Engineered protein glutaminase mutant and active secretory expression method thereof in pichia pastoris

Abstract

The invention discloses an engineered protein glutaminase mutant and an active secretory expression method of the engineered protein glutaminase mutant in pichia pastoris. The catalytic activity of the FBPG is successfully improved through surface charge modification, and the specific activity of the mutant F3 is 9.43 times that of a wild type. The secretory expression of the FBPG is realized in pichia pastoris, and the active expression of the FBPG is realized by introducing a Kex2 cleavage site under the regulation and control of a PDH promoter. After overexpression of the transcription factor Sko1, the yield of the active FBPG in a 7 L bioreactor reaches 2610 U / L, a feasible technical scheme is provided for application of the FBPG in the food industry, and meanwhile, a new thought and method are provided for activity expression of similar enzymes.

Description

Technical Field

[0001] The present invention relates to the technical field of enzyme engineering, and particularly relates to an engineered protein glutaminase mutant and a method for its active secretion expression in Pichia pastoris. Background Art

[0002] Protein glutaminase (PG, EC 3.5.1.44) can specifically hydrolyze the glutamine group on the side chain of proteins or peptides to generate L-glutamic acid and ammonia, and is widely used in the field of modification and processing of plant proteins. After deamidation treatment with PG, the functional properties such as solubility, emulsifying property and foaming property of various plant proteins, such as α-zein, wheat gluten protein, oat protein and coconut protein, are improved. However, the protein glutaminase on the current market has problems such as low specific activity, relatively low yield, and expression in the form of zymogen.

[0003] FBPG is a novel protein glutaminase derived from Flavobacterium sp., and shows stronger deamidation activity towards plant proteins under weakly acidic and high-temperature conditions compared with the commercially available protein glutaminase (CPPG), and has good industrial application potential. Research shows that the charge properties between the enzyme and the substrate will affect their binding, and thus affect the catalytic activity. Therefore, increasing the charge intensity of FBPG may improve its deamidation efficiency.

[0004] Pichia pastoris is the second most commonly used protein expression system after Escherichia coli, and belongs to generally recognized as safe microorganisms (GRAS). Because of its excellent post-translational modification ability and high yield, it is widely used in the production of recombinant proteins. Compared with Saccharomyces cerevisiae, the heterologous protein expression level of Pichia pastoris is 10 - 100 times higher, and it can carry out N-glycosylation modification on secreted proteins. The metabolic process of Pichia pastoris does not produce by-products such as ethanol, and it is an ideal host for methanol biotransformation and chemical synthesis. Summary of the Invention

[0005] The purpose of the present invention is to overcome the disadvantages and deficiencies of the prior art, and provide an engineered protein glutaminase mutant.

[0006] Another purpose of the present invention is to provide a method for active secretion expression of the above-mentioned engineered protein glutaminase mutant in Pichia pastoris.

[0007] The purpose of the present invention is achieved by the following technical solutions: An engineered protein glutaminase mutant is a protein obtained by mutating on the basis of the amino acid sequence shown in SEQ ID NO.1, and the mutation on its sequence is A223H or A223K.

[0008] The engineered protein glutaminase mutant described above has a Kex2 cleavage site sequence inserted between K122 and A123 in its amino acid sequence.

[0009] The amino acid sequence of the Kex2 cleavage site sequence is KR*AEA, where * represents any amino acid; preferably, the amino acid sequence of the Kex2 cleavage site sequence is KRNAEA.

[0010] The nucleotide sequence of the coding gene of the engineered protein glutaminase mutant described above is obtained according to the codon coding rule.

[0011] The coding gene of the engineered protein glutaminase mutant is a nucleotide sequence obtained by mutating the nucleotide sequence shown in SEQ ID NO.2 using mutant primers.

[0012] The amino acid sequence of the engineered protein glutaminase mutant is as shown in SEQ ID NO.3.

[0013] The nucleotide sequence of the engineered protein glutaminase mutant is as shown in SEQ ID NO.4.

[0014] The application of the engineered protein glutaminase mutant described above in hydrolyzing proteins.

[0015] A method for constructing an engineered bacterium for active secretion and expression of an engineered protein glutaminase mutant, comprising the following steps: Construct the expression cassette of the engineered protein glutaminase mutant onto a vector, and co-transform it with the CRISPR / cas9 operating vector pCR-Tg into Pichia pastoris X33-Sko1 to obtain an engineered bacterium for active secretion and expression of the engineered protein glutaminase mutant.

[0016] The expression cassette of the engineered protein glutaminase mutant is assembled in sequence by a promoter DH, an α-factor secretion signal, the coding gene of the engineered protein glutaminase mutant, and a terminator AOX1T.

[0017] The nucleotide sequence of the coding gene of the engineered protein glutaminase mutant is as shown in SEQ ID NO.4.

[0018] The promoter DH is derived from the Pichia pastoris genome, and its nucleotide sequence is located at chromosome 4: 1221312 - 1222312 bp on the chromosome.

[0019] The nucleotide sequence of the α-factor secretion signal is as shown in the NCBI database sequence accession number AY694418.1.

[0020] The nucleotide sequence of the terminator AOX1T is as shown from position 1 to position 354 of the NCBI database sequence accession number Z46231.1.

[0021] The nucleotide sequence of the CRISPR / cas9 operating vector pCR-Tg is as shown in SEQ ID NO.17; The nucleotide sequence of the gRNA contained in the CRISPR / cas9 operating vector pCR-Tg is: GCAAGATGGTTAAAAGGTGA.

[0022] The Pichia pastoris X33-Sko1 is obtained by co-transforming a fragment containing the Sko1 gene expression cassette and the CRISPR / cas9 operating vector pCR-Int6 into Pichia pastoris X33, and integrating the Sko1 gene expression cassette into the genomic Int6 locus.

[0023] The Sko1 gene expression cassette is composed of an AOX1 promoter, an Sko1 gene, and a terminator AOX1T assembled in sequence.

[0024] The promoter AOX1 is derived from the Pichia pastoris genome, and its nucleotide sequence is located at chromosome 4: 1549745 - 1550681bp.

[0025] The nucleotide sequence of the Sko1 gene is as shown in the sequence with locus_tag labeled as PAS_chr1-3_0232 in the NCBI database sequence accession number SAMEA2272385.

[0026] The CRISPR / cas9 operating vector pCR-Int6 is obtained by replacing the gRNA of pCR-Tg with gRNA-Int6.

[0027] The nucleotide sequence of the gRNA-Int6 is: CAACTCGAATTATAGTGGCG.

[0028] The nucleotide sequence of the Pichia pastoris genome is as shown in the NCBI database sequence accession number SAMEA2272385.

[0029] An engineered bacterium for active secretion and expression of the engineered protein glutaminase mutant is constructed by the above construction method.

[0030] Use of the above-mentioned engineered bacterium for active secretion and expression of the engineered protein glutaminase mutant in the production of the engineered protein glutaminase mutant.

[0031] A method for active secretion and expression of an engineered protein glutaminase mutant, comprising the following steps: Inoculate the engineered bacteria for active secretion and expression of the engineered protein glutaminase mutant in a fermenter, induce fermentation, separate and purify to obtain the engineered protein glutaminase mutant.

[0032] The specific conditions for the fermentation are as follows: The fermentation temperature is controlled at 30 °C, the aeration rate is 6 L / min, and the dissolved oxygen is controlled at 30% by adjusting the rotation speed; after 20 h of fermentation, glycerol containing 12 mL / L PMT1 is added at a rate of 25 mL / h until the wet weight reaches 180 g / L; subsequently, the Pichia pastoris is starved for 0.5 h and the temperature is reduced to 25 °C. Then, methanol containing 12 mL / L PMT1 is added for induced fermentation for 120 h, with a flow rate of 5 mL / h from 0 to 4 h and a flow rate of 12 mL / h from 4 to 120 h.

[0033] The present invention has the following advantages and effects compared with the prior art: The present invention successfully improves the catalytic activity of FBPG through surface charge modification, and the specific activity of mutant F3 reaches 9.43 times that of the wild type. The secretory expression of FBPG is achieved in Pichia pastoris, and under the regulation of the DH promoter, the active expression of FBPG is achieved by introducing the Kex2 cleavage site. After overexpressing the transcription factor Sko1, the yield of active FBPG reaches 2610 U / L in a 7 L bioreactor, providing a feasible technical solution for the application of FBPG in the food industry and also providing new ideas and methods for the active expression of similar enzymes. Description of the Drawings

[0034] Figure 1 It is the experimental results of the expression and identification of the mutant in Example 2; wherein A and B are the SDS-PAGE analyses of the proenzyme and mature peptide of the wild type WT, mutants R225K, F3 and F4; C is the SDS-PAGE analysis of mutants F1, F2, F5 and F6; D is the specific enzyme activity of the mutants with increased positive charge.

[0035] Figure 2 It is the influence of different promoters on the expression of mutant F3 in Pichia pastoris in Example 3; wherein A is the expression level of mutant F3 under different promoters; B is the SDS-PAGE analysis; C is the Western blot analysis.

[0036] Figure 3 It is a schematic diagram of the integration of the CRISPR / Cas9 system gene expression cassette into the Pichia pastoris genome.

[0037] Figure 4 It is the result graph of the experiment optimizing the Kex2 cleavage site in Example 4; wherein, A, the cleavage site of Kex2; B, the influence of the P1' residue of the Kex2 cleavage site on the expression of the active mutant F3. Indigestive indicates not activated with trypsin; Digestive indicates activated with trypsin; Control indicates FBPG-F3 without introducing the Kex2 cleavage site.

[0038] Figure 5 It is the influence of overexpressing different regulatory factors on the expression of FBPG-F3 in Example 5.

[0039] Figure 6 It is the growth and FBPG-F3 production curves of the strain X33-Sko1 / F3-Kex2-E124 in a 7 L bioreactor in Example 6. Detailed implementation manners

[0040] The present invention will be further described in detail below in conjunction with the embodiments and the accompanying drawings, but the implementation manners of the present invention are not limited thereto.

[0041] If the specific test conditions are not indicated in the following implementation manners, they are usually in accordance with the conventional test conditions or the test conditions recommended by the reagent company. The materials, reagents, etc. used, unless otherwise specified, are all reagents and materials obtained from commercial channels.

[0042] Example 1 Experimental materials and methods 1.1 Experimental materials Plasmids, Strains, and Media: The Pichia pastoris X33 strain was purchased from Invitrogen; the plasmid pET22b(+)-FBPG / R225K was derived from the literature (Long, Y., Peng, S., Zhou, Y., Zhang, H., Zhao, G., & Wang, Y. (2024). Structural analysis of marine flavobacterium protein glutaminase reveals a “gatekeeper” residue affecting its catalytic activity. Journal of Agricultural and Food Chemistry, 72(49), 27504-27512. https: / / doi.org / 10.1021 / acs.jafc.4c04471), the pCR-Tg (gRNA: 5’-GCAAGATGGTTAAAAGGTGA-3’) for gRNA-Cas9 expression, and the donor DNA plasmid pDTEF have been disclosed in the literature “Shi, X. N. One-step integration method of multiple genes in Pichia pastoris based on CRISPR technology [D]. East China University of Science and Technology, 2019. DOI: 10.27148 / d.cnki.ghagu.2019.000117.”, corresponding to pPIC3.5K-PTEF1up-gRNA1 and pDGG-PTg1 therein, respectively; Escherichia coli TOP10 / BL21 competent cells were purchased from Shanghai Sangon Biotech Co., Ltd. The media used in the experiments included LB medium, LLB medium, YPD medium, BMMY medium, BSM medium, etc., and their specific formulations are as follows: LB Medium: Containing 10 g of tryptone, 5 g of yeast extract, and 10 g of NaCl per liter.

[0043] LLB Medium: The NaCl content in LB medium was halved.

[0044] YPD Medium: Containing 20 g of tryptone, 10 g of yeast extract, and 10 g of glucose per liter.

[0045] BMMY Medium: Containing 20 g of peptone, 10 g of yeast extract, 3.4 g of YNB, 10 g of (NH 4 ) 2 SO 4 . Solid media were supplemented with 15 g / L of agar on the basis of the above media.

[0046] BSM medium: containing 26.7 mL H 3 PO4, 0.93 g CaSO 4 、18.2 g K 2 SO 4 、14.9 gMgSO 4 ・7H 2 O, 4.13 g KOH, 40 g glycerol, 4.35 mL PTM1. The PTM1 formula is: containing 6 g CuSO 4 ・5H 2 O, 0.08 g NaI, 3 g MnSO 4 ・H 2 O, 0.2 g Na 2 MoO 4 ・2H 2 O, 0.02 g H 3 BO 3 、0.5 g CoCl 2 、20 gZnCl 2 、65 g FeSO 4 ・7H 2 O, 0.2 g biotin and 5 mL H 2 SO 4 。

[0047] 1.2 Molecular biology techniques Primers for cloning construction were designed using SnapGene software. When performing PCR amplification with plasmid as the template, PrimeSTAR® Max DNA Polymerase (Takara) was used; when using genomic DNA as the template, PrimeSTAR® HS DNA Polymerase (Takara) was used. The PCR products were treated with QuickCut™ DpnI (TaKaRa) to remove the template and then recovered using the SanPrep Column PCR Product Purification Kit (Shanghai Sangon Biotech Co., Ltd.). The target fragments were ligated to the vector using the Hipro DNA Assembly Cloning Kit (EnzyValley).

[0048] 1.3 Protein expression and purification methods The method for protein expression and purification in Escherichia coli refers to the method in Chinese Patent CN118109442A. When performing shake flask fermentation of Pichia pastoris, 0.5 mL of the bacterial solution was inoculated into 50 mL of BMMY medium and cultured at 30 °C and 220 rpm for 24 h, then the temperature was lowered to 25 °C, and 0.5 mL of methanol was added every 12 h to induce fermentation for 48 h.

[0049] 1.4 FBPG Enzyme Activity Assay Method The determination of the activity of purified FBPG enzyme refers to the method in Chinese Patent CN118109442A. The fermentation broth needs to be pretreated before detection. Take 10 mL of the fermentation supernatant and add it to a 10 kDa ultrafiltration tube, centrifuge at 4000×g for 25 min, and wash three times with Buffer A (20 mM Na 2 HPO 4 / NaH 2 PO 4 , pH 7) to fully remove the interference of residual NH 4 ⁺ in the fermentation broth. When FBPG is directly secreted and expressed in an active form, no trypsin activation is required.

[0050] 1.5 SDS - PAGE and Western blotting Analysis Experimental Methods Use a 12.5% SDS - PAGE Color Preparation kit (Shanghai Sangon Biotech Co., Ltd.) to prepare the gel for electrophoresis analysis, and perform electrophoresis at 120 V for 80 min. Western blotting analysis uses a Western detection kit (Beyotime), and the specific operation refers to the kit instruction manual. Finally, use a DAB Horseradish Peroxidase Color Development Kit (Beyotime) for color development.

[0051] Example 2 Construction and Expression of Mutants 2.1 Construction of Mutant Plasmids In previous studies, our research group constructed a mutant enzyme of FBPG, R225K, which improved its enzyme activity to a certain extent. In order to further enhance its performance, in this example, based on this, experiments were conducted on other different mutation sites. On the basis of the constructed mutant R225K, three sites, D181, A223, and Y226, were selected for mutation to construct mutants D181K / R225K (F1), D181H / R225K (F2), A223H / R225K (F3), A223K / R225K (F4), R225K / Y226H (F5), and R225K / Y226K (F6); the primer design and molecular biology experimental methods refer to the steps in 1.2 of Example 1. Using pET22b(+)-FBPG / R225K as a template, the mutants F1-F6 were obtained by PCR amplification with mutant primers.

[0052] Table 1 Correspondence table of mutants, their mutant amino acids, and mutant codons

[0053] 2.2 Expression and identification of mutants Referring to the method in 1.3 of Example 1, the mutant plasmids constructed in 2.1 were transferred into Escherichia coli for expression. The fermentation broth was purified and identified to obtain the enzyme solution. The SDS-PAGE identification results are as shown in Figure 1 A; after digestion with trypsin, the leader peptide was removed, as shown in Figure 1 B. The experimental results showed that the mutants F3 and F4 were successfully expressed to obtain mutant proteins, while the mutants F1, F2, F5, and F6 were expressed as inclusion bodies ( Figure 1 C), and the target proteins could not be obtained.

[0054] Referring to the method in 1.4 of Example 1, the enzyme activity of the expressed enzyme solution was detected. The experimental results are as shown in Figure 1 D. The experimental results showed that the specific enzyme activity of the mutant F3 reached 15.18 U / mg, which was 9.43 times that of the wild type.

[0055] Example 3 Optimization of promoters in Pichia pastoris to improve the expression level of mutants 3.1 Construction of promoter-related plasmids The promoter sequence was amplified from the Pichia pastoris genome (SAMEA2272385) using primers, and fused by overlap extension PCR in the order of the promoter, α-factor secretion signal (AY694418.1), FBPG-F3 (the gene of the F3 mutant in Example 2), and AOX1T terminator (Z46231.1:1-354) to construct the FBPG expression cassette. Then, the expression cassette was inserted between the upstream and downstream homologous arms of 1000 bp in plasmid pDTEF Spe Ⅰ and Apa Ⅰ restriction sites to obtain the expression cassette donor plasmid with different promoters fused to FBPG-F3.

[0056] Table 2 Gene information of promoters

[0057] 3.2 Shake flask fermentation Using the promoter donor plasmid prepared in 3.1 as a template, the insertion fragment was amplified using primers DTFX-F and DTFX-R, mixed with the gRNA-Cas9 plasmid pCR-Tg, and transferred into Pichia pastoris by electroporation. The FBPG expression cassette was integrated into the Pichia pastoris genome, and then the expression and detection were carried out according to the method in Example 1.

[0058] DTFX-F: 5’-CTATGACCATGATTACGAATTCGAGCT-3’; DTFX-R: 5’- TGCCTGCAGGTCGACTCTAG-3’.

[0059] The experimental results showed that P DH drove the highest expression level of the mutant F3, reaching 0.25 U / mL ( Figure 2 in A), and SDS-PAGE and Western blotting analysis also proved that P DH regulated the highest expression level of the mutant F3 ( Figure 2 in B and C in 2). These results indicated that the expression effect of P DH was better than that of P AOX1 , P GAP and other common promoters in Pichia pastoris.

[0060] Example 4 Optimizing the residue at the P1’ position of the Kex2 cleavage site to improve enzyme activity 4.1 Construction of plasmids related to the Kex2 cleavage site The FBPG enzyme usually needs to have its leader peptide removed by trypsin to activate its activity. To simplify this step, in this example, a Kex2 cleavage site was introduced so that its activity can be activated without trypsin treatment after expression. The specific steps are as follows: Using the donor plasmid pDTEF-DH-F3 with the DH promoter obtained in Example 3 as the starting plasmid, the Kex2 cleavage site (KREAEA) was inserted between K122 and A123 of FBPG through the primers Kex2-F / Kex2-R. Then, using this plasmid pDTEF-DH-F3-Kex2 as the template, mutant primer pairs were designed to perform saturation mutagenesis on the P1' site to construct a Kex2 mutant plasmid. The specific mutant amino acids and codons are shown in Table 3.

[0061] Kex2-F: CAGAAACGTGAAGCGGAGGCGAAAGCGAGCAGCTTCGATTTCA; Kex2-R: TTTCGCCTCCGCTTCACGTTTCTGGGTGGACACTTTGCGG.

[0062] Table 3 Corresponding table of mutant amino acids and mutant codons at the P1' position of the Kex2 cleavage site

[0063] 4.2 Shake flask fermentation Referring to the method in 3.2 of Example 3, the Kex2 mutant plasmid constructed in 4.1 was transferred into Pichia pastoris by electroporation, and positive clones were screened for shake flask fermentation and enzyme activity detection. The experimental results are as Figure 4 shown. By introducing the Kex2 cleavage site between the FBPG propeptide and the mature peptide, the expression of active FBPG was successfully achieved. In addition, the results of saturation mutagenesis showed that when the residue at the P1' position of the Kex2 cleavage site was N, the expression level of active FBPG was the highest, reaching 0.16 U / mL. Therefore, the optimal Kex2 cleavage site for FBPG is KRNAEA.

[0064] Example 5 Overexpression of regulatory factors to increase the expression level 5.1 Construction of overexpression plasmid for regulatory factors The highly efficient integration site Int6 in Pichia pastoris reported in the reference (J. Gao, J. Xu, Y. Zuo, C. Ye, L. Jiang, L. Feng, L. Huang, Z. Xu, J. Lian, Synthetic biology toolkit for marker-less integration of multigene pathways into Pichia pastoris via CRISPR / Cas9, ACS Synth. Biol. 11 (2022) 623–633. https: / / doi.org / 10.1021 / acssynbio.1c00307.) was used as a template with pCR-Tg, and primers were designed to amplify by PCR to replace the gRNA, obtaining the gRNA-Cas9 plasmid pCR-Int6 (gRNA: 5’-CAACTCGAATTATAGTGGCG-3’). The coding genes of Pbs2 (locus_tag: PAS_chr1-3_0267), Sko1 (locus_tag: PAS_chr1-3_0232), Hot1 (locus_tag: PAS_chr1-1_0149), Hot2 (locus_tag: PAS_chr1-1_0105), and Hog1 (locus_tag: PAS_chr1-1_0165) were amplified from the Pichia pastoris genome by PCR using primers respectively, and the corresponding regulatory factor expression cassettes were constructed with the AOX1 promoter and the AOX1T terminator. The upstream and downstream 1000 bp of the Int6 integration site were amplified from the Pichia pastoris genome as homologous arms by primers Int6up-F / Int6up-R and Int6down-F / Int6down-R respectively. They were constructed onto the pDTEF vector linearized by PCR with primers pDTFX-F / pDTFX-R in the order of the upstream homologous arm, the regulatory factor expression cassette, and the downstream homologous arm by seamless cloning, obtaining a series of corresponding regulatory factor donor plasmids.

[0065] Table 4 Primers related to the construction of regulatory factor expression cassettes

[0066] 5.2 Expression and identification Using the regulatory factor donor plasmid prepared in 5.1 as a template, the insertion fragment was amplified using primers DTFX-F and DTFX-R. After mixing with the gRNA-Cas9 plasmid pCR-Int6, it was transferred into Pichia pastoris by electroporation, and the FBPG expression cassette was integrated into the Pichia pastoris genome. The Pichia pastoris with overexpressed transcription factor was screened. Then it was made into competent cells, and the FBPG-F3-Kex2-E124N expression cassette was integrated into the Pichia pastoris genome according to the method described in 3.1, and the expression and detection were carried out according to the method in Example 1.

[0067] The experimental results showed that the overexpression of Sko1, Pbs2 and Hot1 promoted the expression of FBPG-F3. When Sko1 was overexpressed, the expression level of F3 increased by 1.5 times, and the proportion of active F3 increased to 60% ( Figure 5 ). Therefore, the strain X33-Sko1 / F3-Kex2-E124N corresponding to the overexpression of Sko1 was selected as the best production strain of FBPG.

[0068] Example 6 Bioreactor culture Pichia pastoris was amplified in a 7 L fermenter to produce FBPG. The seed liquid cultured for 16 h was inoculated into a 7 L fermenter containing 3 L of BSM medium at an inoculation amount of 10% (v / v). The fermentation temperature was controlled at 30 °C, the aeration rate was 6 L / min, and the dissolved oxygen was controlled at 30% by adjusting the rotation speed. After 20 h of fermentation, glycerol containing 12 mL / L PMT1 was added at a rate of 25 mL / h until the wet weight reached 180 g / L. Subsequently, Pichia pastoris was starved for 0.5 h and the temperature was reduced to 25 °C. Then methanol containing 12 mL / L PMT1 was added for induced fermentation for 120 h, with a flow rate of 5 mL / h from 0 to 4 h and a flow rate of 12 mL / h from 4 to 120 h. Samples were taken every 24 h for OD 600 、wet weight and enzyme activity analysis.

[0069] The experimental results showed that when the strain X33-Sko1 / F3-Kex2-E124N was fermented in a 7 L bioreactor, the cell wet weight reached 443 g / L after 144 h, the OD 600 value reached 431, the expression level of active F3 was 2610 U / L, and FBPG-F3 in the bioreactor was completely expressed in the active form ( Figure 6 ).

[0070] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. An engineered protein glutaminase mutant, characterized in that: It is a protein obtained by mutation based on the amino acid sequence shown in SEQ ID NO.1, and the mutation in the sequence is A223H or A223K.

2. The engineered protein glutaminase mutant according to claim 1, characterized in that: A Kex2 cleavage site sequence is also inserted between K122 and A123 in its amino acid sequence; The amino acid sequence of the Kex2 cleavage site sequence is KRNAEA.

3. The engineered protein glutaminase mutant according to claim 1, characterized in that: The coding gene of the engineered protein glutaminase mutant is a nucleotide sequence obtained by mutation using mutation primers based on the nucleotide sequence shown in SEQ ID NO.

2.

4. The engineered protein glutaminase mutant according to claim 1, characterized in that: The amino acid sequence of the engineered protein glutaminase mutant is shown in SEQ ID NO.3; The nucleotide sequence of the engineered protein glutaminase mutant is shown in SEQ ID NO.

4.

5. Use of the engineered protein glutaminase mutant according to any one of claims 1 to 4 in hydrolyzing proteins.

6. A method for constructing an engineered bacterium that actively secretes and expresses an engineered protein glutaminase mutant, characterized in that The steps include: The engineered protein glutaminase mutant expression cassette was constructed into a vector, and was transferred into Pichia pastoris X33-Sko1 together with the CRISPR / cas9 operation vector pCR-Tg to obtain an engineered bacterium that actively secreted and expressed the engineered protein glutaminase mutant; The engineered protein glutaminase mutant expression cassette is composed of a promoter DH, an α-factor secretion signal, a coding gene for the engineered protein glutaminase mutant, and a terminator AOX1T assembled in sequence; The nucleotide sequence of the gene encoding the engineered protein glutaminase mutant is shown in SEQ ID NO.

4.

7. The method for constructing an engineered bacterium for active secretory expression of an engineered protein glutaminase mutant according to claim 6, characterized in that: The promoter DH is derived from the Pichia pastoris genome, and the position of its nucleotide sequence on the chromosome is chromosome4: 1221312-1222312 bp; The nucleotide sequence of the α-factor secretion signal is shown in the NCBI database sequence accession number AY694418.1; The nucleotide sequence of the terminator AOX1T is shown in the NCBI database sequence accession number Z46231.1 from position 1 to position 354; The nucleotide sequence of the CRISPR / cas9 operation vector pCR-Tg is shown in SEQ ID NO.17; The nucleotide sequence of the gRNA contained in the CRISPR / cas9 operation vector pCR-Tg is: GCAAGATGGTTAAAAGGTGA.

8. The method for constructing an engineered bacterium that actively secretes and expresses an engineered protein glutaminase mutant according to claim 6, characterized in that: The Pichia pastoris X33-Sko1 is obtained by transferring a fragment containing the Sko1 gene expression cassette and the CRISPR / cas9 operation vector pCR-Int6 into Pichia pastoris X33, and integrating the Sko1 gene expression cassette into the genome Int6 site; The Sko1 gene expression cassette is composed of the AOX1 promoter, the Sko1 gene and the terminator AOX1T assembled in sequence; The promoter AOX1 is derived from the Pichia pastoris genome, and the position of its nucleotide sequence on the chromosome is chromosome 4: 1549745-1550681 bp; The nucleotide sequence of the Sko1 gene is shown in the sequence with locus_tag label PAS_chr1-3_0232 in the NCBI database sequence accession number SAMEA2272385; The nucleotide sequence of the terminator AOX1T is shown in the NCBI database sequence accession number Z46231.1 from position 1 to position 354; The CRISPR / cas9 operation vector pCR-Int6 is obtained by replacing the gRNA of pCR-Tg with gRNA-Int6; The nucleotide sequence of the gRNA-Int6 is: CAACTCGAATTATAGTGGCG.

9. An engineered bacterium that actively secretes and expresses an engineered protein glutaminase mutant, characterized in that The method is constructed by any one of claims 6 to 8.

10. Use of the engineered bacteria that actively secrete and express the engineered protein glutaminase mutant according to claim 9 in producing the engineered protein glutaminase mutant.

Images