjugate for regulating the expression of apolipoprotein C3 (APOC3) gene, wherein the polynucleic acid molecule conjugate comprises the polynucleic acid molecule described herein and an asialoglycoprotein receptor targeting moiety. In some cases, the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose.

[0015] In some cases, the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are coupled via a linker. In some cases, the linker comprises the following formula (IV), wherein at least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule. In some cases, Y1 is the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule, or Y1 and Y2 are two consecutive nucleotides in the polynucleic acid molecule. In some cases, the linker and the asialoglycoprotein receptor targeting moiety with the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule are shown in formula (V'):

[0016] wherein Z in formula (V') is -H, -OH, -O-methyl, -F or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic or others.

[0018] In some cases, the linker and the asialoglycoprotein receptor targeting moiety with the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule are shown in formula (V""): Wherein Z in formula (V"") is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V"") is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0020] In some cases, the asialoglycoprotein receptor targeting moiety of the linker and the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule is shown in formula (V'''): Wherein Z in formula (V''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V''') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0022] In some cases, the asialoglycoprotein receptor targeting moiety of the linker and the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule is shown in formula (V''''): Wherein Z in formula (V'''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0024] In another aspect, the present invention provides a pharmaceutical composition comprising the polynucleic acid molecule described herein or the polynucleic acid molecule conjugate described herein, and a pharmaceutically acceptable excipient.

[0025] In some cases, the pharmaceutical composition is formulated as a nanoparticle preparation. In some cases, the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.

[0026] In another aspect, the present disclosure provides a method of modulating the expression of apolipoprotein C3 (APOC3) gene in a subject, comprising: administering to the subject the polynucleotide molecule or the polynucleotide molecule conjugate described herein, or the pharmaceutical composition described herein, thereby modulating the expression of the APOC3 gene in the subject. In some cases, the subject in need is diagnosed with cardiovascular disease or hypertriglyceridemia, has cardiovascular disease or hypertriglyceridemia, or has symptoms of cardiovascular disease or hypertriglyceridemia.

[0027] In another aspect, the present disclosure provides a method of modulating the triglyceride level in a subject in need, comprising: administering to the subject the polynucleotide molecule or the polynucleotide molecule conjugate described herein, or the pharmaceutical composition described herein, thereby modulating the triglyceride level in the subject. In some cases, the subject in need is diagnosed with cardiovascular disease or hypertriglyceridemia, has cardiovascular disease or hypertriglyceridemia, or has symptoms of cardiovascular disease or hypertriglyceridemia. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Aspects of the present disclosure are set forth in the appended claims. The features and advantages of the present disclosure may be better understood by reference to the following detailed description that sets forth illustrative aspects, in which the principles of the present disclosure are utilized, and the following drawings.

[0029] Figures 1A - 1X Illustrates the drug response curves of selected siRNAs for inhibiting APOC3 in primary hepatocytes. Figure 1A Shows the drug response curve of SRS-000665. Figure 1B Shows the drug response curve of SRS-000770. Figure 1C Shows the drug response curve of SRS-000667. Figure 1D Shows the drug response curve of SRS-000771. Figure 1E Shows the drug response curve of SRS-000712. Figure 1F Shows the drug response curve of SRS-000772. Figure 1G Shows the drug response curve of SRS-000713. Figure 1H Shows the drug response curve of SRS-000773. Figure 1I Shows the drug response curve of SRS-000717. Figure 1J Shows the drug response curve of SRS-000774. Figure 1K Shows the drug response curve of SRS-000723. Figure 1L Shows the drug response curve of SRS-000775. Figure 1M Shows the drug response curve of SRS-000753. Figure 1NShows the drug response curve of SRS-000776. Figure 1O Shows the drug response curve of SRS-000754. Figure 1P Shows the drug response curve of SRS-000777. Figure 1Q Shows the drug response curve of SRS-000755. Figure 1R Shows the drug response curve of SRS-000778. Figure 1S Shows the drug response curve of SRS-000756. Figure 1T Shows the drug response curve of SRS-000779. Figure 1U Shows the drug response curve of SRS-000757. Figure 1V Shows the drug response curve of SRS-000780. Figure 1W Shows the drug response curve of SRS-000758. Figure 1X Shows the drug response curve of SRS-000781.

[0030] Figure 2 Shows the plasma APOC3 protein expression relative to the pre-dose level after single-dose administration of the siRNAs (SRS-000225 and SRS-000228 to SRS-000232) listed in Table 5 to cynomolgus monkeys.

[0031] Figures 3A - 3C Shows the hepatic APOC3 mRNA expression relative to the pre-dose level after single-dose administration of the siRNAs (SRS-000225 and SRS-000228 to SRS-000232) listed in Table 5 to cynomolgus monkeys. Figure 3A Shows the hepatic APOC3 mRNA expression relative to the pre-dose level (normalized to ACTB). Figure 3B Shows the hepatic APOC3 mRNA expression relative to the pre-dose level (normalized to ARL1). Figure 3C Shows the hepatic APOC3 mRNA expression relative to the pre-dose level (normalized to PPIA). Detailed Description

[0032] APOC3 is a small protein of 79 amino acid residues containing two amphipathic helices (see, for example, Gangabadage et al., J Biol Chem. 2008; 283(25):17416–17427). APOC3 has been found to be present on circulating lipoproteins, which include high density lipoprotein (HDL), low density lipoprotein (LDL), and triglyceride-rich lipoproteins (TRL), such as chylomicrons (CM) and very low density lipoprotein (VLDL).

[0033] APOC3 is an important regulator of lipid (e.g., triglyceride) metabolism and cardiovascular diseases (pathological processes associated with atherosclerosis). Specifically, studies have shown that impaired catabolism of TRL is associated with elevated plasma APOC3 levels (see, e.g., Boren et al., Arterioscler Thromb Vasc Biol. 2015;35(10):2218–2224). In addition to its effects on lipid metabolism, APOC3 has also been shown to directly affect the development of atherosclerosis.

[0034] Lifetime deficiency of APOC3 may have cardioprotective effects. Lowering plasma triglycerides by inhibiting APOC3 may be a promising strategy for managing severe hypertriglyceridemia or elevated plasma triglycerides.

[0035] This document describes a polynucleic acid molecule for regulating the expression of the APOC3 gene. In some aspects, the polynucleic acid molecule is a single-stranded nucleic acid molecule. In some aspects, the polynucleic acid molecule comprises a sense strand and an antisense strand, and wherein the polynucleic acid molecule comprises the nucleic acid sequences in Table 1, Table 3, Table 5, and Table 12. Accordingly, this document provides different target regions of human APOC3 mRNA to which the polynucleic acid molecules described herein hybridize. In some cases, this document provides the sequences of the polynucleic acid molecules described herein. In some cases, this document provides possible modifications of the polynucleic acid molecules described herein. In some cases, this document provides possible conjugates of the polynucleic acid molecules described herein.

[0036] This document also describes a method for regulating the expression of the APOC3 gene in a subject. This document further describes a method for regulating triglycerides in a subject in need thereof.

[0037] Definitions

[0038] Unless the context clearly dictates otherwise, the singular forms “a,” “an,” and “the” include plural referents. For example, the term “a cell” includes one or more cells, including mixtures thereof. As used herein, “A and / or B” includes all of the following alternative forms: “A,” “B,” “A or B,” and “A and B.”

[0039] When a range of values is provided, it is to be understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limits of that range, and any other stated value or intervening value in that range, is encompassed within the disclosure, unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit values in the range. When the range includes one or both of the limits, ranges excluding either or both of the included limits are also included in the disclosure.

[0040] Certain numerical ranges presented herein are preceded by the term "about". The term "about" is used herein to provide literal support for the exact number that it precedes, as well as numbers that are close to or approximate the number that the term precedes. In determining whether a number is close to or approximate a specifically recited number, an approximate or approximating unrecited number may be a number that provides substantially the same functionality as the specifically recited number in the context in which it is presented.

[0041] For the nucleic acid sequences identified herein, "percent (%) sequence identity" or "percent (%) identity" is defined as the percentage of nucleic acids in a candidate sequence that are identical to the nucleic acid sequence being compared, after aligning the sequences and considering any conservative substitutions as part of the sequence identity.

[0042] All ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be considered to be sufficiently described and enables the same range to be broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. By way of non-limiting example, each range discussed herein can readily be broken down into a lower third, middle third, upper third, etc. As will also be understood by those of skill in the art, all language such as "at most", "at least", "greater than", "less than", etc. includes the recited numbers and refers to ranges that can then be broken down into the subranges as discussed above. Finally, as will be understood by those of skill in the art, a range includes each individual member. Thus, for example, a group having 1 - 3 items refers to a group having 1, 2, or 3 items. Similarly, a group having 1 - 5 items refers to a group having 1, 2, 3, 4, or 5 items, etc.

[0043] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which polynucleotide molecules, polynucleotide molecule conjugates, pharmaceutical compositions, methods, and other aspects belong.

[0044] As used herein, the term "complementary" refers to a sufficient degree of complementarity between two nucleic acid molecules that bind stably and specifically, such that non-specific binding is avoided.

[0045] As used herein, the terms "polynucleic acid" and "polynucleotide" are used interchangeably to refer to a nucleotide chain. The term "nucleotide" includes the sequences "G", "C", "A", "T", and "U", each of which typically represents a nucleotide containing guanine, cytosine, adenine, thymidine, and uracil as bases. In some cases, a "nucleotide" can refer to a modified nucleotide (e.g., having a modified sugar moiety, a modified base, a modified internucleotide linkage, or a combination thereof, including but not limited to 2'-modified nucleotides, LNA, ENA, BNA, UNA, GNA, etc.). In some cases, a "nucleotide" can refer to a modified nucleotide having a non-canonical base (e.g., including but not limited to 2-thiouridine, 2-thymidine, inosine, 2-aminopurine, 2,6-diaminopurine, dihydrouridine, 4-thiouridine, 4-thymidine, 2-thiocytidine).

[0046] As used herein, an "object" can be any mammal, including humans and non-human primates.

[0047] The term "condition" as used herein includes diseases, disorders, and susceptibilities. In some cases, the condition is an APOC3-related disorder or a symptom thereof.

[0048] As used herein, the terms "treat", "treating", or "treatment" of any disease or disorder in one case refers to ameliorating the disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of its clinical symptoms). In another case, "treatment" refers to alleviating or improving at least one physical parameter, including parameters that may not be discernible by the patient. In yet another case, "treatment" refers to modulating the disease or disorder, whether physically (e.g., stabilizing a discernible symptom), physiologically (e.g., stabilizing a physical parameter), or both.

[0049] The terms "prevent", "preventing", and "prevention" as used herein refer to reducing the pathogenesis of a condition in an object that does not have a disease or condition but is at risk of or susceptible to developing a disease or condition. Prevention can be complete, e.g., the complete absence of the pathogenesis of the object's condition. Prevention can also be partial, such that the occurrence of the pathogenesis of the object's condition is lower than would occur without the present disclosure.

[0050] As used herein, "administer" and its grammatical equivalents can refer to providing the pharmaceutical compositions described herein to a subject or patient. Depending on the type of disease or the site of the disease to be treated, the compositions can be administered to the subject using conventional methods known to those of ordinary skill in the medical art. For example, the compositions can be administered, for example, orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, via an implanted reservoir, or via infusion. One or more such routes can be employed.

[0051] As used herein, the term "pharmaceutical composition" and its grammatical equivalents can refer to a mixture or solution containing a therapeutically effective amount of an active pharmaceutical ingredient to be administered to a subject (e.g., a human in need) and one or more pharmaceutically acceptable excipients, carriers, and / or therapeutic agents.

[0052] As used herein, the term "pharmaceutically acceptable" and its grammatical equivalents can refer to the properties of materials that can be used to prepare a pharmaceutical composition that is generally safe, non-toxic, and has neither biological nor other adverse effects and is acceptable for veterinary and human pharmaceutical use. "Pharmaceutically acceptable" can refer to materials such as carriers or diluents that do not eliminate the biological activity or properties of a compound and are relatively non-toxic, i.e., the material can be administered to a subject without causing adverse biological effects or interacting in a harmful manner with any of the components of the pharmaceutical composition in which it is contained.

[0053] A "pharmaceutically acceptable excipient" is an excipient that can be administered with a medicament to a subject and that does not destroy the pharmacological activity of the medicament and is non-toxic when administered in a dose sufficient to deliver a therapeutic amount of the medicament.

[0054] The term "therapeutic agent" can refer to any agent that has a therapeutic, diagnostic, and / or prophylactic effect and / or causes a desired biological and / or pharmacological effect when administered to a subject. Therapeutic agents can also be referred to as "actives" or "active agents". Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

[0055] It should be understood that, for clarity, certain features of polynucleic acid molecules and / or polynucleic acid molecule conjugates, pharmaceutical compositions, methods, and other aspects described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for brevity, the various features of polynucleic acid molecules and / or polynucleic acid molecule conjugates, pharmaceutical compositions, methods, and other aspects described in the context of a single embodiment may also be provided separately or in any suitable sub-combination. All combinations of embodiments are expressly included in and disclosed herein as if each combination were separately and expressly disclosed, provided that such combinations include operable processes and / or compositions. In addition, all sub-combinations listed in embodiments describing such variables are also expressly covered in the polynucleic acid molecules and / or polynucleic acid molecule conjugates, pharmaceutical compositions, methods, and other aspects of the present invention and are disclosed herein as if each such sub-combination were separately and expressly disclosed herein.

[0056] As used herein, the term "sense strand" may be used interchangeably with the term "passenger strand", and the term "antisense strand" may be used interchangeably with the term "guide strand".

[0057] As used herein, the term "continuous sequence" refers to a sequence containing a plurality of consecutive nucleotides from a reference sequence. For example, if the reference sequence is N 1 N 2 N 3 N 4 N 5 N 6 N 7 , then the continuous sequence can be N 1 N 2 N 3 N 4 or N 3 N 4 N 5 N 6 , but the sequence of N 1 N 3 N 4 N 5 or N 3 N 4 N 7 cannot be a continuous sequence.

[0058] As used herein, the term "negative control" refers to an object or cell that has not received treatment or a placebo.

[0059] Polynucleic acid molecule

[0060] Target regions of polynucleic acid molecules

[0061] Described herein is a polynucleic acid molecule for modulating the expression of the APOC3 gene. In some cases, the polynucleic acid molecule comprises a single-stranded nucleic acid molecule that hybridizes to certain regions of the mRNA. In some cases, the polynucleic acid molecule is a double-stranded nucleic acid molecule. Also described herein is a polynucleic acid molecule for modulating the expression of the APOC3 gene, wherein the polynucleic acid molecule is a double-stranded nucleic acid molecule that comprises a sense strand and an antisense strand, and the antisense strand hybridizes to certain regions of the APOC3 mRNA.

[0062] In some aspects, the polynucleic acid molecules described herein hybridize to certain regions of the human APOC3 mRNA. In some cases, the human APOC3 mRNA is NM_000040.3. In some aspects, the polynucleic acid molecules described herein hybridize to certain regions of the non-human APOC3 mRNA.

[0063] In some aspects, the polynucleic acid molecules described herein hybridize to the 5’UTR region of the human APOC3 mRNA. In some aspects, the polynucleic acid molecules described herein hybridize to the coding region of the human APOC3 mRNA. In some aspects, the polynucleic acid molecules described herein hybridize to a portion of exon 1 of the human APOC3 mRNA. In some aspects, the polynucleic acid molecules described herein hybridize to a portion of exon 2 of the human APOC3 mRNA. In some aspects, the polynucleic acid molecules described herein hybridize to a portion of exon 3 of the human APOC3 mRNA. In some aspects, the polynucleic acid molecules described herein hybridize to a portion of exon 4 of the human APOC3 mRNA. In some aspects, the polynucleic acid molecules described herein hybridize to the 3’UTR region of the human APOC3 mRNA.

[0064] In some aspects, the target regions hybridizing with the polynucleic acid molecules described herein are determined by the APOC3 silencing effect and possible off-target effects. In some cases, the starting point of the target region falls between positions 1-10, 11-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, or 91-100 of NM_000040.3. In some cases, the starting point of the target region falls between positions 101-110, 111-120, 121-130, 131-140, 141-150, 151-160, 161-170, 171-180, 181-190, or 191-200 of NM_000040.3. In some cases, the starting point of the target region falls between positions 201-210, 211-220, 221-230, 231-240, 241-250, 251-260, 261-270, 271-280, 281-290, or 291-300 of NM_000040.3. In some cases, the starting point of the target region falls between positions 301-310, 311-320, 321-330, 331-340, 341-350, 351-360, 361-370, 371-380, 381-390, or 391-400 of NM_000040.3. In some cases, the starting point of the target region falls between positions 401-410, 411-420, 421-430, 431-440, 441-450, 451-460, 461-470, 471-480, 481-490, or 491-500 of NM_000040.3. In some cases, the starting point of the target region falls between positions 501-510, 511-520, 521-530, or 531-535 of NM_000040.3.

[0065] Structure of the polynucleic acid molecule

[0066] Single-stranded nucleic acid molecule

[0067] Described herein is a polynucleic acid molecule for regulating the expression of the APOC3 gene, wherein the polynucleic acid molecule comprises a single-stranded nucleic acid molecule that is reverse complementary to the target region of the APOC3 mRNA as described above.

[0068] In some aspects, the polynucleic acid molecules described herein are not 100% complementary to the target region of APOC3 mRNA. Thus, in some cases, the polynucleic acid molecules described herein are about 95% complementary to the target region of APOC3 mRNA. In some cases, the polynucleic acid molecules described herein are about 90% complementary to the target region of APOC3 mRNA. In some cases, the polynucleic acid molecules described herein are about 85% complementary to the target region of APOC3 mRNA. In some cases, the polynucleic acid molecules described herein are about 80% complementary to the target region of APOC3 mRNA. In some cases, the polynucleic acid molecules described herein are about 75% complementary to the target region of APOC3 mRNA. In some cases, the polynucleic acid molecules described herein are about 70% complementary to the target region of APOC3 mRNA.

[0069] In some aspects, the polynucleic acid molecules described herein comprise the nucleic acid sequences in Tables 1, 3, 5, and 12. In some cases, the polynucleic acid molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to the sequences in Tables 1, 3, 5, and 12. In some cases, the polynucleic acid molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to the nucleic acid sequences selected from SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585. In some cases, the polynucleic acid molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to the nucleic acid sequences selected from SEQ ID NOs: 541 - 546.

[0070] In some cases, the polynucleic acid molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to the sequences in Tables 1, 3, 5, and 12 (excluding overhangs). In some cases, the polynucleic acid molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to the nucleic acid sequences selected from SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585 (excluding overhangs). In some cases, the polynucleic acid molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% complementary to the nucleic acid sequences selected from SEQ ID NOs: 541 - 546 (excluding overhangs).

[0071] In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 14 consecutive nucleotides complementary to the sequences in Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 14 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 15 consecutive nucleotides complementary to the sequences in Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 15 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 16 consecutive nucleotides complementary to the sequences in Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 16 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 17 consecutive nucleotides complementary to the sequences in Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 17 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 18 consecutive nucleotides complementary to the sequences in Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 18 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 19 consecutive nucleotides complementary to the sequences in Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches.In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 19 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 20 consecutive nucleotides complementary to the sequences in Table 1, Table 3, Table 5, and Table 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 20 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 21 consecutive nucleotides complementary to the sequences in Table 1, Table 3, Table 5, and Table 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 21 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 22 consecutive nucleotides complementary to the sequences in Table 1, Table 3, Table 5, and Table 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 22 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches.

[0072] In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 14 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 541 - 546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 15 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 541 - 546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 16 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 541 - 546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 17 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 541 - 546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 18 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 541 - 546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 19 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 541 - 546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 20 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 541 - 546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 21 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 541 - 546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that includes 22 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 541 - 546, with no more than 1, 2, 3, or 4 mismatches.

[0073] In yet other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides that are complementary to the sequences in Tables 1, 3, 5, and 12, with no overhangs and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides that are complementary to the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no overhangs and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides that are complementary to the nucleic acid sequence of SEQID NO: 541 - 546, with no overhangs and having no more than 1, 2, 3, or 4 mismatches.

[0074] In some aspects, the polynucleic acid molecules described herein comprise a strand that is at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a strand that is about 15 - 40, 16 - 30, 17 - 30, 18 - 30, 18 - 27, 18 - 25, 18 - 23, 19 - 23, 20 - 23, or 21 - 23 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a strand that is about 15, 16, 17, 18, 19, 20 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a strand that is about 21, 22, 23, 24, 25 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a strand that is about 26, 27, 28, 29, 30 nucleotides in length.

[0075] In some aspects, the polynucleic acid molecules described herein comprise a single - stranded nucleic acid that is at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a single - stranded nucleic acid that is about 15 - 30, 16 - 30, 17 - 30, 18 - 30, 18 - 27, 18 - 25, 18 - 23, 19 - 23, 20 - 23, or 21 - 23 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a single - stranded nucleic acid that is about 15, 16, 17, 18, 19, 20 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a single - stranded nucleic acid that is about 21, 22, 23, 24, 25 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a single - stranded nucleic acid that is about 26, 27, 28, 29, 30 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a single - stranded nucleic acid that is about 21 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a single - stranded nucleic acid that is about 23 nucleotides in length.

[0076] Double-stranded nucleic acid molecule

[0077] The present invention further describes a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule is a double-stranded molecule comprising a sense strand and an antisense strand, and the antisense strand is reverse complementary to the target region of the APOC3 mRNA as described above.

[0078] In some aspects, the antisense strand described herein is 100% complementary to the target region of the APOC3 mRNA. In other aspects, the antisense strand described herein is not 100% complementary to the target region of the APOC3 mRNA. Thus, in some cases, the antisense strand described herein is about 95% complementary to the target region of the APOC3 mRNA. In some aspects, the antisense strand described herein is about 90% complementary to the target region of the APOC3 mRNA. In some aspects, the antisense strand described herein is about 85% complementary to the target region of the APOC3 mRNA. In some aspects, the antisense strand described herein is about 80% complementary to the target region of the APOC3 mRNA. In some aspects, the antisense strand described herein is about 75% complementary to the target region of the APOC3 mRNA. In some aspects, the antisense strand described herein is about 70% complementary to the target region of the APOC3 mRNA.

[0079] In some aspects, the polynucleotide molecule described herein comprises the nucleic acid sequences in Tables 1, 3, 5, and 12. In other aspects, the polynucleotide molecule described herein comprises nucleic acid sequences that are at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequences in Tables 1, 3, 5, and 12. In some cases, the sense strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 217-324, 481-504, 541-546, and 575-585. In some cases, the antisense strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-108, 433-456, 529-534, and 553-563. In some cases, the sense strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 541-546. In some cases, the antisense strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 529-534.

[0080] In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises a contiguous sequence of 14 sequences from Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises a contiguous sequence of 14 sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises a contiguous sequence of 14 sequences of SEQ ID NOs: 1 - 108, 433 - 456, 529 - 534, and 553 - 563, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises a contiguous sequence of 15 sequences from Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises a contiguous sequence of 15 sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises a contiguous sequence of 15 sequences of SEQ ID NOs: 1 - 108, 433 - 456, 529 - 534, and 553 - 563, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises a contiguous sequence of 16 sequences from Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises a contiguous sequence of 16 sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises a contiguous sequence of 16 sequences of SEQ ID NOs: 1 - 108, 433 - 456, 529 - 534, and 553 - 563, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence that comprises a contiguous sequence of 17 sequences from Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises a contiguous sequence of 17 sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, with no more than 1, 2, 3, or 4 mismatches.In some aspects, the antisense strands described herein comprise nucleic acid sequences that include 17 contiguous sequences of SEQ ID NO: 1-108, 433-456, 529-534, and 553-563, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that include 18 contiguous sequences from the sequences in Table 1, Table 3, Table 5, and Table 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that include 18 contiguous sequences of SEQ ID NO: 217-324, 481-504, 541-546, and 575-585, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that include 18 contiguous sequences of SEQ ID NO: 1-108, 433-456, 529-534, and 553-563, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that include 19 contiguous sequences from the sequences in Table 1, Table 3, Table 5, and Table 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that include 19 contiguous sequences of SEQ ID NO: 217-324, 481-504, 541-546, and 575-585, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that include 19 contiguous sequences of SEQ ID NO: 1-108, 433-456, 529-534, and 553-563, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that include 20 contiguous sequences from the sequences in Table 1, Table 3, Table 5, and Table 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that include 20 contiguous sequences of SEQ ID NO: 217-324, 481-504, 541-546, and 575-585, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that include 20 contiguous sequences of SEQ ID NO: 1-108, 433-456, 529-534, and 553-563, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that include 21 contiguous sequences from the sequences in Table 1, Table 3, Table 5, and Table 12, with no more than 1, 2, 3, or 4 mismatches.In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises 21 contiguous sequences of SEQ ID NOs: 217-324, 481-504, 541-546, and 575-585, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises 21 contiguous sequences of SEQ ID NOs: 1-108, 433-456, 529-534, and 553-563, with no more than 1, 2, 3, or 4 mismatches. In still other aspects, the polynucleotide molecule described herein comprises a nucleic acid sequence that comprises 22 contiguous sequences from the sequences in Tables 1, 3, 5, and 12, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises 22 contiguous sequences of SEQ ID NOs: 217-324, 481-504, 541-546, and 575-585, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises 22 contiguous sequences of SEQ ID NOs: 1-108, 433-456, 529-534, and 553-563, with no more than 1, 2, 3, or 4 mismatches.

[0081] In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises 15 consecutive sequences of SEQ ID NOs: 541-546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises 15 consecutive sequences of SEQ ID NOs: 529-534, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises 16 consecutive sequences of SEQ ID NOs: 541-546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises 16 consecutive sequences of SEQ ID NOs: 529-534, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises 17 consecutive sequences of SEQ ID NOs: 541-546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises 17 consecutive sequences of SEQ ID NOs: 529-534, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises 18 consecutive sequences of SEQ ID NOs: 541-546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises 18 consecutive sequences of SEQ ID NOs: 529-534, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises 19 consecutive sequences of SEQ ID NOs: 541-546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises 19 consecutive sequences of SEQ ID NOs: 529-534, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises 20 consecutive sequences of SEQ ID NOs: 541-546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises 20 consecutive sequences of SEQ ID NOs: 529-534, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence that comprises 21 consecutive sequences of SEQ ID NOs: 541-546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that comprises 21 consecutive sequences of SEQ ID NOs: 529-534, with no more than 1, 2, 3, or 4 mismatches.In some aspects, the sense strand described herein comprises a nucleic acid sequence that includes 22 consecutive sequences of SEQ ID NOs: 541 - 546, with no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence that includes 22 consecutive sequences of SEQ ID NOs: 529 - 534, with no more than 1, 2, 3, or 4 mismatches.

[0082] In some aspects, the polynucleic acid molecule described herein comprises a sense strand and an antisense strand that are at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a sense strand and an antisense strand that are about 15 - 30, 16 - 30, 17 - 30, 18 - 30, 18 - 27, 18 - 25, 18 - 23, 19 - 23, 20 - 23, or 21 - 23 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a sense strand and an antisense strand that are about 15, 16, 17, 18, 19, 20 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a sense strand and an antisense strand that are about 21, 22, 23, 24, 25 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a sense strand and an antisense strand that are about 26, 27, 28, 29, 30 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a sense strand that is 19 nucleotides in length and an antisense strand that is about 21 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a sense strand that is 21 nucleotides in length and an antisense strand that is about 23 nucleotides in length.

[0083] In some aspects, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 3' overhang on the antisense strand. In some aspects, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 5' overhang on the antisense strand. In some aspects, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 3' overhang on the sense strand. In some aspects, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 5' overhang on the sense strand.

[0084] Modification of the polynucleic acid molecule

[0085] In some aspects, this document describes polynucleic acid molecules having the modifications described herein. In some aspects, the modifications described herein occur on one or more different structures of the polynucleotide molecules described herein (e.g., modifications on the sugar ring, backbone, bases). In some aspects, the modifications described herein include substitutions of one or more nucleotides in the polynucleic acid molecules described herein. In some aspects, different percentages of the polynucleic acid molecules described herein contain the modifications described herein. In some aspects, different positions of the polynucleic acid molecules described herein contain the modifications described herein. WO / 2018 / 035380 is incorporated herein by reference in its entirety.

[0086] Type of modification

[0087] In some aspects, the polynucleotide molecules described herein comprise one or more sugar-modified nucleotides. In some aspects, the sugar-modified nucleotide is a 2'-fluoro-modified nucleotide. In some cases, the sugar-modified nucleotide comprises a modification at the 2'-hydroxyl of the ribose moiety. In some cases, the sugar-modified nucleotide comprises a modification with H, OR, R, halogen, SH, SR, NH2, NHR, NR2, or CN, where R is an alkyl moiety. In some aspects, the sugar-modified nucleotide is a 2'-O-methyl-modified nucleotide or a 2'-alkoxy-modified nucleotide (e.g., a 2'-methoxy-modified nucleotide). In some cases, the 2'-hydroxyl modification comprises 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA). In some cases, the 2'-hydroxyl of the ribose moiety comprises a locked or bridged ribose modification (e.g., LNA), an unlocked ribose modification (e.g., UNA), or an ethylene nucleic acid (ENA). In some cases, the alkyl moiety comprises a hetero substitution. In some cases, the carbon of the heterocyclic group is substituted with nitrogen, oxygen, or sulfur. In some aspects, the sugar-modified nucleotide is a 2'-amino-modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2'-azido-modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2'-deoxy-modified nucleotide. In some aspects, the sugar-modified nucleotide is 2'-O-methoxyethyl (2'-MOE). In some aspects, the sugar-modified nucleotide is a locked nucleic acid (LNA). In some aspects, the sugar-modified nucleotide is an ethylene-bridged nucleic acid (ENA). In some aspects, the sugar-modified nucleotide is an (S)-constrained ethyl (cEt). In some aspects, the sugar-modified nucleotide is a tricyclic DNA (tcDNA). In some aspects, the sugar-modified nucleotide is 2'-NH 2 nucleic acid.

[0088] In some aspects, the polynucleotide molecules described herein comprise one or more sugar-phosphate-modified nucleotides. In some aspects, the modified sugar-phosphate is a phosphorodiamidate morpholino (PMO). In some aspects, the modified sugar-phosphate is an aminophosphate. In some cases, the heterocyclic substitution comprises imidazole and pyrrolidinyl. In some aspects, the modified sugar-phosphate is a phosphorothioate. In some aspects, the modified sugar-phosphate is a peptide nucleic acid (PNA).

[0089] In some aspects, the polynucleotide molecules described herein include one or more nucleotides with modified backbones. In some aspects, the modified backbone is a methylphosphonate. In some aspects, the modified backbone is a phosphorothioate. In some aspects, the modified backbone is a guanidinopropylaminophosphate. In some aspects, the modified backbone is a methanesulfonyl-amidophosphate (MsPA) linkage. In some cases, the modified backbone includes one or more of dithiophosphates, methylphosphonates, 5'-alkylphosphonates, 5'-methylphosphonates, 3'-alkylphosphonates, trifluoroborates, 3'-5' linked or 2'-5' linked boranophosphates, and selenophosphates, phosphotriesters, thiocarbonylalkylphosphotriesters, hydrogen phosphonate linkages, alkylphosphonates, alkylthiophosphonates, arylthiophosphonates, selenophosphates, and aminophosphates.

[0090] In some aspects, the modified nucleotides include one or more of modified guanines (e.g., inosine) or any type of unnatural nucleic acids.

[0091] In some aspects, the modified backbone is a phosphorothioate, and the phosphorothioate is a stereochemically enriched phosphorothioate. In certain aspects, the strand contains at least one stereochemically enriched phosphorothioate. In some aspects, the strand includes at least 1, 2, 3 stereochemically enriched phosphorothioates. In some aspects, the strand contains only 1, 2, 3, or 4 stereochemically enriched phosphorothioates. In a further aspect, at least one (e.g., one or two) stereochemically enriched phosphorothioates are disposed between two consecutive nucleosides of two of the six 5'-terminal nucleosides of the strand. In yet a further aspect, at least one (e.g., one or two) stereochemically enriched phosphorothioates are disposed between two consecutive nucleosides of two of the six 3'-terminal nucleosides of the strand. In still a further aspect, one stereochemically enriched phosphorothioate is covalently bonded to the first and second nucleosides starting from the 5'-end within the strand. In some aspects, one stereochemically enriched phosphorothioate is covalently bonded to the twenty-first and twenty-second nucleosides starting from the 5'-end within the strand. In certain aspects, one stereochemically enriched phosphorothioate is covalently bonded to the twenty-second and twenty-third nucleosides starting from the 5'-end within the strand. In a particular aspect, the stereochemically enriched phosphorothioate has an R P stereochemical identity. In certain aspects, the stereochemically enriched phosphorothioate has an S P stereochemical identity.

[0092] In some aspects, the polynucleotide molecules described herein contain one or more (e.g., 1 to 20, 1 to 10, or 1 to 5) stereochemically enriched (e.g., internucleoside) phosphorothioates (e.g., with an enantiomeric excess of at least 10%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% at the P-stereogenic center, e.g., up to about 99%). The polynucleotide molecules described herein contain one or more (e.g., 1 to 20, 1 to 10, or 1 to 5; e.g., internucleoside) dithiophosphates. The dithiophosphates in the polynucleotide molecules described herein can be non-P-stereogenic. Phosphorothioates and dithiophosphates can enhance the stability of the polynucleotide molecules described herein against serum exonuclease activity. Non-P-stereogenic dithiophosphates can simplify the synthesis of the polynucleotide molecules described herein by reducing the number of possible enantiomers. Typically, a phosphorothioate or dithiophosphate can link two adjacent nucleosides within the six 3'-terminal nucleosides and the six 5'-terminal nucleosides of the polynucleotide molecules described herein. In some aspects, a stereochemically enriched phosphorothioate (e.g., an R P -enriched phosphorothioate) can be covalently bonded to the first nucleoside (e.g., the 3'-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5'-carbon atom of the second nucleoside) counting from the 5'-end of the antisense strand. Additionally or alternatively, a stereochemically enriched phosphorothioate (e.g., an S P -enriched phosphorothioate) can be covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) counting from the 5'-end of the antisense strand. Further, additionally or alternatively, a stereochemically enriched phosphorothioate (e.g., an S P -enriched phosphorothioate or an Rp-enriched phosphorothioate) can be covalently bonded to the 22nd nucleoside (e.g., the 3'-carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5'-carbon atom of the 23rd nucleoside) counting from the 5'-end of the antisense strand.

[0093] The combination of a 5'R P -enriched phosphorothioate (e.g., an R P -enriched phosphorothioate covalently bonded to the first nucleoside (e.g., the 3'-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5'-carbon atom of the second nucleoside) counting from the 5'-end) and a 3'S P -enriched phosphorothioate (e.g., an S P -enriched phosphorothioate covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) counting from the 5'-end) in the antisense strand can produce better efficacy and / or duration of action, e.g., as determined by comparing to polynucleotides lacking 5'R P-Enriched thiophosphates and 3’S P -A reference guide strand of a combination of enriched thiophosphates or 5’Rp-enriched thiophosphates and 3’Sp- and Rp-enriched thiophosphates, as measured by a decrease in target activity. In some embodiments, the stereochemically enriched thiophosphates can comprise R p R p S p S p (R at positions 1 and 2 of the guide strand p R p and S at positions 21 and 22 of the guide strand p S p ) or R p R p S p R p (R at positions 1 and 2 of the guide strand p R p and S at positions 21 and 22 of the guide strand p R p)。In some aspects, the polynucleotide molecules described herein comprise four stereochemically enriched phosphorothioates: (1) an Rp-enriched phosphorothioate covalently bonded to the 1st nucleoside (e.g., the 3'-carbon atom of the 1st nucleoside) and the 2nd nucleoside (e.g., the 5'-carbon atom of the 2nd nucleoside) from the 5'-end of the antisense strand; (2) an Rp-enriched phosphorothioate covalently bonded to the 2nd nucleoside (e.g., the 3'-carbon atom of the 2nd nucleoside) and the 3rd nucleoside (e.g., the 5'-carbon atom of the 3rd nucleoside) from the 5'-end of the antisense strand; (3) an Sp-enriched phosphorothioate covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) from the 5'-end of the antisense strand; and (4) an Sp-enriched phosphorothioate covalently bonded to the 22nd nucleoside (e.g., the 3'-carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5'-carbon atom of the 23rd nucleoside) from the 5'-end of the antisense strand. In some aspects, the polynucleotide molecules described herein comprise four stereochemically enriched phosphorothioates: (1) an Rp-enriched phosphorothioate covalently bonded to the 1st nucleoside (e.g., the 3'-carbon atom of the 1st nucleoside) and the 2nd nucleoside (e.g., the 5'-carbon atom of the 2nd nucleoside) from the 5'-end of the antisense strand; (2) an Rp-enriched phosphorothioate covalently bonded to the 2nd nucleoside (e.g., the 3'-carbon atom of the 2nd nucleoside) and the 3rd nucleoside (e.g., the 5'-carbon atom of the 3rd nucleoside) from the 5'-end of the antisense strand; (3) an Sp-enriched phosphorothioate covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) from the 5'-end of the antisense strand; and (4) an Rp-enriched phosphorothioate covalently bonded to the 22nd nucleoside (e.g., the 3'-carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5'-carbon atom of the 23rd nucleoside) from the 5'-end of the antisense strand.

[0094] In some aspects, the polynucleotide molecules described herein comprise one or more purine modifications. In some aspects, the purine modification described herein is 2,6-diaminopurine. In some aspects, the purine modification described herein is 3-deaza-adenine. In some aspects, the purine modification described herein is 7-deaza-guanine. In some aspects, the purine modification described herein is 8-azido-adenine.

[0095] In some aspects, the polynucleotide molecules described herein comprise one or more pyrimidine modifications. In some aspects, the pyrimidine modification described herein is 2-thio-thymidine. In some aspects, the pyrimidine modification described herein is 5-formamido-uracil. In some aspects, the pyrimidine modification described herein is 5-methyl-cytosine. In some aspects, the pyrimidine modification described herein is 5-ethynyluracil.

[0096] In some cases, the polynucleotide molecules described herein contain abasic substitutions. In those cases where the hybridized polynucleotide constructs are intended to be used as siRNAs, it is desirable to reduce miRNA-like off-target effects. Because abasic substitutions lack nucleobases that can participate in base-pairing interactions and relieve steric hindrance, including one or more (e.g., one or two) abasic substitutions in the hybridized polynucleotide construct can reduce or even eliminate miRNA-like off-target effects. Accordingly, the polynucleotide molecules disclosed herein can contain one or more (e.g., one or two) abasic substitutions. In some aspects, the abasic substitution is located at the 5th nucleotide from the 5' end of the antisense strand as described herein. In some aspects, the abasic substitution is located at the 7th nucleotide from the 5' end of the antisense strand as described herein.

[0097] When the polynucleic acid molecules disclosed herein include two or more abasic substitutions, their structures can be the same or different. In certain aspects, the sense strand contains one abasic substitution (e.g., the antisense strand can be free of abasic substitutions). In other aspects, the antisense strand contains one abasic substitution (e.g., the sense strand can be free of abasic substitutions). In still other aspects, the antisense strand contains one abasic substitution and the sense strand contains one abasic substitution. In further aspects, the sense strand includes an abasic substitution between nucleoside number (x) and nucleoside number (x + 1), where x is an integer from 2 to 7. In still further aspects, the antisense strand includes a base substitution between nucleoside number (x) and nucleoside number (x + 1), where x is an integer from 2 to 7.

[0098] The abasic substitution can be of formula (III):

[0099]

[0100] where

[0101] L is a sugar analog, or is substituted with a heteroacyl group from A, U, C, G, or is any other substituted nucleic acid (e.g., locked nucleic acid or unlocked nucleic acid, glycol nucleic acid, etc.);

[0102] each X 4 is independently O or S;

[0103] each X 5 is independently O, S, NH, or a bond;

[0104] each R 9 is independently H, optionally substituted C 1-6 alkyl, optionally substituted C 2-6 alkenyl, optionally substituted C 2-6 alkynyl, optionally substituted (C 1-9 heterocyclyl)-C 1-6 -alkyl, optionally substituted (C6-10 aryl)-C 1-6 -alkyl, optionally substituted (C 3-8 cycloalkyl)-C 1-6 -alkyl, -LinkA(-T) p or a conjugate moiety;

[0105] Each LinkA is independently a polyvalent linker (e.g., including -C(O)-N(H)-);

[0106] Each T is independently an auxiliary moiety;

[0107] R 10 is a bond to the 3'-carbon atom of nucleoside (x) in the chain;

[0108] R 11 is a bond to the 5'-oxygen atom of nucleoside (x + 1) in the chain;

[0109] p is an integer from 1 to 6; and

[0110] t is an integer from 1 to 6.

[0111] In some aspects, the abasic substitution described herein is attached to the antisense strand of the polynucleic acid molecule described herein. In certain aspects, an abasic substitution (e.g., an internucleoside abasic spacer of formula (III) where t is 1) can be included in the antisense strand described herein (e.g., within the seed region of the guide strand). In some aspects, an abasic substitution (e.g., an internucleoside abasic spacer of formula (III) where t is 1) can be bonded to the 3'-carbon atom of the second, third, fourth, or fifth nucleoside from the 5'-end of the antisense strand described herein. In certain aspects, an abasic substitution (e.g., an internucleoside abasic spacer of formula (III) where t is 1) can be bonded to the 3'-carbon atom of the thirteenth, fourteenth, fifteenth, or sixteenth nucleoside from the 5'-end of the antisense strand described herein. In some aspects, there is an abasic substitution at the fourth, fifth, sixth, seventh, eighth, and / or ninth nucleoside from the 5'-end of the antisense strand described herein.

[0112] The polynucleotide molecule described herein can contain a strand comprising a seed region that contains a nucleoside (e.g., inosine) containing a hypoxanthine nucleobase.

[0113] In some aspects, the nucleoside containing a hypoxanthine nucleobase is the second nucleoside from the 5'-end in the chain. In a further aspect, the nucleoside containing a hypoxanthine nucleobase is the third nucleoside from the 5'-end in the chain. In still a further aspect, the nucleoside containing a hypoxanthine nucleobase is the fourth nucleoside from the 5'-end in the chain. In yet a further aspect, the nucleoside containing a hypoxanthine nucleobase is the fifth nucleoside from the 5'-end in the chain. In certain aspects, the nucleoside containing a hypoxanthine nucleobase is the sixth nucleoside in the chain. In certain aspects, the nucleoside containing a hypoxanthine nucleobase is the seventh nucleoside in the chain.

[0114] Amount and location of modification

[0115] In some aspects, the polynucleotide molecules described herein comprise one or more types of modifications as described above. Thus, in some aspects, about 10% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 20% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 30% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 40% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 50% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 60% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 70% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 80% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 90% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, 100% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications.

[0116] In some aspects, one or more types of modifications described herein occur at different positions within the polynucleotide molecules described herein. In some aspects, one or more types of modifications described herein occur within the seed region of the polynucleotide molecules described herein. In some aspects, one or more types of modifications described herein occur at the 3' end of the polynucleotide molecules described herein. In some aspects, one or more types of modifications described herein occur at the 5' end of the polynucleotide molecules described herein. In some aspects, one or more types of modifications described herein occur dispersedly within the polynucleotide molecules described herein. In some aspects, one or more types of modifications described herein occur in clusters within the polynucleotide molecules described herein.

[0117] Specific modification patterns

[0118] In some aspects, specific modification patterns of polynucleic acid molecules are described herein, which are double-stranded nucleic acid molecules comprising a sense strand and an antisense strand. In some aspects, the antisense strand contains a 2'-fluoro-modified nucleotide at position 2 starting from the 5' end. In some aspects, the antisense strand contains a 2'-fluoro-modified nucleotide at position 14 starting from the 5' end. In some aspects, the antisense strand contains 2'-fluoro-modified nucleotides at positions 2 and 14 starting from the 5' end. In some aspects, the antisense strand contains a 2'-fluoro-modified nucleotide at position 12 starting from the 5' end. In some aspects, the antisense strand contains a 2'-fluoro-modified nucleotide at position 16 starting from the 5' end. In other aspects, the antisense strand contains a 2'-fluoro-modified nucleotide at position 6 starting from the 5' end. In other aspects, the antisense strand contains a 2'-fluoro-modified nucleotide at position 7 starting from the 5' end. In other aspects, the antisense strand contains a 2'-fluoro-modified nucleotide at position 8 starting from the 5' end. In other aspects, the antisense strand contains a 2'-fluoro-modified nucleotide at position 9 starting from the 5' end. In other aspects, the antisense strand contains a 2'-fluoro-modified nucleotide at position 4 starting from the 5' end.

[0119] In some aspects, the present disclosure describes specific modification patterns of polynucleic acid molecules, which are double-stranded nucleic acid molecules comprising a sense strand and an antisense strand. In some aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 9 starting from the 5'-end. In some aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 11 starting from the 5'-end. In some aspects, the sense strand comprises 2'-fluoro-modified nucleotides at positions 9 and 11 starting from the 5'-end. In some aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 7 starting from the 5'-end. In some aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 10 starting from the 5'-end. In some aspects, the sense strand comprises 2'-fluoro-modified nucleotides at positions 9, 11, and 7 starting from the 5'-end. The sense strand comprises 2'-fluoro-modified nucleotides at positions 9, 11, and 10 starting from the 5'-end. The sense strand comprises 2'-fluoro-modified nucleotides at positions 9 and 7 starting from the 5'-end. The sense strand comprises 2'-fluoro-modified nucleotides at positions 9 and 10 starting from the 5'-end. The sense strand comprises 2'-fluoro-modified nucleotides at positions 9, 11, 7, and 10 starting from the 5'-end. In other aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 8 starting from the 5'-end. In other aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 12 starting from the 5'-end. In other aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 16 starting from the 5'-end.

[0120] In some aspects, the sense strand and the antisense strand of the polynucleic acid molecule comprise any combination of two or more 2'-fluoro-modified nucleotides at the positions described in the above two paragraphs.

[0121] In some aspects, the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3'. In some aspects, the antisense strand comprises 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3'. In some aspects, the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3'. In the above modification patterns, "Nf" represents a 2'-fluoro-modified nucleotide, and "n" represents a 2'-O-methyl-modified nucleotide.

[0122] In some aspects, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3'. In some aspects, the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3'. In some aspects, the sense strand comprises 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3'. In the above modification patterns, "Nf" represents a 2'-fluoro-modified nucleotide, and "n" represents a 2'-O-methyl-modified nucleotide.

[0123] In some aspects, the present disclosure describes specific modification patterns of polynucleic acid molecules, which are double-stranded nucleic acid molecules comprising a sense strand and an antisense strand, wherein the sense strand comprises approximately twelve 2'-fluoro-modified nucleotides and approximately nine 2'-O-methyl-modified nucleotides, and wherein the antisense strand comprises approximately nine 2'-fluoro-modified nucleotides and approximately fourteen 2'-O-methyl-modified nucleotides.

[0124] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand is fully modified and comprises twelve 2'-fluoro-modified nucleotides and nine 2'-O-methyl-modified nucleotides, and wherein the antisense strand is fully modified and comprises nine 2'-fluoro-modified nucleotides and fourteen 2'-O-methyl-modified nucleotides.

[0125] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-NfnNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3', wherein the antisense strand comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnNfnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0126] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-NfnNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3', wherein the antisense strand comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnNfnnn-3', wherein the sense strand and / or the antisense strand comprises one or more phosphorothioate linkages, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In other aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-NfnNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3', wherein the antisense strand comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnNfnnn-3', wherein the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0127] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand and / or the antisense strand is modified to Type I in Table 19.

[0128] Table 19 Nucleotide Modification Patterns

[0129] Pattern name Pattern Type I of the sense strand 5’-NfsnsNfnNfnNfnNfNfNfnNfnNfnNfnNf-3’ Type I of the antisense strand 5’-nsNfsnNfnNfnNfnNfnnnNfnNfnNfnNfnsnsn-3’ Type II of the sense strand 5’-nsnsnnnnNfnNfNfNfnnnnnnnnnn-3’ Type II of the antisense strand 5’-nsNfsnnnNfnNfNfnnnnNfnNfnnnnnsnsn-3’ Type III of the sense strand 5’-nsnsnnnnnnNfnNfnnnnnnnnnn-3’ Type III of the antisense strand 5’-nsNfsnnnnnnnnnNfnNfnnnnnnnsnsn-3’ Type IV of the sense strand 5’-nsnsnnnnNfnNfnNfnnnnnnnnnn-3’ Type IV of the antisense strand 5’-nsNfsnnnnnnnnnNfnNfnNfnnnnnsnsn-3’ Type V of the sense strand 5'-nsnsnnnnNfnNfnNfnnnnnnnnnn-3’ Type V of the antisense strand 5’-_nsNfsnnnnNfnnnnNfnNfnNfnnnnnsnsn-3’ Type VI of the sense strand 5’-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3’

[0130] Note: "Nf" represents a 2'-fluoro-modified nucleotide, "n" represents a 2'-O-methyl-modified nucleotide, "s" represents a 3'-thiophosphate, and "invdN" represents a reverse deoxynucleotide.

[0131] In some aspects, the polynucleotide molecules provided herein comprise a sense strand containing the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585 and an antisense strand containing the nucleic acid sequences of SEQ ID NOs: 1 - 108, 433 - 456, 529 - 534, and 553 - 563. In other aspects, the polynucleotide molecules provided herein comprise a sense strand containing the nucleic acid sequences of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, an antisense strand containing the nucleic acid sequences of SEQ ID NOs: 1 - 108, 433 - 456, 529 - 534, and 553 - 563, and wherein the sense strand and / or the antisense strand are modified in a type I modification pattern as specified in Table 19. In some aspects, the polynucleotide molecules provided herein comprise a sense strand containing the nucleic acid sequence of SEQ ID NOs: 541 - 546 and an antisense strand containing the nucleic acid sequence of SEQ ID NOs: 529 - 534. In other aspects, the polynucleotide molecules provided herein comprise a sense strand containing the nucleic acid sequence of SEQ ID NOs: 541 - 546, an antisense strand containing the nucleic acid sequence of SEQ ID NOs: 529 - 534, and wherein the sense strand and / or the antisense strand are modified in a type I modification pattern as specified in Table 19.

[0132] In some aspects, specific modification patterns are described herein, wherein the sense strand comprises approximately four 2'-fluoro-modified nucleotides and approximately seventeen 2'-O-methyl-modified nucleotides, and wherein the antisense strand comprises approximately six 2'-fluoro-modified nucleotides and approximately seventeen 2'-O-methyl-modified nucleotides.

[0133] In some aspects, specific modification patterns are described herein, wherein the sense strand is fully modified and comprises four 2'-fluoro-modified nucleotides, seventeen 2'-O-methyl-modified nucleotides, and wherein the antisense strand is fully modified and comprises six 2'-fluoro-modified nucleotides and seventeen 2'-O-methyl-modified nucleotides.

[0134] In some aspects, specific modification patterns are described herein, wherein the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnN-3', wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0135] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', wherein the sense strand and / or the antisense strand comprises one or more phosphorothioate linkages, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In other aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', wherein the sense strand comprises two phosphorothioate linkages, wherein the antisense strand comprises four phosphorothioate linkages, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0136] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand and / or the antisense strand is modified as type II in Table 19.

[0137] In some aspects, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence containing SEQ ID NO: 217-324, 481-504, 541-546, and 575-585, and / or an antisense strand comprising a nucleic acid sequence containing SEQ ID NO: 1-108, 433-456, 529-534, and 553-563, and wherein the sense strand and / or the antisense strand is modified in the type II modification pattern specified in Table 19. In other aspects, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence containing SEQ ID NO: 541-546, and / or an antisense strand comprising a nucleic acid sequence containing SEQ ID NO: 529-534, and wherein the sense strand and / or the antisense strand is modified in the type II modification pattern specified in Table 19.

[0138] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises approximately two 2'-fluoro-modified nucleotides and approximately nineteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand comprises approximately three 2'-fluoro-modified nucleotides and approximately twenty 2'-O-methyl-modified nucleotides.

[0139] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand is fully modified and comprises two 2'-fluoro-modified nucleotides and nineteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand is fully modified and comprises three 2'-fluoro-modified nucleotides and twenty 2'-O-methyl-modified nucleotides.

[0140] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0141] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', wherein the sense strand and / or the antisense strand comprises one or more phosphorothioate linkages, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In other aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', wherein the sense strand comprises two phosphorothioate linkages, wherein the antisense strand comprises four phosphorothioate linkages, and wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0142] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand and / or the antisense strand is modified to type III in Table 19.

[0143] In some aspects, the polynucleotide molecule provided herein comprises a sense strand comprising a nucleic acid sequence containing SEQ ID NOs: 217-324, 481-504, 541-546, and 575-585, and / or an antisense strand comprising a nucleic acid sequence containing SEQ ID NOs: 1-108, 433-456, 529-534, and 553-563, and wherein the sense strand and / or the antisense strand is modified in the type III modification pattern specified in Table 19. In other aspects, the polynucleotide molecule provided herein comprises a sense strand comprising a nucleic acid sequence containing SEQ ID NOs: 541-546, and / or an antisense strand comprising a nucleic acid sequence containing SEQ ID NOs: 529-534, and wherein the sense strand and / or the antisense strand is modified in the type III modification pattern specified in Table 19.

[0144] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises approximately three 2'-fluoro-modified nucleotides and approximately eighteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand comprises approximately four 2'-fluoro-modified nucleotides and approximately nineteen 2'-O-methyl-modified nucleotides.

[0145] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand is fully modified and contains three 2'-fluoro-modified nucleotides, eighteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand is fully modified and contains four 2'-fluoro-modified nucleotides and nineteen 2'-O-methyl-modified nucleotides.

[0146] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0147] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein the sense strand and / or the antisense strand comprises one or more phosphorothioate linkages, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In other aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein the sense strand comprises two phosphorothioate linkages, wherein the antisense strand comprises four phosphorothioate linkages, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0148] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand and / or the antisense strand is modified to Type IV in Table 19.

[0149] In some aspects, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence of SEQ ID NOs: 217 - 324, 481 - 504, 541 - 546, and 575 - 585, and / or an antisense strand comprising a nucleic acid sequence of SEQ ID NOs: 1 - 108, 433 - 456, 529 - 534, and 553 - 563, and wherein the sense strand and / or the antisense strand is modified in the type IV modification pattern specified in Table 19. In other aspects, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence of SEQ ID NOs: 541 - 546, and / or an antisense strand comprising a nucleic acid sequence of SEQ ID NOs: 529 - 534, and wherein the sense strand and / or the antisense strand is modified in the type IV modification pattern specified in Table 19.

[0150] In some aspects, specific modification patterns are described herein, wherein the sense strand comprises approximately three 2'-fluoro-modified nucleotides and approximately eighteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand comprises approximately five 2'-fluoro-modified nucleotides and approximately eighteen 2'-O-methyl-modified nucleotides.

[0151] In some aspects, specific modification patterns are described herein, wherein the sense strand is fully modified and comprises three 2'-fluoro-modified nucleotides and eighteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand is fully modified and comprises five 2'-fluoro-modified nucleotides and eighteen 2'-O-methyl-modified nucleotides.

[0152] In some aspects, specific modification patterns are described herein, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0153] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein the sense strand and / or the antisense strand comprises one or more phosphorothioate linkages, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In other aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein the sense strand comprises two phosphorothioate linkages, wherein the antisense strand comprises four phosphorothioate linkages, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0154] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand and / or the antisense strand is modified to type V in Table 19.

[0155] In some aspects, the polynucleotide molecule provided herein comprises a sense strand comprising a nucleic acid sequence containing SEQ ID NO: 217-324, 481-504, 541-546, and 575-585, and / or an antisense strand comprising a nucleic acid sequence containing SEQ ID NO: 1-108, 433-456, 529-534, and 553-563, and wherein the sense strand and / or the antisense strand is modified in a type V modification pattern specified in Table 19. In other aspects, the polynucleotide molecule provided herein comprises a sense strand comprising a nucleic acid sequence containing SEQ ID NO: 541-546, and / or an antisense strand comprising a nucleic acid sequence containing SEQ ID NO: 529-534, and wherein the sense strand and / or the antisense strand is modified in a type V modification pattern specified in Table 19.

[0156] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises approximately three 2'-fluoro-modified nucleotides and approximately eighteen 2'-O-methyl-modified nucleotides, and has one or more reverse deoxynucleotides as overhangs at the 3' end.

[0157] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand is fully modified and comprises three 2'-fluoro-modified nucleotides and eighteen 2'-O-methyl-modified nucleotides, and has two reverse deoxynucleotides as overhangs at the 3' end.

[0158] In some aspects, the present disclosure describes specific modification patterns, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', where "Nf" represents a 2'-fluoro-modified nucleotide, where "n" represents a 2'-O-methyl-modified nucleotide, and "invdN" represents a reverse deoxynucleotide. In some cases, invdN is a reverse deoxythymidine. In some aspects, a linker conjugated to one or more targeting moieties as shown in formula (IV") or (IV"') is added to the first nucleic acid at the 5' end. In some aspects, a linker conjugated to one or more GalNAc as shown in formula (V") or (V"') is added to the first nucleic acid at the 5' end. In some aspects, the modification pattern comprises one or more phosphorothioate linkages. In some aspects, the modification pattern is as shown in formula (VII). In some aspects, 5' end modifications known in the art are applied to one or more reverse nucleotides.

[0159] Wherein R is a moiety corresponding to the sugar modification described herein, and in some cases, R is -O-methyl; wherein R' is thymine, abasic, or others; wherein A is -O or -S; and wherein A' is -O or -S.

[0160] In some aspects, the polynucleotide molecules provided herein comprise a sense strand containing nucleic acid sequences of SEQ ID NO: 217-324, 481-504, 541-546, and 575-585, and / or an antisense strand containing nucleic acid sequences of SEQ ID NO: 1-108, 433-456, 529-534, and 553-563, and wherein the sense strand is modified with a type VI modification pattern as specified in Table 19 or described in the previous paragraph. In other aspects, the polynucleotide molecules provided herein comprise a sense strand containing nucleic acid sequences of SEQ ID NO: 541-546, and / or an antisense strand containing nucleic acid sequences of SEQ ID NO: 529-534, and wherein the sense strand is modified with a type VI modification pattern as specified in Table 19 or described in the previous paragraph.

[0161] This document describes a polynucleic acid molecule, whose sense strand contains a nucleic acid sequence that is at least 80% identical to a nucleic acid sequence selected from SEQ ID NOs: 325 - 432, 505 - 528, 547 - 552, and 586 - 596. This document describes a polynucleic acid molecule, whose sense strand contains a nucleic acid sequence that is at least 85% identical to a nucleic acid sequence selected from SEQ ID NOs: 325 - 432, 505 - 528, 547 - 552, and 586 - 596. This document describes a polynucleic acid molecule, whose sense strand contains a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from SEQ ID NOs: 325 - 432, 505 - 528, 547 - 552, and 586 - 596. This document describes a polynucleic acid molecule, whose sense strand contains a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 325 - 432, 505 - 528, 547 - 552, and 586 - 596.

[0162] This document describes a polynucleic acid molecule, whose antisense strand contains a nucleic acid sequence that is at least 80% identical to a nucleic acid sequence selected from SEQ ID NOs: 109 - 216, 457 - 480, 535 - 540, and 564 - 574. This document describes a polynucleic acid molecule, whose antisense strand contains a nucleic acid sequence that is at least 85% identical to a nucleic acid sequence selected from SEQ ID NOs: 109 - 216, 457 - 480, 535 - 540, and 564 - 574. This document describes a polynucleic acid molecule, whose antisense strand contains a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from SEQ ID NOs: 109 - 216, 457 - 480, 535 - 540, and 564 - 574. This document describes a polynucleic acid molecule, whose antisense strand contains a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 109 - 216, 457 - 480, 535 - 540, and 564 - 574.

[0163] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usUfsucagGfgaacUfgAfaGfccaucsgsg (SEQ ID NO: 535) and a sense strand containing a nucleotide sequence of gsasuggcUfuCfaGfuucccugaaa (SEQ ID NO: 547), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0164] The present invention also provides a polynucleic acid molecule for regulating the expression of the APOC3 gene, wherein the polynucleic acid molecule comprises an antisense strand containing a nucleotide sequence of usGfsaauaCfugucCfcUfuUfuaagcsasa (SEQ ID NO: 536) and a sense strand containing a nucleotide sequence of gscsuuaaAfaGfgGfacaguauuca (SEQ ID NO: 548), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0165] The present invention also provides a polynucleic acid molecule for regulating the expression of the APOC3 gene, wherein the polynucleic acid molecule comprises an antisense strand containing a nucleotide sequence of usAfsgaauAfcuguCfcCfuUfuuaagscsa (SEQ ID NO:537) and a sense strand containing a nucleotide sequence of csusuaaaAfgGfgAfcaguauucua (SEQ ID NO:549), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0166] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usUfsgagaAfuacuGfuCfcCfuuuuasasg (SEQ ID NO: 538) and a sense strand containing a nucleotide sequence of usasaaagGfgAfcAfguauucucaa (SEQ ID NO: 550), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0167] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO: 539) and a sense strand containing a nucleotide sequence of asasaaggGfaCfaGfuauucucaga (SEQ ID NO: 551), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0168] The present invention also provides a polynucleic acid molecule for regulating the expression of the APOC3 gene, wherein the polynucleic acid molecule comprises an antisense strand containing a nucleotide sequence of usCfsacugAfgaauAfcUfgUfcccuususu (SEQ ID NO: 540) and a sense strand containing a nucleotide sequence of asasgggaCfaGfuAfuucucaguga (SEQ ID NO: 552), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiol phosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0169] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of vpusCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO: 565) and a sense strand containing a nucleotide sequence of asasaaggGfaCfaGfuauucucaga (SEQ ID NO: 587), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0170] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usCfsugagAfauacUfgUfcCfcuuucsasa (SEQ ID NO:566) and a sense strand containing a nucleotide sequence of gsasaaggGfaCfaGfuauucucaga (SEQ ID NO:588), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0171] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usCfsugagAfauacUfgUfcCfcuuugsasa (SEQ ID NO: 567) and a sense strand containing a nucleotide sequence of csasaaggGfaCfaGfuauucucaga (SEQ ID NO: 589), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0172] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usCfsugagAfauacUfgUfcCfcuugcsasa (SEQ ID NO: 568) and a sense strand containing a nucleotide sequence of gscsaaggGfaCfaGfuauucucaga (SEQ ID NO: 590), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0173] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usCfsugagAfauacUfgUfcCfcuucgsasa (SEQ ID NO: 569) and a sense strand containing a nucleotide sequence of csgsaaggGfaCfaGfuauucucaga (SEQ ID NO: 591), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0174] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO: 570) and a sense strand containing a nucleotide sequence of (invAb)asasaaggGfaCfaGfuauucucaga (SEQ ID NO: 592), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to reverse abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0175] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usCfsugagAfauacUfgUfcCfcuuugsasa (SEQ ID NO: 571) and a sense strand containing a nucleotide sequence of (invAb)csasaaggGfaCfaGfuauucucaga (SEQ ID NO: 593), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to reverse abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0176] The present invention also provides a polynucleotide molecule for regulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usCfsugdAgdAauacUfgUfcCfcuuuusasa (SEQ ID NO: 572) and a sense strand containing a nucleotide sequence of asasaaggGfaCfaGfuauucucaga (SEQ ID NO: 594), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiolphosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0177] The present invention also provides a polynucleic acid molecule for regulating the expression of the APOC3 gene, wherein the polynucleic acid molecule comprises an antisense strand containing a nucleotide sequence of usCfsugagAfauacUfgUfscCfcuuuusasa (SEQ ID NO: 573) and a sense strand containing a nucleotide sequence of asasaaggGfaCfaGfuauucucaga (SEQ ID NO: 595), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0178] The present invention also provides a polynucleotide molecule for modulating the expression of the APOC3 gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of usCfsugagAfauacUfgUfcCfcsuuuusasa (SEQ ID NO:574) and a sense strand containing a nucleotide sequence of asasaaggGfaCfaGfuauucucaga (SEQ ID NO:596), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thio-phosphate, "(invAb)" refers to inverted abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

[0179] Conjugation

[0180] Targeting moiety

[0181] In some aspects, the polynucleotide molecules described herein are conjugated or linked to one or more targeting moieties to form polynucleotide-targeting moiety conjugate molecules. In some cases, the targeting moiety is selected based on its ability to selectively or preferably target the conjugate molecules described herein to a desired cell population, tissue, or organ. In some cases, the targeting moiety targets cells, tissues, or organs that express the corresponding binding partner (e.g., the corresponding receptor or ligand) of the targeting moiety. For example, a polynucleotide molecule conjugated with N-acetylgalactosamine (GalNAc) can target hepatocytes that express asialoglycoprotein (ASGP-R). Any suitable GalNAc molecule known in the art is contemplated. Exemplary GalNAc molecules include triantennary GalNAc (e.g., L96). Another example of a targeting moiety is galactose. The targeting moiety can also be a lipid, a peptide, or a small molecule.

[0182] The hybrid polynucleotide constructs disclosed herein may include targeting moieties (i.e., intracellular targeting moieties) that target desired intracellular sites (e.g., endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria). Non-limiting examples of intracellular targeting moieties are provided in WO 2015 / 069932 and WO 2015 / 188197; the disclosures of the intracellular targeting moieties in WO 2015 / 069932 and WO 2015 / 188197 are incorporated herein by reference.

[0183] Thus, the polynucleotide molecules described herein may include one or more targeting moieties selected from intracellular targeting moieties, extracellular targeting moieties, and combinations thereof. Thus, inclusion of one or more targeting moieties (e.g., extracellular targeting moieties including targeting moieties independently selected from folic acid, mannose, N-acetylgalactosamine, and prostate specific membrane antigen) and one or more intracellular targeting moieties (e.g., moieties targeting the endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) in the polynucleotide molecules described herein can facilitate delivery of the polynucleotide to specific sites within a particular cell population. In some aspects, the targeting moiety contains one or more mannose carbohydrates. Mannose targets the mannose receptor, a 175 KDa membrane-associated receptor that is expressed on sinusoidal liver cells and antigen presenting cells (e.g., macrophages and dendritic cells). It is an efficient endocytic / recycling receptor that binds and internalizes mannosylated pathogens and proteins (Lennartz et al., J. Biol. Chem. 262:9942-9944, 1987; Taylor et al., J. Biol. Chem. 265:12156-62, 1990).

[0184] This text describes some targeting moieties. In some aspects, the targeting moiety comprises or specifically binds to a protein selected from the group consisting of: insulin, insulin-like growth factor receptor 1 (IGF1R), IGF2R, insulin-like growth factor (IGF; e.g., IGF 1 or 2), mesenchymal-epithelial transition factor receptor (c-met; also known as hepatocyte growth factor receptor (HGFR)), hepatocyte growth factor (HGF), epidermal growth factor receptor (EGFR), epidermal growth factor (EGF), heregulin, fibroblast growth factor receptor (FGFR), platelet-derived growth factor receptor (PDGFR), platelet-derived growth factor (PDGF), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor (VEGF), tumor necrosis factor receptor (TNFR), tumor necrosis factor α (TNF-α), TNF-β, folate receptor (FOLR), folic acid, transferrin, transferrin receptor (TfR), mesothelin, Fc receptor, c-kit receptor, c-kit, integrin (e.g., α4 integrin or β-1 integrin), P-selectin, sphingosine-1-phosphate receptor-1 (S1PR), hyaluronate receptor, leukocyte function-associated antigen-1 (LFA-1), CD4, CD11, CD18, CD20, CD25, CD27, CD52, CD70, CD80, CD85, CD95 (Fas receptor), CD106 (vascular cell adhesion molecule 1 (VCAM1)), CD166 (activated leukocyte cell adhesion molecule (ALCAM)), CD178 (Fas ligand), CD253 (TNF-related apoptosis-inducing ligand (TRAIL)), ICOS ligand, CCR2, CXCR3, CCR5, CXCL12 (stromal cell-derived factor 1 (SDF-1)), interleukin 1 (IL-1), IL-1ra, IL-2, IL-3, IL-4, IL-6, IL-7, IL-8, CTLA-4, MART-1, gp100, MAGE-1, Eph receptor, mucosal addressin cell adhesion molecule 1 (MAdCAM-1), carcinoembryonic antigen (CEA), LewisY, MUC-1, epithelial cell adhesion molecule (EpCAM), cancer antigen 125 (CA125), prostate-specific membrane antigen (PSMA), TAG-72 antigen, and fragments thereof. In further aspects, the targeting moiety comprises an erythroblastic leukemia viral oncogene homolog (ErbB) receptor (e.g., ErbB1 receptor; ErbB2 receptor; ErbB3 receptor; and ErbB4 receptor). In some aspects, the targeting moiety comprises one or more (e.g., 1 to 6) N-acetylgalactosamine (GalNAc). In some aspects, the targeting moiety comprises one or more (e.g., 1 to 6) galactose.In some aspects, the targeting moiety contains one or more (e.g., 1 to 6) mannoses. In other aspects, the targeting moiety contains a folic acid ligand. The folic acid ligand has the following structure:.

[0185]

[0186] Certain targeting moieties can include bombesin, gastrin, gastrin-releasing peptide, tumor growth factor (TGF) (e.g., TGF-α or TGF-β), or vaccinia virus growth factor (VVGF). Non-peptidyl targeting moieties can also be used for the targeting moiety and can include, for example, steroids, carbohydrates, vitamins, and lectins. Some targeting moieties can include polypeptides such as somatostatin or somatostatin analogs (e.g., octreotide or lanreotide), bombesin, or an antibody or antigen-binding fragment thereof. The antibody can be any known class or subclass, e.g., IgG, IgA, IgM, IgD, or IgE. Typically, those antibodies belonging to the IgG class are used. According to techniques known in the art, the antibody can be from any species. However, generally, the antibody is of human, murine, or rabbit origin. In addition, the antibody can be polyclonal or monoclonal, but is typically monoclonal. Human or chimeric (e.g., humanized) antibodies can be used in the targeting moiety. The targeting moiety can include an antigen-binding fragment of an antibody. Such antibody fragments can include, for example, Fab’, F(ab’)2, Fv, or Fab fragments, single-domain antibodies, ScFv, or other antigen-binding fragments. Fc fragments can also be used in the targeting moiety. Such antibody fragments can be prepared, for example, by proteolytic enzyme digestion, e.g., by pepsin or papain digestion, reductive alkylation, or recombinant techniques. The materials and methods for preparing antibody fragments are well known to those skilled in the art. See, for example, Parham, J. Immunology, 131:2895, 1983; Lamoyi et al., J. Immunological Methods, 56:235, 1983.

[0187] Other peptides used as targeting moieties in the polynucleotide molecules described herein can be selected from KiSS peptides and analogs, osteocrin II peptides and analogs, GnRH I and II peptides and analogs, depreotide, vapreotide, vasoactive intestinal peptide (VIP), cholecystokinin (CCK), RGD-containing peptides, melanocyte-stimulating hormone (MSH) peptides, neurotensin, calcitonin, glutathione, YIGSR (leukophilic peptide, e.g., P483H, which contains the heparin-binding region of platelet factor-4 (PF-4) and a lysine-rich sequence), atrial natriuretic peptide (ANP), β-amyloid peptide, δ-opioid antagonist (such as ITIPP (psi)), annexin-V, endothelin, leukotriene B4 (LTB4), chemotactic peptides (e.g., N-formyl-methionyl-leucyl-phenylalanine-lysine (fMLFK)), GP IIb / IIIa receptor antagonists (e.g., DMP444), human neutrophil elastase inhibitors (EPI-HNE-2 and EPI-HNE-4), plasmin inhibitors, antimicrobial peptides, apticide (P280 and P274), thrombospondin receptors (including analogs such as TP-1300), bitistatin, pituitary adenylate cyclase type I receptor (PAC1), fibrin α-chain, peptides derived from phage display libraries, and their conservative substitutions.

[0188] One or more (e.g., 1 to 6) targeting moieties can be linked to the MOIETY or X2 in formula (V’, V”, V”’, V””, V””’, V”””) via -LinkA-.

[0189] In some aspects, the targeting moiety includes one or more (e.g., 1 to 6 or 1 to 3) asialoglycoprotein receptor ligands (e.g., GalNAc). In some aspects, the asialoglycoprotein receptor ligand (e.g., GalNAc) is attached to -LinkA- via the anomeric carbon (e.g., where the anomeric carbon is the carbon atom in an acetal or hemiaminal). In some aspects, the asialoglycoprotein receptor ligand (e.g., GalNAc) contains an anomeric carbon bonded to a trivalent, tetravalent, pentavalent, or hexavalent linker, where the anomeric carbon is part of a hemiaminal group. Compared to a hybrid polynucleotide construct having an asialoglycoprotein receptor ligand (e.g., GalNAc) attached to the linker via an acetal, an asialoglycoprotein receptor ligand (e.g., GalNAc) attached to the linker via a hemiaminal can produce a hybrid polynucleotide construct with better efficacy in gene silencing.

[0190] In some aspects, the linker and three asialoglycoprotein receptor targeting moieties, each containing GalNAc, are shown in formula (V). In some cases, the conjugates described herein contain only one asialoglycoprotein receptor targeting moiety, and thus the conjugate contains the structure of formula (V) with any two targeting moieties removed. In some cases, the conjugates described herein contain only two asialoglycoprotein receptor targeting moieties, and thus the conjugates described herein contain the structure of formula (V) with any one targeting moiety removed.

[0191]

[0192] Wherein one of Y1 and Y2 is a nucleotide, or wherein both Y1 and Y2 are nucleotides, and Y1 and Y2 are consecutive or adjacent nucleotides in the polynucleic acid molecule described herein.

[0193] In some aspects, the linker and targeting moieties described herein are conjugated to the 3'-end of the sense strand (e.g., as shown in formulas (V', V'', V''', V'''')). In some aspects, the linker and targeting moieties described herein are conjugated to the 5'-end of the sense strand (e.g., as shown in formula (V'') or (V''')). In some aspects, the linker and targeting moieties described herein are conjugated to the 3'-end of the antisense strand (e.g., as shown in formulas (V', V'', V''', V'''')). In some aspects, the linker and targeting moieties described herein are conjugated to the 5'-end of the antisense strand (e.g., as shown in formula (V'') or (V''')).

[0194] Wherein Z in formula (V') corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic or others.

[0196]

[0197] Wherein Z in formula (V'') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V'') is adenine, uracil, guanine, cytosine, thymine, abasic or others.

[0198]

[0199] wherein Z in formula (V”’) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V”’) is adenine, uracil, guanine, cytosine, thymine, abasic or others.

[0200]

[0201] wherein Z in formula (V””) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V””) is adenine, uracil, guanine, cytosine, thymine, abasic or others.

[0202]

[0203] wherein Z in formula (V””’) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V””’) is adenine, uracil, guanine, cytosine, thymine, abasic or others.

[0204]

[0205] wherein Z in formula (V”””) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V”””) is adenine, uracil, guanine, cytosine, thymine, abasic or others.

[0206] In some cases, the 3'-end of the passenger / sense strand in Table 1, Table 3, Table 5, or Table 12 is conjugated to X2-GalNAc (see formulas (V), (V'), (V''), (V'''), (V'''')). In some cases, the 5'-end of the passenger / sense strand in Table 1, Table 3, Table 5, or Table 12 is conjugated to X2-GalNAc (see formulas (V), (V''), or (V''')). In some cases, a nucleic acid within the passenger / sense strand in Table 1, Table 3, Table 5, or Table 12 (not at the 5'-end or 3'-end) is conjugated to X2-GalNAc (see formula (V)). In some cases, the 3'-end of the guide / antisense strand in Table 1, Table 3, Table 5, or Table 12 is conjugated to X2-GalNAc (see formulas (V), (V'), (V''), (V'''), (V'''')). In some cases, the 5'-end of the guide / antisense strand in Table 1, Table 3, Table 5, or Table 12 is conjugated to X2-GalNAc (see formulas (V), (V''), or (V''')). In some cases, a nucleic acid within the guide / antisense strand in Table 1, Table 3, Table 5, or Table 12 (not at the 5'-end or 3'-end) is conjugated to X2-GalNAc (see formula (V)).

[0207] In some cases, one or more endosomal escape moieties (e.g., 1 to 6 or 1 to 3) can be attached as auxiliary moieties to the polynucleotide constructs or hybrid polynucleotide constructs disclosed herein. Exemplary endosomal escape moieties include chemotherapeutic agents described herein (e.g., quinolones such as chloroquine); fusogenic lipids (e.g., dioleoylphosphatidylethanolamine (DOPE)); and polymers such as polyethylenimine (PEI); poly(β-amino esters); polypeptides such as polyarginine (e.g., octaarginine) and polylysine (e.g., octalysine); proton sponges, viral capsids, and peptide transduction domains. For example, fusogenic peptides can be derived from the M2 protein of influenza A virus; peptide analogs of influenza virus hemagglutinin; the HEF protein of influenza C virus; the transmembrane glycoprotein of filoviruses; the transmembrane glycoprotein of rabies virus; the transmembrane glycoprotein (G) of vesicular stomatitis virus; the fusion protein of Sendai virus; the transmembrane glycoprotein of Semliki forest virus; the fusion protein of human respiratory syncytial virus (RSV); the fusion protein of measles virus; the fusion protein of Newcastle disease virus; the fusion protein of ovine progressive pneumonia virus; the fusion protein of murine leukemia virus; the fusion protein of HTL virus; and the fusion protein of simian immunodeficiency virus (SIV). Other moieties useful for promoting endosomal escape are described in Dominska et al., Journal of Cell Science, 123(8):1183-1189, 2010. For example, specific examples of endosomal escape moieties are provided in WO 2015 / 188197, including moieties suitable for conjugation to the hybrid polynucleotide constructs disclosed herein; the disclosure of these endosomal escape moieties is incorporated herein by reference.

[0208] As described herein, one or more endosomal escape moieties (e.g., 1 to 6 or 1 to 3) can be attached via -LinkA- to the MOIETY or X2 in formulae (V’, V”, V”’, V””, V””’, V”””).

[0209] One or more cell-penetrating peptides (CPPs) (e.g., 1 to 6 or 1 to 3) can be attached as auxiliary moieties to the polynucleotide constructs or hybrid polynucleotide constructs disclosed herein. As disclosed herein, the CPP can be reversibly linked to the hybrid polynucleotide via a disulfide bond. Thus, after delivery to the cell, the CPP can be cleaved intracellularly, e.g., by intracellular enzymes (e.g., protein disulfide isomerase, thioredoxin, or thioesterase), thereby releasing the polynucleotide.

[0210] CPPs are known in the art (e.g., TAT or Arg8) (Snyder and Dowdy, 2005, Expert Opin. Drug Deliv. 2, 43-51). For example, specific examples of CPPs that include a moiety suitable for conjugation to the hybrid polynucleotide constructs disclosed herein are provided in WO 2015 / 188197; the disclosure of these CPPs is incorporated herein by reference.

[0211] CPPs are positively charged peptides that are capable of facilitating the delivery of biological cargo to cells. It is believed that the cationic charge of CPPs is essential for their function. In addition, the transduction of these proteins does not appear to be affected by cell type, and these proteins can efficiently transduce almost all cells in culture without significant toxicity (Nagahara et al., Nat. Med. 4:1449-52, 1998). In addition to full-length proteins, CPPs have also been successfully used to induce intracellular uptake of DNA (Abu-Amer, supra), antisense polynucleotides (Astriab-Fisher et al., Pharm. Res, 19:744-54, 2002), small molecules (Polyakov et al., Bioconjug. Chem. 11:762-71, 2000), and even inorganic 40 nm iron particles (Dodd et al., J. Immunol. Methods 256:89-105, 2001; Wunderbaldinger et al., Bioconjug. Chem. 13:264-8, 2002; Lewin et al., Nat. Biotechnol. 18:410-4, 2000; Josephson et al., Bioconjug. Chem. 10:186-91, 1999), indicating considerable flexibility in particle size in this method.

[0212] In one case, the CPPs that can be used in the methods and compositions described herein include peptides characterized by significant α-helicity. It has been found that transfection is optimal when the CPP exhibits significant α-helicity. In another case, the CPPs include sequences containing basic amino acid residues that are arranged substantially along at least one face of the peptide. The CPPs described herein can be naturally occurring peptides or synthetic peptides.

[0213] As described herein, one or more cell-penetrating peptides (e.g., 1 to 6 or 1 to 3) can be attached via -LinkA- to the MOIETY or X2 in formula (V’, V”, V”’, V””, V””’, V””).

[0214] The polynucleotide constructs and hybrid polynucleotide constructs disclosed herein may also include a covalently attached neutral polymer-based auxiliary moiety. Neutral polymers include poly(C1-6 alkylene oxides), such as, poly(ethylene glycol) and poly(propylene glycol) and their copolymers, such as, diblock and triblock copolymers. Other examples of polymers include esterified poly(acrylic acid), esterified poly(glutamic acid), esterified poly(aspartic acid), poly(vinyl alcohol), poly(ethylene-co-vinyl alcohol), poly(N-vinylpyrrolidone), poly(ethyl oxazoline), poly(alkyl acrylate), poly(acrylamide), poly(N-alkyl acrylamide), poly(N-acryloylmorpholine), poly(lactic acid), poly(glycolic acid), poly(dioxanone), poly(caprolactone), styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyurethane, N-isopropylacrylamide polymer, and poly(N,N-dialkylacrylamide). Exemplary polymeric auxiliary moieties may have a molecular weight of less than 100, 300, 500, 1000, or 5000 Da (e.g., greater than 100 Da). Other polymers are known in the art.

[0215] As described herein, one or more polymers (e.g., 1 to 6 or 1 to 3) may be attached via -LinkA- to the MOIETY or X2 in Formulas (V’, V”, V”’, V””, V””’, V””).

[0216] Conjugation linker

[0217] In some aspects, the polynucleic acid molecules described herein comprise a sense or antisense strand bonded to at least one group of Formula (I)

[0218]

[0219] or a salt thereof, or a stereoisomer thereof,

[0220] wherein

[0221] each X 1 is independently O or S;

[0222] each X 2 is independently O, S, NH, or a bond;

[0223] MOIETY is an optionally substituted C 2-10 alkane-tetrayl or the group -M 1 -M 2 -M 3 -, where each M 1 and each M 3 is independently absent or is an optionally substituted C 1-6Alkylene, and M 2 is an optionally substituted C 3-9 heterocyclic-tetrayl, an optionally substituted C 6-10 arylene-tetrayl or an optionally substituted C 3-8 cycloalkane-tetrayl;

[0224] Each R 1 and each R 2 is independently H, an optionally substituted C 1-16 alkyl, an optionally substituted C 2-16 heteroalkyl, a conjugating moiety or -LinkA(-T) p , provided that at least one R 1 or at least one R 2 is a conjugating moiety or -LinkA(-T) p ;

[0225] Each R 3 is independently H, an optionally substituted C 1-16 alkyl, an optionally substituted C 2-16 heteroalkyl, an optionally substituted C 2-16 alkenyl, an optionally substituted C 2-16 alkynyl, an optionally substituted (C 1-9 heterocyclic group)-C 1-6 -alkyl, an optionally substituted (C 6-10 aryl)-C 1-6 -alkyl, an optionally substituted (C 3-8 cycloalkyl)-C 1-6 -alkyl, a conjugating moiety or -LinkA(-T) p ;

[0226] R 4 is H, an optionally substituted C 1-6 alkyl, -LinkA(-T) p or -Sol;

[0227] Each LinkA is independently a polyvalent linker (e.g., including -C(O)-N(H)- (e.g., at least one polyvalent linker including -C(O)-N(H)- bonded to T));

[0228] Each T is independently a helper moiety;

[0229] Sol is a solid support;

[0230] m is an integer from 1 to 6;

[0231] Each n is independently 0 or 1;

[0232] Each p is independently an integer from 1 to 6; and

[0233] q is an integer from 0 to 3.

[0234] At least one group of formula (I) can be bonded to the 5'-end, 3'-end, internucleoside phosphate, internucleoside phosphorothioate or internucleoside dithiophosphate of the polynucleotide. When at least one group of formula (I) is bonded to an internucleoside phosphate, internucleoside phosphorothioate or internucleoside dithiophosphate, q is 0. The polynucleotide construct contains no more than one Sol.

[0235] The group -LinkA- can include from 0 to 3 polyvalent monomers (e.g., an optionally substituted C1-6 alkane-triyl, an optionally substituted C1-6 alkane-tetrayl or a trivalent nitrogen atom) and one or more divalent monomers (e.g., from 1 to 40), where each divalent monomer is independently an optionally substituted C1-6 alkylene; an optionally substituted C2-6 alkenylene; an optionally substituted C2-6 alkynylene; an optionally substituted C3-8 cycloalkylene; an optionally substituted C3-8 cycloalkenylene; an optionally substituted C6-14 arylene; an optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O and S; an optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O and S; an imino group; an optionally substituted N; O; or S(O)m, where m is 0, 1 or 2. In some aspects, each monomer is independently an optionally substituted C1-6 alkylene; an optionally substituted C3-8 cycloalkylene; an optionally substituted C3-8 cycloalkenylene; an optionally substituted C6-14 arylene; an optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O and S; an optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O and S; an imino group; an optionally substituted N; O; or S(O)m, where m is 0, 1 or 2 (e.g., m is 2). In certain aspects, each monomer is independently an optionally substituted C1-6 alkylene; an optionally substituted C3-8 cycloalkylene; an optionally substituted C3-8 cycloalkenylene; an optionally substituted C6-14 arylene; an optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O and S; an optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O and S; an optionally substituted N; O; or S(O)m, where m is 0, 1 or 2 (e.g., m is 2). A non-bio-reversible linker that attaches the auxiliary moiety to the conjugate moiety or its reaction product can include from 2 to 500 (e.g., from 2 to 300 or from 2 to 200) such monomers. The group -LinkA- can include a poly(alkylene oxide) (e.g., polyethylene oxide, polypropylene oxide, poly(triethylene oxide), polybutylene oxide, poly(tetramethylene oxide) and their diblock or triblock copolymers). In some aspects, the non-bio-reversible linker includes polyethylene oxide (e.g., poly(ethylene oxide) having a molecular weight less than 1 kDa).

[0236] The group -LinkA-(-T)p in formula (I) can be prepared by the methods described in the following sections. In some cases, -LinkA-(-T)p is formula (II):

[0237] -Q 1 -Q 2 ([-Q 3 -Q 4 -Q 5 s -Q 6 -T) p

[0238] (II),

[0239] where

[0240] each s is independently an integer from 0 to 20 (e.g., 0 to 10), where the repeating units are the same or different;

[0241] Q 1 is a conjugation linker (e.g., [-Q 3 -Q 4 -Q 5 s -Q C -, where Q C is an optionally substituted C 2-12 heteroalkylene (e.g., a heteroalkylene containing -C(O)-N(H)-, -N(H)-C(O)-, -S(O) 2 -N(H)- or -N(H)-S(O) 2 -), an optionally substituted C 1-12 thioalkene (e.g., ), an optionally substituted C 1-12 heteroalkene (e.g., 1,2,3-triazole-1,4-diyl or ), cyclobut-3-ene-1,2-dione-3,4-diyl or pyridine-2-ylhydrazone);

[0242] If p is 1, then Q 2 is a linear group (e.g., [-Q 3 -Q 4 -Q 5 s -), or if p is an integer from 2 to 6, then Q 2 is a branched group (e.g., [-Q 3 -Q 4 -Q 5 s -Q 7 ([-Q 3 -Q 4 -Q 5 ​​​​​s -(Q 7 ) p1 )) p2 , where p1 is 0 or 1, and p2 is 0, 1, 2, or 3);

[0243] Each Q 3 and each Q 6 is independently absent, -CO-, -NH-, -O-, -S-, -SO 2 -, -OC(O)-, -COO-, -NHC(O)-, -C(O)NH-, -CH 2 -, -CH 2 NH-, -NHCH 2 -, -CH 2 O- or -OCH 2 -;

[0244] Each Q 4 is independently absent, optionally substituted C 1-12 alkylene, optionally substituted C 2-12 alkenylene, optionally substituted C 2-12 alkynylene, optionally substituted C 2-12 heteroalkylene, optionally substituted C 6-10 arylene, optionally substituted C 1-9 heteroarylene or optionally substituted C 1-9 heterocyclylene;

[0245] Each Q 5 is independently absent, -CO-, -NH-, -O-, -S-, -SO 2 -, -CH 2 -, -C(O)O-, -OC(O)-, -C(O)NH-, -NH-C(O)-, -NH-CH(R a )-C(O)- or -C(O)-CH(R a )-NH-;

[0246] Each Q 7 is independently optionally substituted C 1-6 alkane-triyl, optionally substituted C 1-6 alkane-tetrayl, optionally substituted C 2-6 heteroalkane-triyl or optionally substituted C 2-6 heteroalkane-tetrayl; and

[0247] Each R a is independently H or an amino acid side chain;

[0248] Provided that Q 3 、Q 4 and Q 5at least one of which is present.

[0249] In some aspects, each Q 4 is independently absent, an optionally substituted C 1-12 alkylene, an optionally substituted C 2-12 alkenylene, an optionally substituted C 2-12 alkynylene, an optionally substituted C 2-12 heteroalkylene or an optionally substituted C 1-9 heterocycloalkylene. In certain aspects, s is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0250] Thus, in formula (II), if each p1 is 0, LinkA can include a single branch point, or if at least one p1 is 1, LinkA can include multiple branch points.

[0251] In formula (II), Q 1 can be -O-Q L -Q C -, where Q L is an optionally substituted C 2-12 heteroalkylene, an optionally substituted C 1-12 alkylene or -(optionally substituted C 1-6 alkylene)-(optionally substituted C 6-10 arylene). In some aspects, Q L is an optionally substituted C 2-12 heteroalkylene or an optionally substituted C 1-12 alkylene. In formula (II), Q C can be:

[0252]

[0253] In formula (II), Q 2 can be a linear group of the formula [-Q 3 -Q 4 -Q 5 s -, where Q 3 , Q 4 and Q 5 are as defined in formula (II). Alternatively, Q 2 can be a branched group [-Q 3 -Q 4 -Q 5 s -Q 7 ([-Q 3 -Q 4 -Q 5 s ​​​-(Q 7 ) p1 ) p2 , wherein each Q 7 is independently an optionally substituted C 1-6 alkane - triyl, an optionally substituted C 1-6 alkane - tetrayl, an optionally substituted C 2-6 heteroalkane - triyl or an optionally substituted C 2-6 heteroalkane - tetrayl;

[0254] wherein

[0255] p1 is 0 or 1;

[0256] p2 is 0, 1, 2 or 3;

[0257] wherein,

[0258] when p1 is 0, LinkA is a trivalent or tetravalent linker, and

[0259] when p1 is 1, LinkA is a tetravalent, pentavalent or hexavalent linker.

[0260] In some aspects, p1 is 0.

[0261] In some aspects, Q 7 is:

[0262]

[0263] Compounds useful for preparing the group - LinkA(-T)p in formula (I) are described herein and in WO 2015 / 188197. Non - limiting examples of - LinkA include:

[0264]

[0265]

[0266]

[0267]

[0268] wherein

[0269] R 18 is a bond to a MOIETY,

[0270] each R 19 is independently a bond to an auxiliary moiety,

[0271] each m5 is independently an integer from 1 to 20,

[0272] each m6 is independently an integer from 1 to 10,

[0273] m7 is an integer from 1 to 6, and

[0274] each X 6 is independently O or S.

[0275] In formula (II), when the conjugate linker is of the formula [-Q 3 -Q 4 -Q 5 s -Q C -, -Q 2 ([-Q 3 -Q 4 -Q 5 s -Q 6 -T) p can be:

[0276]

[0277]

[0278] wherein

[0279] R 20 is the bond to Q 1 in Q, each R C is independently a bond to the auxiliary moiety, each m5 is independently an integer from 1 to 20, 19 each m6 is independently an integer from 1 to 10,

[0280] each m6 is independently an integer from 1 to 10,

[0281] m7 is an integer from 1 to 6, and

[0282] each X 6 is independently O or S.

[0283] In some aspects, the linkers described herein are cleavable. In some aspects, the linkers described herein are non-cleavable.

[0284] In some aspects, the polynucleic acid molecules described herein comprise a sense or antisense strand bonded to at least one group of formula (IV),

[0285]

[0286] wherein at least one of Y1 or Y2 is a nucleotide in the polynucleic acid molecule.

[0287] ​​In some cases, Y1 is the last nucleotide at the 3'-end or the first nucleotide at the 5'-end of a strand of a polynucleic acid molecule. In some cases, Y1 is the last nucleotide at the 3'-end or the first nucleotide at the 5'-end of the sense strand of a polynucleic acid molecule. In some cases, Y1 is the last nucleotide at the 3'-end or the first nucleotide at the 5'-end of the sense strand of a polynucleic acid molecule, and Y2 is a 3-hydroxy-propoxy group. In some cases, Y2 is the first nucleotide at the 5'-end or the last nucleotide at the 3'-end of a strand of a polynucleic acid molecule. In some cases, Y2 is the first nucleotide at the 5'-end or the last nucleotide at the 3'-end of the sense strand of a polynucleic acid molecule. In some cases, Y2 is the first nucleotide at the 5'-end or the last nucleotide at the 3'-end of the sense strand of a polynucleic acid molecule, and Y1 is a 3-hydroxy-propoxy group. In other cases, Y1 and Y2 are two consecutive nucleotides in a strand of a polynucleic acid molecule.

[0288] In some aspects, the targeting moiety described herein is conjugated to the 3'-end of the sense strand (e.g., Formula (IV') or (IV'')). In some aspects, the targeting moiety described herein is conjugated to the 5'-end of the sense strand (e.g., Formula (IV'') or (IV''')). In some aspects, the targeting moiety described herein is conjugated to the 3'-end of the antisense strand (e.g., Formula (IV') or (IV'')). In some aspects, the targeting moiety described herein is conjugated to the 5'-end of the antisense strand (e.g., Formula (IV'') or (IV''')).

[0289]

[0290] Wherein Z in Formula (IV') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in Formula (IV') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0291]

[0292] Wherein Z in Formula (IV'') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in Formula (IV'') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0293]

[0294] Wherein Z in formula (IV”’) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV”’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0295]

[0296] Wherein Z in formula (IV””) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV””) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0297] Pharmaceutical composition

[0298] Delivery of the polynucleotide molecules described herein can be achieved by contacting the cells with the polynucleotide molecules using a variety of methods. In certain aspects, the polynucleotide molecules described herein are formulated with various excipients, vehicles, and carriers, as more fully described elsewhere herein.

[0299] The pharmaceutical compositions described herein can be prepared, using carriers, excipients, and vehicles, in a form suitable for administration to a subject, including the hybrid polynucleotide constructs disclosed herein. Commonly used excipients include magnesium carbonate, titanium dioxide, lactose, mannitol, and other sugars, talc, milk proteins, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycol, and solvents such as sterile water, alcohols, glycerol, and polyols. Intravenous vehicles include fluids and nutrient supplements. Preservatives include antimicrobial agents, antioxidants, chelating agents, and inert gases. Other pharmaceutically acceptable vehicles include aqueous solutions, non-toxic excipients including salts, preservatives, buffers, etc., for example, as described in Remington: The Science and Practice of Pharmacy, 21st Edition, Gennaro, Editor, Lippencott Williams & Wilkins (2005) and The United States Pharmacopeia: The National Formulary (USP 36NF31), published in 2013. The pH and precise concentration of the various components in the pharmaceutical composition are adjusted according to conventional techniques in the art. See Goodman and Gilman's The Pharmacological Basis for Therapeutics.

[0300] The pharmaceutical compositions described herein can be administered locally or systemically. The therapeutically effective amount will vary according to various factors such as the degree of infection in the subject, the age, sex and weight of the individual. The dosage regimen can be adjusted to provide the optimal therapeutic response. For example, several divided doses can be administered daily or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0301] The pharmaceutical compositions can be administered in a convenient manner, such as by injection (e.g., subcutaneous, intravenous, intraorbital, etc.), oral administration, ophthalmic application, inhalation, topical application or rectal administration. Depending on the route of administration, the pharmaceutical composition can be coated with a material to protect the pharmaceutical composition from the action of enzymes, acids and other natural conditions that may inactivate the pharmaceutical composition. The pharmaceutical compositions can also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols and their mixtures and in oils. Under ordinary conditions of storage and use, these preparations can contain preservatives to prevent the growth of microorganisms.

[0302] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The compositions will generally be sterile and fluid to the extent that easy syringability exists. The compositions will generally be stable under the conditions of manufacture and storage and will prevent the contaminating action of microorganisms such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycol, etc.), suitable mixtures thereof and vegetable oils. In the case of a dispersion, suitable fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size and by the use of surfactants. The preventing action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, isotonic agents such as sugars, polyols such as mannitol and sorbitol or sodium chloride are used in the compositions. Prolonged absorption of the injectable compositions can be brought about by including in the composition agents that delay absorption, such as aluminum monostearate and gelatin.

[0303] Sterile injectable solutions can be prepared by incorporating the required amount of the pharmaceutical composition into a suitable solvent with one or a combination of ingredients enumerated above and then, if necessary, filtering sterilizing. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle containing a basic dispersion medium and the required other ingredients enumerated above.

[0304] For convenience in administration and uniformity of dosage, it is particularly advantageous to formulate parenteral compositions in unit dosage form. The unit dosage form used herein refers to physically discrete units suitable as unit doses for the subject to be treated; each unit contains a predetermined quantity of the pharmaceutical composition calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The specification of the unit dosage form is related to the characteristics of the pharmaceutical composition and the particular therapeutic effect to be achieved. For convenient and effective administration, an effective amount of the principal pharmaceutical composition is compounded with a suitable pharmaceutically acceptable vehicle in an acceptable unit dosage. In the case of compositions containing supplementary active ingredients, the dosage is determined by reference to the usual dosage and manner of administration of the ingredients.

[0305] The pharmaceutical composition can be administered orally, for example, in a carrier, for example, in enteric-coated unit dosage forms. The pharmaceutical composition and other ingredients can also be encapsulated in hard or soft gelatin capsules or compressed into tablets. For oral therapeutic administration, the pharmaceutical composition can be admixed with excipients and used in ingestible tablets, lozenges, capsules, pills, wafers, etc. Such compositions and preparations should contain at least 1% by weight of the active compound. Of course, the percentages of the compositions and preparations can vary and can conveniently be between about 5% and about 80% of the weight of the unit. Tablets, lozenges, pills, capsules, etc. can also contain the following: binders such as tragacanth, acacia, corn starch or gelatin; excipients such as dibasic calcium phosphate; disintegrating agents such as corn starch, potato starch, alginic acid, etc.; lubricants such as magnesium stearate; and sweetening agents such as sucrose, lactose or saccharin, or flavoring agents such as peppermint, wintergreen oil or cherry flavor. When the unit dosage form is a capsule, it can also contain a liquid carrier in addition to the materials of the above types. Various other materials can be present as coatings or otherwise modify the physical form of the unit dosage. For example, tablets, pills or capsules can be coated with shellac, sugar or both. Syrups or elixirs can contain agents, sucrose as a sweetening agent, methyl paraben and propyl paraben as preservatives, dyes and flavoring agents such as cherry flavor or orange flavor. Any material used in the preparation of any unit dosage form should be pharmaceutically acceptable in purity and substantially non-toxic at the amounts used. In addition, the pharmaceutical composition can be incorporated into sustained-release preparations and formulations.

[0306] The pharmaceutical compositions described herein may include one or more permeation enhancers that enhance the bioavailability of the polynucleotide molecules described herein. WO 2000 / 67798, Muranishi, 1990, Crit. Rev. Ther. Drug Carrier Systems, 7, 1, Lee et al., 1991, Crit. Rev. Ther. Drug Carrier Systems, 8, 91 are hereby incorporated by reference in their entirety. In some aspects, the permeation enhancer is enteral. In some aspects, the permeation enhancer is transdermal. In some aspects, the permeation enhancer facilitates crossing the blood-brain barrier. In some aspects, the permeation enhancer increases permeability in oral, nasal, buccal, pulmonary, vaginal, or corneal delivery models. In some aspects, the permeation enhancer is a fatty acid or a derivative thereof. In some aspects, the permeation enhancer is a surfactant or a derivative thereof. In some aspects, the permeation enhancer is a bile salt or a derivative thereof. In some aspects, the permeation enhancer is a chelating agent or a derivative thereof. In some aspects, the permeation enhancer is a non-chelating non-surfactant or a derivative thereof. In some aspects, the permeation enhancer is an ester or a derivative thereof. In some aspects, the permeation enhancer is an ether or a derivative thereof. In some aspects, the permeation enhancer is arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, didecanoate, tridecanoate, glyceryl monooleate, dilaurin, 1-monocaprylin, 1-dodecylazacycloheptan-2-one, acyl carnitine, acyl choline, or a monoglyceride, diglyceride, or a pharmaceutically acceptable salt thereof. In a specific aspect, the permeation enhancer is sodium decanoate (C10). In some aspects, the permeation enhancer is chenodeoxycholic acid (CDCA), ursodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glycodeoxycholic acid, glycocholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydrofusidate, or sodium fusidate dihydrate. In some aspects, the permeation enhancer is polyoxyethylene-9-lauryl ether or polyoxyethylene-20-cetyl ether.

[0307] For the polynucleotide molecules described herein, suitable pharmaceutically acceptable salts include (i) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine; (ii) acid addition salts formed with inorganic acids such as, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid; and (iii) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid.

[0308] Although the hybrid polynucleotide constructs described herein may not require the use of excipients for delivery to target cells, it may be advantageous to use excipients in some aspects. Thus, for delivery to target cells, the hybrid polynucleotide molecules described herein can non-covalently associate with excipients to form complexes. Excipients can be used to alter biodistribution after delivery, enhance uptake, increase the half-life or stability of the strands in the hybrid polynucleotide construct (e.g., increase nuclease resistance), and / or increase targeting to specific cell or tissue types.

[0309] Exemplary excipients include condensing agents (e.g., agents capable of attracting or binding nucleic acids through ionic or electrostatic interactions); fusogenic agents (e.g., agents capable of fusing and / or transporting across cell membranes); proteins that target specific cell or tissue types (e.g., thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, or any other protein); lipids; lipopolysaccharides; lipid micelles or liposomes (e.g., formed from phospholipids such as phosphatidylcholine, fatty acids, glycolipids, ceramides, glycerides, cholesterol, or any combination thereof); nanoparticles (e.g., silica, lipid, carbohydrate, or other pharmaceutically acceptable polymeric nanoparticles); complexes formed from cationic polymers and anionic agents (e.g., CRO), wherein exemplary cationic polymers include polyamines (e.g., polylysine, polyarginine, polyamidoamine, and polyethyleneimine); cholesterol; dendrimers (e.g., polyamidoamine (PAMAM) dendrimers); serum proteins (e.g., human serum albumin (HSA) or low density lipoprotein (LDL)); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); lipids; synthetic polymers (e.g., polylysine (PLL), polyethyleneimine, poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, pseudopeptide-polyamine, peptidomimetic polyamine, or polyamine); cationic moieties (e.g., cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides); multivalent sugars (e.g., multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose); vitamins (e.g., vitamin A, vitamin E, vitamin K, vitamin B, folic acid, vitamin B12, riboflavin, biotin, or pyridoxal); cofactors; or drugs that disrupt the cytoskeleton to increase uptake (e.g., paclitaxel, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, spongistatin A, phalloidin, swinholide A, indanocine, or myoservin).

[0310] Other therapeutic agents as described herein may be included in the pharmaceutical compositions described herein in combination with the polynucleotide molecules described herein.

[0311] Methods of treatment

[0312] In some aspects, the present disclosure describes a method of modulating the expression of the APOC3 gene in a subject, comprising: administering to the subject a polynucleotide molecule described herein, a polynucleotide conjugate described herein, or a pharmaceutical composition described herein, thereby modulating the expression of the APOC3 gene in the subject.

[0313] In some aspects, compared to a negative control, the method described herein reduces the expression of the APOC3 gene in the subject by about 10% or at least 10%. In some aspects, compared to a negative control, the method described herein reduces the expression of the APOC3 gene in the subject by about 20% or at least 20%. In some aspects, compared to a negative control, the method described herein reduces the expression of the APOC3 gene in the subject by about 30% or at least 30%. In some aspects, compared to a negative control, the method described herein reduces the expression of the APOC3 gene in the subject by about 40% or at least 40%. In some aspects, compared to a negative control, the method described herein reduces the expression of the APOC3 gene in the subject by about 50% or at least 50%. In some aspects, compared to a negative control, the method described herein reduces the expression of the APOC3 gene in the subject by about 60% or at least 60%. In some aspects, compared to a negative control, the method described herein reduces the expression of the APOC3 gene in the subject by about 70% or at least 70%. In some aspects, compared to a negative control, the method described herein reduces the expression of the APOC3 gene in the subject by about 80% or at least 80%. In some aspects, compared to a negative control, the method described herein reduces the expression of the APOC3 gene in the subject by about 90% or at least 90%. In some aspects, compared to a negative control, the method described herein reduces the expression of the APOC3 gene in the subject by about 100%.

[0314] In some aspects, the methods described herein achieve an IC50 value of about 5 nM. In some aspects, the methods described herein achieve an IC50 value of about 10 nM. In some aspects, the methods described herein achieve an IC50 value of about 15 nM. In some aspects, the methods described herein achieve an IC50 value of about 20 nM. In some aspects, the methods described herein achieve an IC50 value of about 25 nM. In some aspects, the methods described herein achieve an IC50 value of about 30 nM. In some aspects, the methods described herein achieve an IC50 value of about 35 nM. In some aspects, the methods described herein achieve an IC50 value of about 40 nM. In some aspects, the methods described herein achieve an IC50 value of about 45 nM. In some aspects, the methods described herein achieve an IC50 value of about 50 nM. In some aspects, the methods described herein achieve an IC50 value of about 55 nM. In some aspects, the methods described herein achieve an IC50 value of about 60 nM. In some aspects, the methods described herein achieve an IC50 value of about 65 nM. In some aspects, the methods described herein achieve an IC50 value of about 70 nM. In some aspects, the methods described herein achieve an IC50 value of about 75 nM. In some aspects, the methods described herein achieve an IC50 value of about 80 nM. In some aspects, the methods described herein achieve an IC50 value of about 85 nM. In some aspects, the methods described herein achieve an IC50 value of about 90 nM. In some aspects, the methods described herein achieve an IC50 value of about 95 nM. In some aspects, the methods described herein achieve an IC50 value of about 100 nM.

[0315] In some aspects, the methods described herein achieve an IC50 value of about 1 μM. In some aspects, the methods described herein achieve an IC50 value of about 1.1 μM. In some aspects, the methods described herein achieve an IC50 value of about 1.2 μM. In some aspects, the methods described herein achieve an IC50 value of about 1.3 μM. In some aspects, the methods described herein achieve an IC50 value of about 1.4 μM. In some aspects, the methods described herein achieve an IC50 value of about 1.5 μM. In some aspects, the methods described herein achieve an IC50 value of about 2 μM. In some aspects, the methods described herein achieve an IC50 value of about 4 μM. In some aspects, the methods described herein achieve an IC50 value of about 6 μM. In some aspects, the methods described herein achieve an IC50 value of about 8 μM. In some aspects, the methods described herein achieve an IC50 value of about 10 μM. In some aspects, the methods described herein achieve an IC50 value of about 12 μM. In some aspects, the methods described herein achieve an IC50 value of about 13 μM. In some aspects, the methods described herein achieve an IC50 value of about 14 μM. In some aspects, the methods described herein achieve an IC50 value of about 15 μM. In some aspects, the methods described herein achieve an IC50 value of about 30 μM. In some aspects, the methods described herein achieve an IC50 value of about 35 μM. In some aspects, the methods described herein achieve an IC50 value of about 40 μM. In some aspects, the methods described herein achieve an IC50 value of about 50 μM. In some aspects, the methods described herein achieve an IC50 value of about 60 μM. In some aspects, the methods described herein achieve an IC50 value of about 80 μM. In some aspects, the methods described herein achieve an IC50 value of about 100 μM. In some aspects, the methods described herein achieve an IC50 value of about 120 μM. In some aspects, the methods described herein achieve an IC50 value of about 160 μM.

[0316] In some aspects, the present disclosure describes a method of modulating triglycerides in a subject in need thereof, comprising administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, wherein the polynucleic acid molecule described herein, the polynucleic acid molecule conjugate described herein, or the pharmaceutical composition described herein reduces the expression of the APOC3 gene in the subject.

[0317] In some aspects, compared to a negative control, the methods described herein reduce the triglyceride levels of an object by about 10% or at least 10%. In some aspects, compared to a negative control, the methods described herein reduce the triglyceride levels of an object by about 20% or at least 20%. In some aspects, compared to a negative control, the methods described herein reduce the triglyceride levels of an object by about 30% or at least 30%. In some aspects, compared to a negative control, the methods described herein reduce the triglyceride levels of an object by about 40% or at least 40%. In some aspects, compared to a negative control, the methods described herein reduce the triglyceride levels of an object by about 50% or at least 50%. In some aspects, compared to a negative control, the methods described herein reduce the triglyceride levels of an object by about 60% or at least 60%. In some aspects, compared to a negative control, the methods described herein reduce the triglyceride levels of an object by about 70% or at least 70%. In some aspects, compared to a negative control, the methods described herein reduce the triglyceride levels of an object by about 80% or at least 80%. In some aspects, compared to a negative control, the methods described herein reduce the triglyceride levels of an object by about 90% or at least 90%. In some aspects, compared to a negative control, the methods described herein reduce the triglyceride levels of an object by about 100%.

[0318] In some aspects, the objects receiving the methods described herein have severe hypertriglyceridemia. In some specific cases, the objects receiving the methods described herein have familial chylomicron syndrome (FCS). In other aspects, the objects receiving the methods described herein have elevated fasting triglycerides on a restricted low-fat diet. In other aspects, the objects receiving the methods described herein are overweight or obese. In other aspects, the objects receiving the methods described herein have type 2 diabetes. In other aspects, the objects receiving the methods described herein have dyslipidemia. In other aspects, the objects receiving the methods described herein have cardiovascular disease. In other aspects, the objects receiving the methods described herein have atherosclerosis. In other aspects, the objects receiving the methods described herein have had a stroke. In other aspects, the objects receiving the methods described herein have acute pancreatitis. In other aspects, the objects receiving the methods described herein have atherosclerotic cardiovascular disease. In other aspects, the objects receiving the methods described herein have atrial fibrillation. In other aspects, the objects receiving the methods described herein have had a myocardial infarction. In other aspects, the objects receiving the methods described herein have calcific aortic valve stenosis. In other aspects, the objects receiving the methods described herein have had a cardiac arrest. In other aspects, the objects receiving the methods described herein have peripheral artery disease.

[0319] Exemplary embodiments

[0320] Embodiment 1. A polynucleic acid molecule for regulating the expression of apolipoprotein C3 (APOC3) gene, wherein the polynucleic acid molecule comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% identical to the nucleic acid sequences in Table 1, Table 3, Table 5 or Table 12.

[0321] Embodiment 2. The polynucleic acid molecule according to Embodiment 1, wherein the polynucleic acid molecule comprises the nucleic acid sequence in Table 1, Table 3, Table 5 or Table 12.

[0322] Embodiment 3. The polynucleic acid molecule according to any one of Embodiments 1-2, wherein the polynucleic acid molecule is a single-stranded nucleic acid molecule.

[0323] Embodiment 4. The polynucleic acid molecule according to Embodiment 3, wherein the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, 18 consecutive nucleotides that are complementary to the nucleic acid sequences selected from SEQ ID NO: 217-324, 481-504, 541-546 and 575-585, with no more than 1, 2, 3, 4 mismatches.

[0324] Embodiment 5. The polynucleic acid molecule according to Embodiment 3, wherein the single-stranded nucleic acid molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95% complementary to the nucleic acid sequences selected from SEQ ID NO: 217-324, 481-504, 541-546 and 575-585.

[0325] Embodiment 6. The polynucleic acid molecule according to Embodiment 3, wherein the single-stranded nucleic acid molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 1-108, 433-456, 529-534 and 553-563.

[0326] Embodiment 7. The polynucleic acid molecule according to Embodiment 3, wherein the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, 18 consecutive nucleotides that are identical to the nucleic acid sequences selected from SEQ ID NO: 1-108, 433-456, 529-534 and 553-563.

[0327] Embodiment 8. The polynucleic acid molecule according to Embodiment 1, wherein the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand.

[0328] Embodiment 9. The polynucleic acid molecule according to Embodiment 8, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 217-324, 481-504, 541-546, and 575-585.

[0329] Embodiment 10. The polynucleic acid molecule according to Embodiment 8, wherein the sense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 541-546 and 575-585.

[0330] Embodiment 11. The polynucleic acid molecule according to any one of Embodiments 8-10, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-108, 433-456, 529-534, and 553-563.

[0331] Embodiment 12. The polynucleic acid molecule according to Embodiment 11, wherein the antisense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 529-534 and 553-563.

[0332] Embodiment 13. The polynucleic acid molecule according to any one of Embodiments 8-12, wherein the sense strand comprises a nucleic acid sequence that comprises at least 14, 15, 16, 17, 18, 19, or 20 consecutive sequences of a nucleic acid sequence selected from SEQ ID NOs: 217-324, 481-504, 541-546, and 575-585, with no more than 1, 2, 3, or 4 mismatches.

[0333] Embodiment 14. The polynucleic acid molecule according to any one of Embodiments 8-13, wherein the antisense strand comprises a nucleic acid sequence that comprises at least 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive sequences of a nucleic acid sequence selected from SEQ ID NOs: 1-108, 433-456, 529-534, and 553-563, with no more than 1, 2, 3, or 4 mismatches.

[0334] Embodiment 15. The polynucleic acid molecule according to any one of Embodiments 8-14, wherein the sense strand comprises a nucleic acid sequence of SEQ ID NOs: 217-324, 481-504, 541-546, and 575-585, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 1-108, 433-456, 529-534, and 553-563.

[0335] Embodiment 16. The polynucleic acid molecule according to Embodiment 15, wherein the sense strand comprises a nucleic acid sequence selected from SEQ ID NO: 541-546 and 575-585, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NO: 529-534 and 553-563.

[0336] Embodiment 17. The polynucleic acid molecule according to any one of Embodiments 1-16, wherein the polynucleic acid molecule comprises (1) 2'-fluoro-modified nucleotides; (2) 2'-O-methyl-modified nucleotides; (3) 2'-deoxy-modified nucleotides, or (4) modified internucleotide linkages.

[0337] Embodiment 18. The polynucleic acid molecule according to any one of Embodiments 1-17, wherein the polynucleic acid molecule comprises at least two consecutive modified internucleotide linkages at the 5' end.

[0338] Embodiment 19. The polynucleic acid molecule according to any one of Embodiments 8-18, wherein the antisense strand comprises at least two of the three internucleotide linkages in which the 3' end is replaced by a modified internucleotide linkage.

[0339] Embodiment 20. The polynucleic acid molecule according to any one of Embodiments 8-19, wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3' or 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide, and where "n" represents a 2'-O-methyl-modified nucleotide.

[0340] Embodiment 21. The polynucleic acid molecule according to any one of Embodiments 8-20, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3' or 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', where "Nf" represents a 2'-fluoro-modified nucleotide, where "n" represents a 2'-O-methyl-modified nucleotide, and where "invdN" represents a reverse deoxynucleotide.

[0341] Embodiment 22. The polynucleic acid molecule according to any one of Embodiments 8-21, wherein the sense strand comprises 5'-NfnNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3', wherein the antisense strand comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnNfnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0342] Embodiment 23. The polynucleic acid molecule according to any one of Embodiments 8-21, wherein the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0343] Embodiment 24. The polynucleic acid molecule according to any one of Embodiments 8-21, wherein the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0344] Embodiment 25. The polynucleic acid molecule according to any one of Embodiments 8-21, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0345] Embodiment 26. The polynucleic acid molecule according to any one of Embodiments 8-21, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0346] Embodiment 27. The polynucleic acid molecule according to any one of Embodiments 17-26, wherein the modified internucleotide linkage is a phosphorothioate internucleotide linkage.

[0347] Embodiment 28. The polynucleic acid molecule according to any of embodiments 27, wherein the modified internucleotide linkage comprises a stereochemically enriched phosphorothioate internucleotide linkage.

[0348] Embodiment 29. The polynucleic acid molecule according to any one of embodiments 17 - 28, wherein the modified internucleotide linkage is an SP chiral phosphorothioate internucleotide linkage.

[0349] Embodiment 30. The polynucleic acid molecule according to any one of embodiments 17 - 29, wherein the polynucleic acid comprises a plurality of modified internucleotide linkages, and at least 1, 2, 3, or 4 of the plurality of modified internucleotide linkages are stereochemically enriched phosphorothioate internucleotide linkages.

[0350] Embodiment 31. The polynucleic acid molecule according to embodiment 30, wherein the stereochemically enriched phosphorothioate internucleotide linkage comprises both R - isomers and S - isomers.

[0351] Embodiment 32. The polynucleic acid molecule according to one of embodiments 30 - 31, wherein the stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides of two of the six 5'-terminal nucleosides or 3'-terminal nucleosides of the sense strand or the antisense strand.

[0352] Embodiment 33. The polynucleic acid molecule according to any one of embodiments 1 - 32, wherein the polynucleic acid molecule comprises a nucleoside substitution containing a hypoxanthine nucleobase.

[0353] Embodiment 34. The polynucleic acid molecule according to embodiment 33, wherein the nucleoside substitution containing a hypoxanthine nucleobase is an inosine substitution.

[0354] Embodiment 35. The polynucleic acid molecule according to embodiment 34, wherein the inosine substitution is located within the seed region of the antisense strand.

[0355] Embodiment 36. The polynucleic acid molecule according to embodiment 34, wherein the inosine substitution is located within 7 nucleotides from the 5'-end of the antisense strand.

[0356] Embodiment 37. The polynucleic acid molecule according to any one of embodiments 1 - 36, wherein the polynucleic acid molecule comprises an abasic substitution.

[0357] Embodiment 38. The polynucleic acid molecule according to embodiment 37, wherein the abasic substitution is located at the 5th or 7th nucleotide from the 5'-end.

[0358] Embodiment 39. The polynucleic acid molecule according to any one of embodiments 17 - 38, wherein the cytotoxicity of the polynucleic acid molecule is reduced compared to the unmodified polynucleic acid.

[0359] Embodiment 40. The polynucleic acid molecule according to any one of embodiments 17 - 39, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 325 - 432, 505 - 528, 547 - 552, and 586 - 596.

[0360] Embodiment 41. The polynucleic acid molecule according to any one of embodiments 17 - 39, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 109 - 216, 457 - 480, 535 - 540, and 564 - 574.

[0361] Embodiment 42. The polynucleic acid molecule according to any one of embodiments 17 - 41, wherein the sense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 325 - 432, 505 - 528, 547 - 552, and 586 - 596, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 109 - 216, 457 - 480, 535 - 540, and 564 - 574.

[0362] Embodiment 43. The polynucleic acid molecule according to any one of embodiments 1 - 42, wherein the polynucleic acid molecule has a length of 19 - 25 or 21 - 23 nucleotides.

[0363] Embodiment 44. A polynucleic acid molecule for regulating the expression of apolipoprotein C3 (APOC3) gene, wherein the polynucleic acid molecule comprises:

[0364] (a) an antisense strand comprising a nucleotide sequence of UUUCAGGGAACUGAAGCCAUCGG (SEQ ID NO: 529) and a sense strand comprising a nucleotide sequence of GAUGGCUUCAGUUCCCUGAAA (SEQ ID NO: 541);

[0365] (b) an antisense strand comprising a nucleotide sequence of UGAAUACUGUCCCUUUUAAGCAA (SEQ ID NO: 530) and a sense strand comprising a nucleotide sequence of GCUUAAAAGGGACAGUAUUCA (SEQ ID NO: 542);

[0366] (c) The antisense strand with the nucleotide sequence UAGAAUACUGUCCCUUUUAAGCA (SEQ ID NO:531) and the sense strand with the nucleotide sequence CUUAAAAGGGACAGUAUUCUA (SEQ ID NO:543);

[0367] (d) The antisense strand with the nucleotide sequence UUGAGAAUACUGUCCCUUUUAAG (SEQ ID NO:532) and the sense strand with the nucleotide sequence UAAAAGGGACAGUAUUCUCAA (SEQ ID NO:544);

[0368] (e) The antisense strand with the nucleotide sequence UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO:533) and the sense strand with the nucleotide sequence AAAAAGGACAGUAUUCUCAGA (SEQ ID NO:545);

[0369] (f) The antisense strand with the nucleotide sequence UCACUGAGAAUACUGUCCCUUUU (SEQ ID NO:534) and the sense strand with the nucleotide sequence AAGGGACAGUAUUCUCAGUGA (SEQ ID NO:546);

[0370] (g) The antisense strand with the nucleotide sequence UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO:554) and the sense strand with the nucleotide sequence AAAAAGGACAGUAUUCUCAGA (SEQ ID NO:576);

[0371] (h) The antisense strand with the nucleotide sequence UCUGAGAAUACUGUCCCUUUCAA (SEQ ID NO:555) and the sense strand with the nucleotide sequence GAAAGGGACAGUAUUCUCAGA (SEQ ID NO:577);

[0372] (i) The antisense strand with the nucleotide sequence UCUGAGAAUACUGUCCCUUUGAA (SEQ ID NO:556) and the sense strand with the nucleotide sequence CAAAGGGACAGUAUUCUCAGA (SEQ ID NO:578);

[0373] (j) The antisense strand of the nucleotide sequence comprising UCUGAGAAUACUGUCCCUUGCAA (SEQ ID NO:557) and the sense strand of the nucleotide sequence comprising GCAAGGGACAGUAUUCUCAGA (SEQ ID NO:579);

[0374] (k) The antisense strand of the nucleotide sequence comprising UCUGAGAAUACU GUCCCUUCGAA (SEQ ID NO:558) and the sense strand of the nucleotide sequence comprising CGAAGGGACAGUAUUCUCAGA (SEQ ID NO:580);

[0375] (l) The antisense strand of the nucleotide sequence comprising UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO:559) and the sense strand of the nucleotide sequence comprising AAAA GGACAGUAUUCUCAGA (SEQ ID NO:581);

[0376] (m) The antisense strand of the nucleotide sequence comprising UCUGAGAAUACUGUCCCUUUGAA (SEQ ID NO:560) and the sense strand of the nucleotide sequence comprising CAAAGGGACAGUAUUCUCAGA (SEQ ID NO:582);

[0377] (n) The antisense strand of the nucleotide sequence comprising UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO:561) and the sense strand of the nucleotide sequence comprising AAAA GGACAGUAUUCUCAGA (SEQ ID NO:583);

[0378] (o) The antisense strand of the nucleotide sequence comprising UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO:562) and the sense strand of the nucleotide sequence comprising AAAA GGACAGUAUUCUCAGA (SEQ ID NO:584); or

[0379] (p) The antisense strand of the nucleotide sequence comprising UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO:563) and the sense strand of the nucleotide sequence comprising AAAA GGACAGUAUUCUCAGA (SEQ ID NO:585).

[0380] Embodiment 45. A polynucleic acid molecule for regulating the expression of apolipoprotein C3 (APOC3) gene, wherein the polynucleic acid molecule comprises:

[0381] (a) The antisense strand of the nucleotide sequence containing usUfsucagGfgaacUfgAfaGfccaucsgsg (SEQ ID NO:535) and the sense strand of the nucleotide sequence containing gsasuggcUfuCfaGfuucccugaaa (SEQ ID NO:547);

[0382] (b) The antisense strand of the nucleotide sequence containing usGfsaauaCfugucCfcUfuUfuaagcsasa (SEQ ID NO:536) and the sense strand of the nucleotide sequence containing gscsuuaaAfaGfgGfacaguauuca (SEQ ID NO:548);

[0383] (c) The antisense strand of the nucleotide sequence containing usAfsgaauAfcuguCfcCfuUfuuaagscsa (SEQ ID NO:537) and the sense strand of the nucleotide sequence containing csusuaaaAfgGfgAfcaguauucua (SEQ ID NO:549);

[0384] (d) The antisense strand of the nucleotide sequence containing usUfsgagaAfuacuGfuCfcCfuuuuasasg (SEQ ID NO:538) and the sense strand of the nucleotide sequence containing usasaaagGfgAfcAfguauucucaa (SEQ ID NO:550);

[0385] (e) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO:539) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO:551);

[0386] (f) The antisense strand of the nucleotide sequence containing usCfsacugAfgaauAfcUfgUfcccuususu (SEQ ID NO:540) and the sense strand of the nucleotide sequence containing asasgggaCfaGfuAfuucucaguga (SEQ ID NO:552);

[0387] (g) The antisense strand of the nucleotide sequence containing vpusCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO:565) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO:587);

[0388] (h) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuucsasa (SEQ ID NO:566) and the sense strand of the nucleotide sequence containing gsasaaggGfaCfaGfuauucucaga (SEQ ID NO:588);

[0389] (i) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuugsasa (SEQ ID NO:567) and the sense strand of the nucleotide sequence containing csasaaggGfaCfaGfuauucucaga (SEQ ID NO:589);

[0390] (j) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuugcsasa (SEQ ID NO:568) and the sense strand of the nucleotide sequence containing gscsaaggGfaCfaGfuauucucaga (SEQ ID NO:590);

[0391] (k) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuucgsasa (SEQ ID NO:569) and the sense strand of the nucleotide sequence containing csgsaaggGfaCfaGfuauucucaga (SEQ ID NO:591);

[0392] (l) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO:570) and the sense strand of the nucleotide sequence containing (invAb)asasaaggGfaCfaGfuauucucaga (SEQ ID NO:592);

[0393] (m) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuugsasa (SEQ ID NO:571) and the sense strand of the nucleotide sequence containing (invAb)csasaaggGfaCfaGfuauucucaga (SEQ ID NO:593);

[0394] (n) The antisense strand of the nucleotide sequence containing usCfsugdAgdAauacUfgUfcCfcuuuusasa (SEQ ID NO:572) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO:594);

[0395] (o) The antisense strand containing the nucleotide sequence of usCfsugagAfauacUfgUfscCfcuuuusasa (SEQ ID NO:573) and the sense strand containing the nucleotide sequence of asasaaggGfaCfaGfuauucucaga (SEQ ID NO:595); or

[0396] (p) The antisense strand containing the nucleotide sequence of usCfsugagAfauacUfgUfcCfcsuuuusasa (SEQ ID NO:574) and the sense strand containing the nucleotide sequence of asasaaggGfaCfaGfuauucucaga (SEQ ID NO:596),

[0397] wherein “A” refers to adenosine - 3’ - phosphate; “a” refers to 2’ - O - methyladenosine - 3’ - phosphate; “Af” refers to 2’ - fluoroadenosine - 3’ - phosphate; “dA” refers to 2’ - deoxyadenosine - 3 - phosphate; “C” refers to cytidine - 3’ - phosphate; “c” refers to 2’ - O - methylcytidine - 3’ - phosphate; “Cf” refers to 2’ - fluorocytidine - 3’ - phosphate; “dC” refers to 2’ - deoxycytidine - 3’ - phosphate; “G” refers to guanosine - 3’ - phosphate; “g” refers to 2’ - O - methylguanosine - 3’ - phosphate; “Gf” refers to 2’ - fluoroguanosine - 3’ - phosphate; “dG” refers to 2’ - deoxyguanosine - 3’ - phosphate; “U” refers to uridine - 3’ - phosphate; “u” refers to 2’ - O - methyluridine - 3’ - phosphate; “Uf” refers to 2’ - fluorouridine - 3’ - phosphate; “T” refers to 5 - methyluridine - 3’ - phosphate; “t” refers to 2’ - O - methyl - 5 - methyluridine - 3’ - phosphate; “Tf” refers to 2’ - fluoro - 5 - methyluridine - 3’ - phosphate; “dT” refers to 2’ - deoxythymidine - 3’ - phosphate; “s” refers to 3’ - thiophosphate, “(invAb)” refers to inverted abasic deoxyribonucleotide, and “vp” refers to 5’ - vinylphosphonate - modified nucleotide.

[0398] Embodiment 46. A polynucleic acid molecule conjugate for regulating the expression of apolipoprotein C3 (APOC3) gene, wherein the polynucleic acid molecule conjugate comprises a polynucleic acid molecule according to any one of Embodiments 1 - 45 and an asialoglycoprotein receptor - targeting moiety.

[0399] Embodiment 47. The polynucleic acid molecule conjugate according to Embodiment 46, wherein the polynucleic acid molecule and the asialoglycoprotein receptor - targeting moiety are coupled via a linker.

[0400] Embodiment 48. The polynucleic acid molecule conjugate according to Embodiment 47, wherein the linker comprises the following formula (IV), At least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule.

[0402] Embodiment 49. The polynucleic acid molecule conjugate according to embodiment 48, wherein Y1 is the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule.

[0403] Embodiment 50. The polynucleic acid molecule conjugate according to embodiment 48, wherein Y1 and Y2 are two consecutive nucleotides in the polynucleic acid molecule.

[0404] Embodiment 51. The polynucleic acid molecule conjugate according to any one of embodiments 46 - 50, wherein the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose.

[0405] Embodiment 52. The polynucleic acid molecule conjugate according to any one of embodiments 47 - 51, wherein the linker and the asialoglycoprotein receptor targeting moiety with the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule are shown in formula (V'):

[0406] wherein Z in formula (V') is -H, -OH, -O-methyl, -F or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic or others.

[0408] Embodiment 53. The polynucleic acid molecule conjugate according to any one of embodiments 47 - 51, wherein the linker and the asialoglycoprotein receptor targeting moiety with the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule are shown in formula (V""):

[0409] wherein Z in formula (V"") is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (V"") is adenine, uracil, guanine, cytosine, thymine, abasic or others.

[0411] Embodiment 54. The polynucleic acid molecule conjugate according to any one of embodiments 47 - 51, wherein the linker and the asialoglycoprotein receptor targeting moiety of the last nucleotide on the 3' end of the sense strand carrying the polynucleic acid molecule are shown in formula (V'''), (V'''), wherein Z in formula (V''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V''') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0413] Embodiment 55. The polynucleic acid molecule conjugate according to any one of embodiments 47 - 51, wherein the linker and the asialoglycoprotein receptor targeting moiety of the last nucleotide on the 3' end of the sense strand carrying the polynucleic acid molecule are shown in formula (V'''), (V'''), wherein Z in formula (V''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V''') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0414] Embodiment 56. A pharmaceutical composition comprising the polynucleic acid molecule according to any one of embodiments 1 - 45 or the polynucleic acid molecule conjugate according to any one of embodiments 46 - 55, and a pharmaceutically acceptable excipient.

[0415] Embodiment 57. The pharmaceutical composition according to embodiment 56, wherein the pharmaceutical composition is formulated as a nanoparticle preparation.

[0416] Embodiment 58. The pharmaceutical composition according to embodiment 56 or embodiment 57, wherein the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.

[0417] Embodiment 59. A method of modulating the expression of apolipoprotein C3 (APOC3) gene in a subject, comprising: administering to the subject the polynucleic acid molecule according to any one of embodiments 1 - 45 or the polynucleic acid molecule conjugate according to any one of embodiments 46 - 55, or the pharmaceutical composition according to any one of embodiments 56 - 58, thereby modulating the expression of the APOC3 gene in the subject.

[0418] Embodiment 60. A method of modulating triglycerides in a subject in need thereof, comprising: administering to the subject a polynucleic acid molecule according to any one of Embodiments 1-45, or a polynucleic acid molecule conjugate according to any one of Embodiments 46-55, or a pharmaceutical composition according to any one of Embodiments 56-58, thereby modulating the triglycerides of the subject.

[0419] Embodiment 61. The method according to Embodiment 59 or 60, wherein the subject in need thereof has cardiovascular disease or hypertriglyceridemia.

[0420] Examples

[0421] These examples are provided for illustrative purposes only and do not limit the scope of the claims provided herein. For all sequences presented herein, oligonucleotide structures are represented as read from left to right (5' to 3'). Unless otherwise specified, the monomeric codings present in oligonucleotide codings are joined by 5'-3' phosphodiester bonds (followed by 3' internucleotide linkages when read from left to right). The abbreviations of nucleotide monomers used in the representation of oligonucleotide structures are as follows. "A" represents adenosine-3'-phosphate; "a" represents 2'-O-methyladenosine-3'-phosphate; "Af" represents 2'-fluoroadenosine-3'-phosphate; "dA" represents 2'-deoxyadenosine-3'-phosphate; "C" represents cytidine-3'-phosphate; "c" represents 2'-O-methylcytidine-3'-phosphate; "Cf" represents 2'-fluorocytidine-3'-phosphate; "dC" represents 2'-deoxycytidine-3'-phosphate; "G" represents guanosine-3'-phosphate; "g" represents 2'-O-methylguanosine-3'-phosphate; "Gf" represents 2'-fluoroguanosine-3'-phosphate; "dG" represents 2'-deoxyguanosine-3'-phosphate; "U" represents uridine-3'-phosphate; "u" represents 2'-O-methyluridine-3'-phosphate; "Uf" represents 2'-fluorouridine-3'-phosphate; "dU" represents 2'-deoxyuridine-3'-phosphate; "T" represents 5-methyluridine-3'-phosphate; "t" represents 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" represents 2'-fluoro-5-methyluridine-3'-phosphate; "dT" represents thymidine-3'-phosphate; and "s" represents 3'-thiophosphate.

[0422] Example 1 - In Vitro Efficacy of siRNA Targeting APOC3

[0423] A set of siRNAs (shown in Table 1) was generated, and the 3' end of each passenger strand / sense strand was conjugated to a three-pronged GalNAc moiety (GalNAc-L96). The siRNA-GalNAc conjugates were evaluated in vitro in primary human hepatocytes.

[0424] Thawed cryopreserved primary human hepatocytes (PHH) and seeded them at a density of 9×10 4 cells per well onto collagen-coated 96-well plates. In the absence of transfection reagent (free uptake), hepatocytes were treated by incubation with siRNAs shown in Table 1 (where the 3'-end of each passenger strand / sense strand was conjugated to a triantennary GalNAc moiety) for 48 hours. Cells were treated with siRNAs at a concentration of 10 μM or 0.5 μM. Untreated PHH were used as negative controls. siRNAs targeting an irrelevant gene (Ahsa1) were also used as negative controls. At the end of the incubation period, cells were lysed and the relative expression of the target gene was measured by branched DNA (bDNA) assay and normalized to a housekeeping gene (e.g., human GapDH) using standard protocols. The in vitro potency of the siRNAs is listed in Table 2.

[0425] Example 2 - Drug response curves of selected APOC3 siRNAs

[0426] A selected set of siRNAs targeting APOC3 shown in Table 3, and the 3'-end of each passenger strand / sense strand was conjugated to a triantennary GalNAc moiety (GalNAc-L96). Using an experimental setup similar to that in Example 1, the siRNA-GalNAc conjugates were evaluated at 10 different doses in primary human hepatocytes. The corresponding drug response curves are depicted in Figures 1A through 1X and the IC 50 and IC 80 are listed in Table 4.

[0427] Example 3 - Testing APOC3 siRNAs in transgenic mice

[0428] SRS-000231, SRS-000228, SRS-000229 or vehicle (1×PBS) was administered to APOC3 transgenic mice (The Jackson Laboratory, B6; CBA-Tg(APOC3)3707 / Bres / J, strain #006907) by subcutaneous injection (10 mL / kg). The SRS-000231 and SRS-000228 treatment groups were administered at single doses of 10 mg / kg, 3 mg / kg, 1 mg / kg or 0.3 mg / kg, and the SRS-000229 treatment group was administered at single doses of 10 mg / kg, 3 mg / kg or 1 mg / kg. The 3'-end of the passenger strand of each siRNA was conjugated to a triantennary GalNAc moiety (X2-GalNAc as in formula (V')). Plasma from all groups was collected on days -4, 1, 7, 14, 21, 28 and 35. On day 35, liver tissue was collected for mRNA expression analysis.

[0429] Measure plasma total cholesterol levels, triglyceride levels, HDL-c levels, and LDL-c levels. For each measurement and time point, determine the percentage of each individual animal relative to the value on Day -4, and average the results. The group average results and standard deviations are presented in Tables 6, 7, 8, and 9.

[0430] Measure plasma hAPOC3 protein levels on Days 1, 7, 14, 21, 28, and 35 using an ELISA assay (Abcam, catalog number: ab154131). Due to insufficient residual samples for some animals and time points, the results for each individual animal and time point were calculated as the percentage of circulating hAPOC3 protein relative to the group Day 1 average. The average results and standard deviations are presented in Table 10.

[0431] Extract total RNA from liver samples on Day 35 and measure the levels of APOC3 mRNA by RT-qPCR. Normalize the values of animals treated with SRS-000231, SRS-000228, and SRS-000229 relative to the APOC3 mRNA measurements of the PBS-treated group. The average results and standard deviations of the remaining percentage of APOC3 mRNA in each group are presented in Table 11.

[0432] SRS-000231, SRS-000228, and SRS-000229 each dose-dependently reduced plasma APOC3 at all time points (e.g., up to 88.5% in the SRS-000228 treatment group). Additionally, a reduction in liver APOC3 mRNA was observed on Day 35 relative to the control group (e.g., up to 96.7% in the SRS-000231 treatment group). Throughout the study, SRS-000231, SRS-000228, and SRS-000229 each reduced total cholesterol, triglycerides, and LDL-cholesterol.

[0433] Example 4 - Testing APOC3 siRNA in Non-Human Primates

[0434] The siRNA sequences for non-human primate studies are listed in Table 5, wherein the 3' end of each passenger strand / sense strand is conjugated to GalNAc via X2 (see formula (V')). Male cynomolgus monkeys (n = 4 per treatment group / siRNA) were administered the APOC3 siRNA constructs SRS-000225 and SRS-000228 to SRS-000232 (as shown in Table 5) by a single subcutaneous injection at 3 mg / kg. Blood samples were collected before dosing (Day -1) and at Days 3, 7, 10, 14, 21, 28, 35, and 42. The APOC3 circulating protein levels in all serum samples were analyzed using an APOC3 immunoturbidimetric assay (Beijing Leadman Biochemstry, WGAB7031). The results are expressed as the percentage of the remaining circulating APOC3 protein relative to the pre-dose time point and are depicted in Figure 2 In order to evaluate the depth of APOC3 mRNA silencing in liver tissue, ultrasound-guided liver biopsies were collected before dosing (Day -1) and at Days 21 and 42. At each time point, all samples were subjected to RT-qPCR to measure APOC3 mRNA, normalized relative to the reference genes ACTB, PPIA, and ARL1. The APOC3 mRNA levels relative to the pre-dose time point are depicted in Figures 3A - 3C In.

[0435] Relative to the pre-dose time point, each siRNA reduced liver APOC3 mRNA. For example, when normalized relative to the ACTB reference gene, SRS-000231 reduced liver APOC3 mRNA by 90% at Days 21 and 42, while SRS-000228 reduced liver APOC3 mRNA by 89% at Day 21 and 87% at Day 42 when normalized relative to the ACTB reference gene. Similar reductions were observed when normalized relative to ARL1 and PPIA.

[0436] In addition, relative to the pre-dose time point, each siRNA reduced serum APOC3. For example, SRS-000231 reduced serum APOC3 by 64% at Day 21 and 54% at Day 42.

[0437] Example 5 - Testing APOC3 siRNA in transgenic mice

[0438] The siRNA sequences or vehicle (1×PBS) listed in Table 12 were administered as a single dose of 0.5 mg / kg by subcutaneous injection (10 mL / kg) to APOC3 transgenic mice (The Jackson Laboratory, B6; CBA-Tg(APOC3)3707 / Bres / J, strain #006907). The 3’ end of the passenger strand of each siRNA was conjugated to a trisialyl GalNAc moiety (X2-GalNAc as in formula (V’)). Plasma was collected from all groups on days -4, 1, 7, 14, 21, 28, 35, 42, 49, and 56. On day 56, liver tissue was collected for mRNA expression analysis.

[0439] Plasma total cholesterol levels, triglyceride levels, HDL-c levels, and LDL-c levels were measured. For each measurement and time point, the percentage of each individual animal relative to the day 1 value was determined and the results were averaged. Group mean results along with standard deviations are listed in Tables 13, 14, 15, and 16.

[0440] Plasma hAPOC3 protein levels were measured on days 1, 7, 14, 21, 28, 35, 49, and 56 using an ELISA assay (Abcam, catalog number: ab154131). Due to insufficient residual samples for some animals and time points, the results for each individual animal and time point were calculated as the percentage of circulating hAPOC3 protein relative to the mean of its group on day 1. Mean results along with standard deviations are listed in Table 17.

[0441] Total RNA was extracted from liver samples on day 56 and the level of APOC3 mRNA was measured by RT-qPCR. Values from siRNA-treated animals were normalized relative to APOC3 mRNA measurements in the PBS-treated group. Mean results along with standard deviations of APOC3 mRNA expression relative to the vehicle control group are listed in Table 18.

[0442] After single-dose administration at 0.5 mg / kg, all siRNAs significantly reduced plasma APOC3 levels. For example, after treatment with SRS-000231, plasma APOC3 decreased in the range of 69.6% to 89% from day 7 to day 56. After treatment with each siRNA, total cholesterol, triglycerides, and LDL-cholesterol were also reduced. For example, by day 7, SRS-000231 reduced total cholesterol, triglycerides, and LDL-cholesterol by 70.1%, 90%, and 95.2%, respectively, and the levels remained low until day 56. In addition, hepatic APOC3 mRNA remained significantly reduced at day 56 (end of study). For example, SRS-000231 reduced hepatic APOC3 mRNA by 74%. Exemplary siRNAs SRS-001860, SRS-001861, SRS-001862, and SRS-001863 reduced hepatic APOC3 mRNA by 93%, 95%, 97%, and 94%, respectively.

[0443] Although the preferred aspects of the present disclosure have been shown and described herein, these aspects are provided by way of example only to those skilled in the art. Many variations, changes, and substitutions will occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the aspects of the present disclosure described herein may be employed in practicing the present disclosure. The following claims are intended to define the scope of the present disclosure and the methods and structures within the scope of these claims and their equivalents.

[0444] Table 1. Sequence information of siRNAs evaluated in vitro

[0445]

[0446]

[0447]

[0448]

[0449]

[0450] Table 2. In vitro efficacy of candidate siRNAs

[0451]

[0452]

[0453]

[0454]

[0455]

[0456]

[0457] Table 3. Sequence information of siRNAs for evaluating their drug response curves

[0458]

[0459]

[0460] Table 4. Summary of drug response curves of selected APOC3 siRNAs

[0461]

[0462]

[0463] Table 5. Sequence information of siRNAs evaluated in non-human primates

[0464]

[0465] Table 6. Percentage of total cholesterol relative to day -4 after treatment of transgenic mice

[0466]

[0467]

[0468] Table 7. Percentage of triglycerides relative to day -4 after treatment of transgenic mice

[0469]

[0470]

[0471] Table 8. Percentage of HDL-cholesterol relative to day -4 after treatment of transgenic mice

[0472]

[0473]

[0474] Table 9. Percentage of LDL-cholesterol relative to day -4 after treatment of transgenic mice

[0475]

[0476]

[0477] Table 10. Percentage of plasma APOC3 relative to day 1 after treatment of transgenic mice

[0478]

[0479]

[0480] Table 11. Percentage of remaining APOC3 mRNA in transgenic mice after treatment relative to PBS control

[0481]

[0482] Table 12. Additional siRNA sequences evaluated in Example 5

[0483]

[0484] Table 13. Percentage of total cholesterol in transgenic mice after treatment relative to day 1

[0485]

[0486]

[0488] Table 14. Percentage of triglycerides in transgenic mice after treatment relative to day 1

[0489]

[0490]

[0491] Table 15. Percentage of HDL-cholesterol in transgenic mice after treatment relative to day 1

[0492]

[0493]

[0494] Table 16. Percentage of LDL-cholesterol in transgenic mice after treatment relative to day 1

[0495]

[0496]

[0497] Table 17. Percentage of plasma APOC3 in transgenic mice after treatment relative to day 1

[0498]

[0499]

[0500] Table 18. APOC3 mRNA expression in transgenic mice after treatment relative to PBS control

[0501]

[0502]

Claims

1. A polynucleic acid molecule for regulating the expression of apolipoprotein C3 (APOC3) gene, which comprises a sense strand and an antisense strand, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 1-108, 433-456, 529-534 and 553-563.

2. The polynucleic acid molecule according to claim 1, wherein the antisense strand comprises a nucleic acid sequence that comprises at least 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive sequences of the nucleic acid sequences selected from SEQ ID NO: 1-108, 433-456, 529-534 and 553-563, with no more than 1, 2, 3 or 4 mismatches.

3. The polynucleic acid molecule according to claim 1 or 2, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 217-324, 481-504, 541-546 and 575-585.

4. The polynucleic acid molecule according to any one of claims 1-3, wherein the sense strand comprises a nucleic acid sequence that comprises at least 14, 15, 16, 17, 18, 19 or 20 consecutive sequences of the nucleic acid sequences selected from SEQ ID NO: 217-324, 481-504, 541-546 and 575-585, with no more than 1, 2, 3 or 4 mismatches.

5. The polynucleic acid molecule according to any one of claims 1-4, wherein the sense strand comprises the nucleic acid sequences of SEQ ID NO: 217-324, 481-504, 541-546 and 575-585, and the antisense strand comprises the nucleic acid sequences selected from SEQ ID NO: 1-108, 433-456, 529-534 and 553-563.

6. The polynucleic acid molecule according to any one of claims 1-5, wherein the polynucleic acid molecule comprises (1) 2'-fluoro modified nucleotides; (2) 2'-O-methyl modified nucleotides; (3) 2'-deoxy modified nucleotides, or (4) modified internucleotide linkages.

7. The polynucleic acid molecule according to claim 6, wherein the polynucleic acid molecule comprises at least two consecutive modified internucleotide linkages at the 5' end or the 3' end.

8. The polynucleic acid molecule according to any one of claims 6-7, wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3' or 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

9. The polynucleic acid molecule according to any one of claims 6-8, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3' or 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

10. The polynucleic acid molecule according to any one of claims 6-9, wherein i) the sense strand comprises 5'-NfnNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3', and the antisense strand comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnNfnnn-3'; ii) the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', and the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3'; iii) the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3'; iv) the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3'; or v) the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

11. The polynucleic acid molecule according to any one of claims 6-10, wherein the modified internucleotide linkage is a phosphorothioate internucleotide linkage.

12. The polynucleic acid molecule according to any one of claims 6-11, wherein the modified internucleotide linkage comprises a stereochemically enriched phosphorothioate internucleotide linkage.

13. The polynucleic acid molecule according to any one of claims 1-12, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 325-432, 505-528, 547-552, and 586-596.

14. The polynucleic acid molecule according to any one of claims 1-13, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 109-216, 457-480, 535-540, and 564-574.

15. The polynucleic acid molecule according to any one of claims 1-14, wherein the sense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 325-432, 505-528, 547-552, and 586-596, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 109-216, 457-480, 535-540, and 564-574.

16. A polynucleic acid molecule for modulating the expression of apolipoprotein C3 (APOC3) gene, wherein the polynucleic acid molecule comprises: (a) an antisense strand comprising a nucleotide sequence of UUUCAGGGAACUGAAGCCAUCGG (SEQ ID NO: 529) and a sense strand comprising a nucleotide sequence of GAUGGCUUCAGUUCCCUGAAA (SEQ ID NO: 541); (b) an antisense strand comprising a nucleotide sequence of UGAAUACUGUCCCUUUUAAGCAA (SEQ ID NO: 530) and a sense strand comprising a nucleotide sequence of GCUUAAAAGGGACAGUAUUCA (SEQ ID NO: 542); (c) an antisense strand comprising a nucleotide sequence of UAGAAUACUGUCCCUUUUAAGCA (SEQ ID NO: 531) and a sense strand comprising a nucleotide sequence of CUUAAAAGGGACAGUAUUCUA (SEQ ID NO: 543); (d) an antisense strand comprising a nucleotide sequence of UUGAGAAUACUGUCCCUUUUAAG (SEQ ID NO: 532) and a sense strand comprising a nucleotide sequence of UAAAAGGGACAGUAUUCUCAA (SEQ ID NO: 544); (e) an antisense strand comprising a nucleotide sequence of UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO: 533) and a sense strand comprising a nucleotide sequence of AAAAGGGACAGUAUUCUCAGA (SEQ ID NO: 545); (f) The antisense strand with the nucleotide sequence containing UCACUGAGAAUACUGUCCCUUUU (SEQ ID NO: 534) and the sense strand with the nucleotide sequence containing AAGGGACAGUAUUCUCAGUGA (SEQ ID NO: 546); (g) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO: 554) and the sense strand with the nucleotide sequence containing AAAAAGGACAGUAUUCUCAGA (SEQ ID NO: 576); (h) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUCAA (SEQ ID NO: 555) and the sense strand with the nucleotide sequence containing GAAAGGGACAGUAUUCUCAGA (SEQ ID NO: 577); (i) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUGAA (SEQ ID NO: 556) and the sense strand with the nucleotide sequence containing CAAAGGGACAGUAUUCUCAGA (SEQ ID NO: 578); (j) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUGCAA (SEQ ID NO: 557) and the sense strand with the nucleotide sequence containing GCAAGGGACAGUAUUCUCAGA (SEQ ID NO: 579); (k) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUCGAA (SEQ ID NO: 558) and the sense strand with the nucleotide sequence containing CGAAGGGACAGUAUUCUCAGA (SEQ ID NO: 580); (l) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO: 559) and the sense strand with the nucleotide sequence containing AAAAAGGACAGUAUUCUCAGA (SEQ ID NO: 581); (m) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUGAA (SEQ ID NO: 560) and the sense strand with the nucleotide sequence containing CAAAGGGACAGUAUUCUCAGA (SEQ ID NO: 582); (n) The antisense strand with the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO: 561) and the sense strand with the nucleotide sequence containing AAAAAGGACAGUAUUCUCAGA (SEQ ID NO: 583); (o) The antisense strand of the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO:562) and the sense strand of the nucleotide sequence containing AAAAAGGACAGUAUUCUCAGA (SEQ ID NO:584); or (p) The antisense strand of the nucleotide sequence containing UCUGAGAAUACUGUCCCUUUUAA (SEQ ID NO:563) and the sense strand of the nucleotide sequence containing AAAAAGGACAGUAUUCUCAGA (SEQ ID NO:585).

17. A polynucleic acid molecule for regulating the expression of apolipoprotein C3 (APOC3) gene, wherein the polynucleic acid molecule comprises: (a) The antisense strand of the nucleotide sequence containing usUfsucagGfgaacUfgAfaGfccaucsgsg (SEQ ID NO:535) and the sense strand of the nucleotide sequence containing gsasuggcUfuCfaGfuucccugaaa (SEQ ID NO:547); (b) The antisense strand of the nucleotide sequence containing usGfsaauaCfugucCfcUfuUfuaagcsasa (SEQ ID NO:536) and the sense strand of the nucleotide sequence containing gscsuuaaAfaGfgGfacaguauuca (SEQ ID NO:548); (c) The antisense strand of the nucleotide sequence containing usAfsgaauAfcuguCfcCfuUfuuaagscsa (SEQ ID NO:537) and the sense strand of the nucleotide sequence containing csusuaaaAfgGfgAfcaguauucua (SEQ ID NO:549); (d) The antisense strand of the nucleotide sequence containing usUfsgagaAfuacuGfuCfcCfuuuuasasg (SEQ ID NO:538) and the sense strand of the nucleotide sequence containing usasaaagGfgAfcAfguauucucaa (SEQ ID NO:550); (e) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO:539) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO:551); (f) The antisense strand of the nucleotide sequence containing usCfsacugAfgaauAfcUfgUfcccuususu (SEQ ID NO:540) and the sense strand of the nucleotide sequence containing asasgggaCfaGfuAfuucucaguga (SEQ ID NO:552); (g) The antisense strand of the nucleotide sequence containing vpusCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO:565) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO:587); (h) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuucsasa (SEQ ID NO:566) and the sense strand of the nucleotide sequence containing gsasaaggGfaCfaGfuauucucaga (SEQ ID NO:588); (i) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuugsasa (SEQ ID NO:567) and the sense strand of the nucleotide sequence containing csasaaggGfaCfaGfuauucucaga (SEQ ID NO:589); (j) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuugcsasa (SEQ ID NO:568) and the sense strand of the nucleotide sequence containing gscsaaggGfaCfaGfuauucucaga (SEQ ID NO:590); (k) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuucgsasa (SEQ ID NO:569) and the sense strand of the nucleotide sequence containing csgsaaggGfaCfaGfuauucucaga (SEQ ID NO:591); (l) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuuusasa (SEQ ID NO:570) and the sense strand of the nucleotide sequence containing (invAb)asasaaggGfaCfaGfuauucucaga (SEQ ID NO:592); (m) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcuuugsasa (SEQ ID NO:571) and the sense strand of the nucleotide sequence containing (invAb)csasaaggGfaCfaGfuauucucaga (SEQ ID NO:593); (n) The antisense strand of the nucleotide sequence containing usCfsugdAgdAauacUfgUfcCfcuuuusasa (SEQ ID NO:572) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO:594); (o) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfscCfcuuuusasa (SEQ ID NO:573) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO:595); or (p) The antisense strand of the nucleotide sequence containing usCfsugagAfauacUfgUfcCfcsuuuusasa (SEQ ID NO:574) and the sense strand of the nucleotide sequence containing asasaaggGfaCfaGfuauucucaga (SEQ ID NO:596), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "(invAb)" refers to reverse abasic deoxyribonucleotide, and "vp" refers to 5'-vinylphosphonate-modified nucleotide.

18. A polynucleic acid molecule conjugate for regulating the expression of apolipoprotein C3 (APOC3) gene, wherein the polynucleic acid molecule conjugate comprises the polynucleic acid molecule according to any one of claims 1-17 and an asialoglycoprotein receptor targeting moiety.

19. The polynucleic acid molecule conjugate according to claim 18, wherein the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose.

20. The polynucleic acid molecule conjugate according to claim 18 or 19, wherein the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are coupled via a linker.

21. The polynucleic acid molecule conjugate according to claim 20, wherein the linker comprises the following formula (IV), wherein at least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule.

22. The polynucleic acid molecule conjugate according to claim 21, wherein Y1 is the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule, or Y1 and Y2 are two consecutive nucleotides in the polynucleic acid molecule.

23. The polynucleic acid molecule conjugate according to any one of claims 20-22, wherein the linker and the asialoglycoprotein receptor targeting moiety bearing the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule are shown in formula (V'), (V'''), (V'''), or (V''''): wherein Z in formula (V') is -H, -OH, -O-methyl, -F, or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic, or others; wherein Z in formula (V'') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'') is adenine, uracil, guanine, cytosine, thymine, abasic, or others; wherein Z in formula (V''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V''') is adenine, uracil, guanine, cytosine, thymine, abasic, or others; wherein Z in formula (V'''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

24. The polynucleic acid molecule conjugate according to claim 23, wherein the linker and the asialoglycoprotein receptor targeting moiety bearing the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule are shown in formula (V'): (V’)， wherein Z in formula (V') is -H, -OH, -O-methyl, -F, or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

25. A pharmaceutical composition comprising the polynucleic acid molecule according to any one of claims 1-17 or the polynucleic acid molecule conjugate according to any one of claims 18-24, and a pharmaceutically acceptable excipient.

26. The pharmaceutical composition according to claim 25, wherein the pharmaceutical composition is formulated as a nanoparticle preparation.

27. The pharmaceutical composition according to claim 25 or 26, wherein the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.

28. A method of modulating the expression of apolipoprotein C3 (APOC3) gene in a subject in need thereof, which comprises: Administering to the subject a polynucleotide molecule according to any one of claims 1-17 or a polynucleotide molecule conjugate according to any one of claims 18-24, or a pharmaceutical composition according to any one of claims 25-27, to modulate the expression of the APOC3 gene in the subject.

29. A method of modulating triglyceride levels in a subject in need thereof, which comprises: Administering to the subject a polynucleotide molecule according to any one of claims 1-17 or a polynucleotide molecule conjugate according to any one of claims 18-24, or a pharmaceutical composition according to any one of claims 25-27, to modulate the triglyceride levels in the subject.

30. The method according to claim 28 or 29, wherein the subject in need is diagnosed with cardiovascular disease or hypertriglyceridemia, has cardiovascular disease or hypertriglyceridemia, or has symptoms of cardiovascular disease or hypertriglyceridemia.

Images