A VIGS silencing system of AmPDS gene of Allium mongolicum and its application

Abstract

The present invention provides a VIGS silencing system of AmPDS gene of Allium mongolicum and its application, which belongs to the technical field of plant genetic engineering. The AmPDS gene cloned fragment is connected to the multiple cloning site of tobacco rattle virus vector to obtain a recombinant plasmid. TRV2‑AmPDS , transformed into Agrobacterium to obtain recombinant plasmid TRV2‑AmPDS Agrobacterium was used to infect leaves of Allium mongolicum; the AmPDS gene is represented by SEQ ID NO. 3. The AmPDS gene-silenced plants obtained by constructing the VIGS silencing system for the AmPDS gene of Allium mongolicum provided by the present invention exhibited an albino phenotype within 20 days, with significantly reduced AmPDS gene expression and a silencing rate reaching a maximum of 56.7%. The establishment of this system provides important support for in-depth research on stress-resistant genes in Allium mongolicum.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to an Allium mongolicum AmPDS gene VIGS silencing system and application thereof. Background Art

[0002] Allium mongolicum Allium mongolicum Allium mongolicum is a perennial herbaceous plant of the genus Allium in the Amaryllis family. It exhibits strong stress tolerance, enduring drought, saline-alkali, and infertile environments, and is widely distributed across the Mongolian Plateau (Yan Zizhu et al., 2023). As a specialty vegetable with high edible and medicinal value, the stress resistance mechanisms of Allium mongolicum have become a research focus, and research on the functions of related genes is ongoing (Wei Pengchao et al., 2025). However, tissue culture of Allium mongolicum is difficult, with low callus induction rates and challenges in inducing proliferation (Wang Like et al., 2018). This makes the establishment of a stable transformation system for Allium mongolicum challenging. Compared to model plants such as Arabidopsis thaliana, Allium mongolicum, as a perennial plant, has a longer cycle from sowing to flowering, significantly extending the timeframe for transgenic experiments. These challenges have hindered functional studies of genes involved in the growth and development of Allium mongolicum. Therefore, given the difficulty in establishing a homologous stable transformation system based on efficient tissue culture techniques, leveraging VIGS for transient verification of gene function will facilitate the development of a reliable and efficient system for functional verification, significantly advancing research on functional Allium mongolicum genes. Summary of the Invention

[0003] The purpose of the present invention is to provide a simple, reliable and efficient function verification system for Allium mongolicum growth and development related genes.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides a VIGS silencing system for the AmPDS gene of Allium mongolicum. The construction method is as follows: the AmPDS gene clone fragment is connected to the multiple cloning site of the tobacco rattle virus vector to obtain a recombinant plasmid. TRV2-AmPDS , transformed into Agrobacterium to obtain recombinant plasmid TRV2-AmPDS Agrobacterium tumefaciens infects the leaves of Allium mongolicum;

[0006] The nucleotide sequence of the AmPDS gene is shown in SEQ ID NO.3.

[0007] Preferably, the upstream primer used in cloning the AmPDS gene is shown in SEQ ID NO.1, and the downstream primer is shown in SEQ ID NO.2:

[0008] SEQ ID NO.1:CCCCGGGGGAGGTCCCCAACCAGAGAA;

[0009] SEQ ID NO. 2: CGGATCCGACCGACTAAACTCTCCAGGC.

[0010] Preferably, the restriction endonucleases used when constructing the silencing vector using tobacco rattle virus are SmaⅠ and BamHI.

[0011] Preferably, the Agrobacterium is used to infect the Allium mongolicum leaves by friction infection or injection infiltration;

[0012] The specific operation of the friction infection method is as follows: using sterilized quartz sand to rub small wounds on the leaves of Allium mongolicum, and then using sterile absorbent cotton dipped in Agrobacterium resuspension to repeatedly wipe the wounds for 2 to 5 minutes;

[0013] The operation of the injection infiltration method is as follows: using a pipette equipped with a 100 μl pipette tip to inject 50-100 μl of Agrobacterium resuspension solution slowly and pressure-injected into the Allium mongolicum leaves until the bacterial solution infiltrates the leaves.

[0014] The present invention also provides application of the construction method in verifying the function of the Allium mongolicum AmPDS gene.

[0015] This study uses tobacco rattle virus (Tab. Rattle Virus) and the AmPDS gene as a reporter gene to establish an effective VIGS system in Allium mongolicum leaves. Results showed that silenced plants exhibited an albinism phenotype after 20 days, with significantly reduced AmPDS gene expression, reaching a silencing rate of up to 56.7%. This system provides important support for further research into stress-resistant genes in Allium mongolicum. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0017] Figure 1 This is the cloning result of AmPDS gene of Allium mongolicum;

[0018] Figure 2 This is the sequencing alignment result of E. coli transformants;

[0019] Figure 3 The PCR results of Agrobacterium transformant colonies are shown;

[0020] Figure 4 The AmPDS silenced phenotype of Allium mongolicum (A: Allium mongolicum plants infected by injection infiltration; B: Allium mongolicum plants infected by friction infection; C: control plants);

[0021] Figure 5 Silencing effect of the Allium mongolicum AmPDS gene (A: RT-qPCR results after silencing of the Allium mongolicum AmPDS gene; B: Statistics of silencing rate of the Allium mongolicum AmPDS gene). DETAILED DESCRIPTION

[0022] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0023] Example 1

[0024] Select plump and similar-sized mongolica seeds, soak them for 6 hours and then sow them into the seedling medium. Routine watering management is carried out after the seedlings emerge. The infection experiment is carried out 45 days after the seedlings grow.

[0025] 1. Cloning of AmPDS silent fragments

[0026] Total RNA was extracted from Allium mongolicum leaves according to the instructions of the Plant Total RNA Extraction Kit (Takara, Japan), and the concentration of the RNA samples was measured using a NanoDrop 2000 UV spectrophotometer. Subsequently, the RNA was reverse transcribed into first-strand cDNA using a cDNA Synthesis Kit (Shanghai Biotechnology Co., Ltd.). The AmPDS gene (Genebank gene sequence number: PV416815) was selected as a template, and specific primers AmPDS-F / R were designed (see Table 1).

[0027] Table 1

[0028]

[0029] The target fragment is 314 bp in length and the sequence is

[0030] GAGGTCCCCAACCAGAGAAAAAAGCTCAAAGTTGTGATTGCTGTGCAGGATTGGCTGGTCTTTCTACTGCAAAATATTTAGCTGATGCTGGACATACACCTATATTATTGGAAGCTAGAGATGTTCTGGGAGGCAAGGTTGCTGCTTGGAAAGACAAGG ATGGGGATTGGTACGAGACAGGTCTCCATATTTTCTTTGGAGCTTATCCTAATGTTCAAAATTTATTTGGAGAGCTTGGTATAAATGATCGATTGCAATGGAAAGAACATTCCATGATTTTTGCCATGCCAAATAAGCCTGGAGAGTTTAGTCGG (SEQ ID NO.3)

[0031] Gene fragments were amplified using K5 high-fidelity enzyme (Zhuangmeng Biotechnology, Beijing). The PCR reaction system was prepared according to the manufacturer's instructions. The amplification program was as follows: pre-denaturation at 95°C for 3 minutes; 30 cycles of denaturation at 95°C for 15 seconds, annealing at 59°C for 15 seconds, and extension at 72°C for 30 seconds; and a final extension at 72°C for 10 minutes. After amplification, PCR products were detected by 1.0% agarose gel electrophoresis, and the bands were photographed and recovered using a gel imaging system.

[0032] 2. Vector Construction

[0033] The TRV2 vector was double-digested with restriction endonucleases SmaⅠ and BamHI at 30°C for 30 min. The enzyme digestion system is as follows:

[0034] Add 1-2 μg of TRV2 plasmid (volume calculated based on the plasmid extract concentration), 2 μL of 10× Quick Cut Buffer, 1.5 μL of SmaⅠ, and 1.5 μL of BamHI. Adjust the volume to 20 μL with ddH2O. Incubate at 30°C for 30 min. The digested product was detected by electrophoresis on a 1.0% agarose gel and then recovered.

[0035] Recombinant plasmid TRV2-AmPDS system:

[0036] 100 ng of linearized vector, insert fragment AmPDS 10 ng, 4 µL T4 buffer, 2 µL T4 ligase, dilute to 20 µL with ddH2O. Ligation was performed overnight at 16°C.

[0037] 3. Plasmid transformation

[0038] The recombinant ligation product was added to a DH5α competent cell for transformation. The plate was plated onto LB (Luria-Bertani) solid medium (containing 50 mg / L kanamycin) and checked for single colonies after 16 hours. Plaques were selected in a clean bench and positive colonies were tested by PCR using the Rapid PCR Mix instructions. After confirming the correct size of the PCR product using 1.0% agarose gel electrophoresis, the bacterial suspension was sequenced and aligned. Once alignment was correct, the plasmid was extracted and transformed into Agrobacterium tumefaciens GV3101 according to the manufacturer's instructions. Positive clones were verified by PCR and expanded to prepare a bacterial suspension.

[0039] 4. Preparation of infection solution

[0040] The Agrobacterium GV3101 culture containing the plasmid was propagated to OD 600 The concentration of the infection solution is 1.0-1.5. After centrifugation, add the same volume of infection solution to resuspend the bacteria and protect from light for 2-3 hours. The infection solution is prepared before use and the formula is 10 mmol·L-1 MgCl2+10 mmol·L -1 MES (2-(N-morpholino)ethanesulfonic acid) + 400 μmol·L -1 AS (acetosyringone), after the light protection is completed, the bacterial solution containing pTRV1 and the recombinant vector ( TRV2-AmPDS ) Mix the bacterial solution in a volume ratio of 1:1 and set aside.

[0041] 5. Infection method

[0042] Injection infiltration method (T1): Using a pipette equipped with a 100 μL yellow tip, slowly inject the Agrobacterium suspension (approximately 50-100 μL) into the leaves of Allium mongolicum under pressure until the suspension completely infiltrates the leaves. Incubate in the dark for 48 hours and then incubate as normal. Each treatment is repeated for 30 plants.

[0043] Friction infection method (T2): Use sterilized quartz sand to create small wounds on the leaves of Allium mongolicum. Use sterile absorbent cotton to repeatedly wipe the wounds with Agrobacterium suspension for approximately 3 minutes. After 48 hours of incubation in the dark, incubate normally. Repeat each treatment for 30 plants.

[0044] 6. Expression analysis after infection

[0045] Albino leaves were quickly cut with pre-chilled scissors, frozen in liquid nitrogen, and then stored at -80°C until use. Next, total RNA was extracted from the samples using a plant RNA extraction kit, and expression levels were analyzed using the internal reference primers AmactinF / R and the AmPDS-specific quantitative primers AmPDSq-F / R (Table 2).

[0046] Table 2

[0047]

[0048] 7. Calculation of infection success rate

[0049] The percentage of albino plants was marked as the VIGS silencing rate, which was calculated as follows: plant silencing rate = (number of albino plants / total number of transformed plants) × 100%.

[0050] 8. Results and Analysis

[0051] (1) Cloning of the AmPDS gene from Allium mongolicum

[0052] The silenced fragments obtained by PCR amplification using AmPDS primers can be seen from the agarose gel electrophoresis results (e.g. Figure 1A, -: negative control; P1-P2: AmPDS gene PCR results). The selected cloned fragment is 314 bp, while the band position is around 300 bp. Therefore, the obtained PCR product fragment length is consistent with the expectation. After gel recovery and purification, the cloning vector was constructed and transformed into E. coli DH5α for cloning. The transformants were analyzed by rapid colony PCR (e.g. Figure 1 B, V1~V6: positive colony PCR results), select positive monoclonal bacterial solution for sample, sequence the positive clones (sequencing comparison results are as follows Figure 2 As shown in Figure 3), the sequencing accuracy rate reached 99.92%, proving that the AmPDS silenced fragment was successfully cloned.

[0053] (2) Construction of Agrobacterium vector

[0054] The bacteria solution that was sequenced correctly was expanded overnight, the plasmid was extracted, and after double enzyme digestion, it was connected with the TRV2 linearized vector by T4 and transformed. The positive colonies obtained in this step contained the constructed recombinant plasmid. After the recombinant plasmid was extracted, it was transformed into GV3101 competent cells. The colony PCR results of Agrobacterium showed ( Figure 3 , VN1-VN4: PCR results of Agrobacterium-positive colonies), there is a bright band around 300 bp, proving that the recombinant vector was successfully transformed into Agrobacterium.

[0055] (3) Gene silencing effect of AmPDS in Allium mongolicum

[0056] like Figure 4 As shown in the figure, 20 days after inoculation, the control plants showed a light green color, and the leaves of Allium mongolicum infected by the two methods showed a photobleaching phenomenon, that is, the leaves of the plants showed a chlorotic and albinic phenotype. The degree of albinism was higher when the friction infection method was used, which preliminarily proved that PDS Gene silencing was successful.

[0057] To further determine the silencing efficiency of the PDS gene, this study used qRT-PCR technology to detect PDS The results showed that compared with the wild-type Allium mongolicum, the expression levels of the AmPDS gene in the two experimental groups were significantly reduced ( Figure 5 A). According to statistics, the infection success rate after infection by T1 method is 43.3%, and the infection success rate after infection by T2 method is 56.7% ( Figure 5 B), therefore, the T2 (friction infection method) method can be used as the optimal method to induce gene silencing in Allium mongolicum.

[0058] In this field, vacuum infiltration is an efficient infection method, but it is relatively uncontrollable in actual operation. Compared with model plants such as tobacco and tomato, the leaves of Allium mongolicum are relatively soft and easily necrotized due to mechanical damage. Therefore, the present invention attempts to optimize the injection infiltration method and the friction infection method. For the conventional pressure injection method, when using a 1ml needle-free syringe, it is difficult to apply sufficient pressure because the diameter of the Allium mongolicum leaves is much smaller than the caliber of the syringe, resulting in injection difficulties. Therefore, this experiment chose to use a pipette equipped with a 100μl tip for injection to ensure that the leaves can be covered and appropriate pressure can be applied. The experimental results show that both the injection infiltration method and the friction infection method can successfully silence the target gene, among which the friction infection method is better than the injection infiltration method.

[0059] In summary, this study successfully constructed an Agrobacterium-mediated VIGS system using Allium mongolicum leaves as the infection tissue and TRV virus as the silencing vector. The system successfully silenced the AmPDS gene in Allium mongolicum, resulting in a distinct albinism phenotype. This result validates the effectiveness of the constructed VIGS system for studying gene function and provides important technical support for further research on regulatory genes involved in stress resistance, growth, and development in Allium mongolicum.

[0060] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A method for silencing the AmPDS gene of Allium mongolicum, characterized in that: The method comprises: connecting the AmPDS gene clone fragment to the multiple cloning site of the tobacco rattle virus vector to obtain a recombinant plasmid TRV2-AmPDS , transformed into Agrobacterium to obtain recombinant plasmid TRV2-AmPDS Agrobacterium containing the recombinant plasmid TRV2-AmPDS Agrobacterium infects the leaves of Allium mongolicum; The nucleotide sequence of the AmPDS gene cloned fragment is shown in SEQ ID NO.

3.

2. The method for silencing the AmPDS gene of Allium mongolicum according to claim 1, wherein: The upstream primer used in AmPDS gene cloning is shown in SEQ ID NO.1, and the downstream primer is shown in SEQ ID NO.2: SEQ ID NO.1:CCCCGGGGGAGGTCCCCAACCAGAGAA; SEQ ID NO. 2: CGGATCCGACCGACTAAACTCTCCAGGC.

3. The method for silencing the AmPDS gene of Allium mongolicum according to claim 2, wherein: The restriction endonucleases used to construct the silencing vector using tobacco rattle virus were SmaⅠ and BamHI.

4. The method for silencing the AmPDS gene of Allium mongolicum according to claim 3, wherein: Using the recombinant plasmid TRV2-AmPDS When Agrobacterium is used to infect the leaves of Allium mongolicum, friction infection or injection infiltration method is used.

5. The method for silencing the AmPDS gene of Allium mongolicum according to claim 4, characterized in that: The specific operation of the friction infection method is: using sterilized quartz sand to rub small wounds on the leaves of the mongolica, and then using sterile absorbent cotton to dip the recombinant plasmid into the TRV2-AmPDS Repeatedly wipe the wound with the Agrobacterium resuspension for 2-5 minutes; The operation of the injection infiltration method is as follows: use a pipette equipped with a 100 μl pipette tip to inject 50-100 μl of the recombinant plasmid TRV2-AmPDS The resuspension of Agrobacterium is slowly injected into the leaves of Allium mongolicum under pressure until the bacterial liquid infiltrates the leaves.

Images