Kit for predicting adoptive NK treatment effect based on triple negative breast cancer circDEK expression

Abstract

The invention belongs to the technical field of biological detection, discloses a kit for predicting adoptive nk treatment effect based on triple negative breast cancer circDEK expression, and discloses that circDEK in breast cancer tissues can be used as a triple negative breast cancer adoptive NK treatment sensitivity assessment marker for the first time. Specifically, on the basis of the triple negative breast cancer, the circDEK expression level in tumor tissue is related to the adoptive NK cell curative effect (the circDEK expression is low, and the adoptive NK cell curative effect is better), so that the adoptive NK treatment sensitivity of the triple negative breast cancer is predicted. Furthermore, by detecting the circDEK expression level in the tumor tissue of a triple negative breast cancer patient, the curative effect (the sensitivity is 82.69%, the specificity is 94.23%, and the AUC is 0.9331) of adoptive NK treatment can be accurately predicted.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a kit for predicting the efficacy of adoptive NK therapy based on the expression of circDEK in triple-negative breast cancer. Background Art

[0002] Breast cancer is the most common malignant tumor in women, with approximately 2 million new breast cancer patients worldwide each year. Breast cancer is a highly heterogeneous tumor at the molecular level, with great differences in tissue morphology, immunophenotype, biological behavior, and treatment response. Patients with the same traditional pathological TNM stage may have very different responses to clinical treatment and prognoses. According to molecular markers, including estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2), breast cancer is classified into three major subtypes: hormone receptor (HR)-positive type, HER2-positive type, and triple-negative breast cancer (TNBC). Triple-negative breast cancer accounts for about 15% to 20% of all breast cancer cases. Compared with hormone receptor-positive breast cancer, triple-negative breast cancer has a poorer prognosis. More than 50% of patients relapse within three to five years after diagnosis, and the median overall survival (OS) under the existing treatment regimen is 10.2 months. Due to the lack of relevant receptor markers, patients with triple-negative breast cancer (TNBC) cannot benefit from existing endocrine or HER2-targeted drugs. Therefore, the standard therapy for non-surgical treatment of TNBC remains non-specific chemotherapy. It is worth noting that TNBC responds best to standardized chemotherapy regimens such as taxanes or anthracyclines. However, only less than 30% of TNBC patients can achieve a complete remission, and their recurrence rate and mortality rate are still higher than those of non-TNBC subtypes.

[0003] Currently, immunotherapy has shown good efficacy in TNBC. In addition to immune checkpoint inhibitors, such as therapeutic monoclonal antibodies targeting the PD-1 / PD-L1 (programmed death protein 1-programmed death ligand 1) pathway, and adoptive T cell therapy, adoptive NK therapy has also gradually gained attention. Human natural killer cells (NK cells) are a type of peripheral blood lymphocyte characterized by the expression of CD56 or CD16 and the absence of the T cell receptor (CD3). NK cells play a role in tumor surveillance and are important immune effector cells belonging to the innate lymphoid cell (ILC) family. During development, NK cells originate from the same common lymphoid progenitor (CLP) as T cells and B cells. Their functions include the production of cytokines, including interferon-γ (IFN-γ), tumor necrosis factor (TNF), IL-10, granulocyte-macrophage colony-stimulating factor (GM-CSF), and the cytotoxic perforin and granzyme B. Although NK cells lack somatic rearrangement receptors for specific antigen discrimination, they are inherently equipped with a variety of activating and inhibitory receptors. The dynamic balance between these receptors ensures fine regulation of NK cell cytotoxic activity. When the activating signal is stronger than the inhibitory signal, NK cells are activated; otherwise, they remain in a resting state. These characteristics make NK cells ideal candidates for "off-the-shelf" therapeutic products in adoptive immunotherapy. Specifically, autologous or allogeneic NK cells are expanded and activated in vitro under the stimulation of feeder cells such as genetically modified K562 cells and cytokines (IL-2 / IL-15), and then transfused back into patients to eliminate tumor cells. The rapidly evolving field of adoptive NK cell therapy now encompasses a range of candidate cell sources and, with the advancement of genetic engineering, further improves the specificity, persistence, and anti-tumor efficacy of NK cells.

[0004] Circular RNA (circRNA) is a special type of non-coding RNA with a structure different from that of linear RNA. It forms a closed single-stranded RNA circular structure through covalent bonds, so it has no polyA tail; nor does it have the polarity of 5'-3'; it is not easily degraded by the exonuclease RNAse r; and even its half-life in cells is longer than that of linear RNA. The single-stranded circRNA structure was first observed by Diener using electron microscopy in potato spindle tuber disease; since these free RNA molecules observed by Diener were a type of infectious particle similar to viruses, the single-stranded circular RNA molecules with pathogenic ability in plants were named viroids at that time. However, these RNA molecules with a closed circular structure do not only appear in viruses or prokaryotes, but such closed circular structure RNAs can also exist in eukaryotic cells. In 1993, it was first reported that circRNA molecules transcribed from the sry gene were found in mouse testes. In 2012, Salzman et al. used bioinformatics methods combined with next-generation sequencing technology to discover a large number of circRNAs in normal human cells and tumor cells, and the abundance of some circRNAs exceeded that of their linear transcripts. These evidences suggest that circRNA, as a special type of non-coding RNA, similar to lncRNA, is not the "noise" or by-product of transcription, but a type of regulatory molecule with important functions and is involved in regulating the occurrence and development of tumors. At present, there is no relevant research on the efficacy of circRNA in adoptive NK therapy for triple-negative breast cancer. Summary of the Invention

[0005] The purpose of the first aspect of the present invention is to provide the application of circDEK as a biomarker in the preparation of a product for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer.

[0006] The purpose of the second aspect of the present invention is to provide the application of a substance for detecting circDEK in the preparation of a product for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer.

[0007] The purpose of the third aspect of the present invention is to provide a primer set for detecting circDEK.

[0008] The purpose of the fourth aspect of the present invention is to provide a kit.

[0009] The purpose of the fifth aspect of the present invention is to provide a system for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer.

[0010] The purpose of the sixth aspect of the present invention is to provide the application of a circDEK inhibitor in the preparation of a product for improving the efficacy of adoptive NK therapy for triple-negative breast cancer.

[0011] The objective of the seventh aspect of the present invention is to provide a shRNA.

[0012] The objective of the eighth aspect of the present invention is to provide a biological material related to the shRNA of the seventh aspect of the present invention.

[0013] The objective of the ninth aspect of the present invention is to provide a reagent.

[0014] The objective of the tenth aspect of the present invention is to provide the application of the shRNA of the seventh aspect of the present invention, the biological material of the eighth aspect of the present invention, or the reagent of the ninth aspect of the present invention in the preparation of a product for improving the efficacy of adoptive NK cell therapy for triple-negative breast cancer.

[0015] In order to achieve the above objectives, the technical solutions adopted by the present invention are as follows:

[0016] The first aspect of the present invention provides the application of circDEK as a biomarker in the preparation of a product for predicting the efficacy of adoptive NK cell therapy for triple-negative breast cancer.

[0017] In some embodiments of the present invention, the nucleotide sequence of the circDEK is as shown in SEQ ID NO:7.

[0018] In some embodiments of the present invention, the product includes at least one of a reagent, a kit, a test strip, a system, and a chip.

[0019] The second aspect of the present invention provides the application of a substance for detecting circDEK in the preparation of a product for predicting the efficacy of adoptive NK cell therapy for triple-negative breast cancer.

[0020] In some embodiments of the present invention, the substance for detecting circDEK includes a substance for quantitatively detecting circDEK.

[0021] In some embodiments of the present invention, the substance includes a substance for detecting the circDEK by PCR, a biochip method, or a nucleic acid sequencing method.

[0022] In some embodiments of the present invention, the substance includes at least one of a substance specific to circDEK, a probe specific to circDEK, a gene chip, and a PCR primer.

[0023] In some embodiments of the present invention, the nucleotide sequence of the PCR primer is as shown in SEQ ID NO:1-2.

[0024] In some embodiments of the present invention, the product includes, but is not limited to, a reagent, a kit, a test strip, a system, or a chip.

[0025] In some embodiments of the present invention, the test sample of the product is selected from at least one of the blood, tissue, cells, and excreta of the subject to be tested.

[0026] In the third aspect of the present invention, a primer set for detecting circDEK is provided, and the nucleotide sequences of the primer set are shown in SEQ ID NO: 1-2.

[0027] In the fourth aspect of the present invention, a kit is provided, including the primer set of the third aspect of the present invention.

[0028] In some embodiments of the present invention, the kit further includes an RNA extraction reagent, a reagent for RNA reverse transcription reaction, and a reagent for PCR reaction.

[0029] In some embodiments of the present invention, the reagent for RNA reverse transcription reaction includes reverse transcriptase, reverse transcription primer, random primers, and buffer.

[0030] In some embodiments of the present invention, the reverse transcriptase includes M-MLV reverse transcriptase, AMV reverse transcriptase, or a combination thereof.

[0031] In some embodiments of the present invention, the buffer includes dNTP and metal ions (such as magnesium ions, manganese ions, or calcium ions), and at least one of ATP and / or GTP.

[0032] In some embodiments of the present invention, the reverse transcription primer is oligo(dt) 12-18 primer.

[0033] In some embodiments of the present invention, the reagent for PCR reaction includes SYBR green mixture.

[0034] In some embodiments of the present invention, the kit further includes PCR amplification primers for internal reference genes U6 and β-actin, as shown in SEQ ID NO: 3-4 and SEQ ID NO: 5-6, respectively.

[0035] In the fifth aspect of the present invention, a system for predicting the efficacy of adoptive NK cell therapy for triple-negative breast cancer is provided, and the system includes:

[0036] A data collection module, which collects samples of patients, measures the expression level of circDEK, and outputs the circDEK expression level data to the model calculation module;

[0037] A model calculation module: obtains the risk coefficient and cut-off value of the patient, and calculates the risk coefficient of the patient using the 2 -ΔΔCt method;

[0038] Output prediction module: Output the efficacy of adoptive NK cell therapy for the patient according to the patient's risk score and the cut-off value.

[0039] In some embodiments of the present invention, the cut-off value is 0.00088.

[0040] In some embodiments of the present invention, when the patient's risk score is lower than the cut-off value, it is determined as Responder, otherwise it is determined as Non-Responder.

[0041] The sixth aspect of the present invention provides the use of a circDEK inhibitor in the preparation of a product for improving the efficacy of adoptive NK cell therapy for triple-negative breast cancer.

[0042] In some embodiments of the present invention, the circDEK inhibitor includes at least one of a substance that inhibits the activity of circDEK, a substance that reduces the content of circDEK, and a substance that reduces the expression level of circDEK.

[0043] In some embodiments of the present invention, the circDEK inhibitor is a substance that reduces the expression level of circDEK.

[0044] In some embodiments of the present invention, the substance that reduces the expression level of circDEK is at least one of (1) to (3):

[0045] (1) sgRNA, siRNA, dsRNA, miRNA, ribozyme or shRNA targeting circDEK;

[0046] (2) A nucleic acid molecule encoding the sgRNA, siRNA, dsRNA, miRNA, ribozyme or shRNA targeting circDEK described in (1);

[0047] (3) An expression cassette, vector, transgenic cell line or microorganism containing the nucleic acid molecule described in (1).

[0048] In some embodiments of the present invention, the nucleotide sequence of the shRNA targeting circDEK is as shown in SEQ ID NO:8 or SEQ ID NO:9.

[0049] The seventh aspect of the present invention provides an shRNA, characterized in that the nucleotide sequence of the shRNA is as shown in SEQ ID NO:8 or SEQ ID NO:9.

[0050] The eighth aspect of the present invention provides a biomaterial related to the shRNA of the seventh aspect of the present invention, and the biomaterial includes any one of (1) to (12):

[0051] 1) A nucleic acid molecule encoding the shRNA of the seventh aspect of the present invention;

[0052] 2) An expression cassette comprising the nucleic acid molecule of 1);

[0053] 3) A vector comprising the nucleic acid molecule of 1);

[0054] 4) A vector comprising the expression cassette of 2);

[0055] 5) A transgenic cell line comprising the nucleic acid molecule of 1);

[0056] 6) A transgenic cell line comprising the expression cassette of 2);

[0057] 7) A transgenic cell line comprising the vector of 3);

[0058] 8) A transgenic cell line comprising the vector of 4);

[0059] 9) A recombinant microorganism containing the nucleic acid molecule of 1);

[0060] 10) A recombinant microorganism containing the expression cassette of 2);

[0061] 11) A recombinant microorganism containing the vector of 3);

[0062] 12) A recombinant microorganism containing the vector of 4).

[0063] In some embodiments of the present invention, the transgenic cell line does not contain propagation materials.

[0064] The ninth aspect of the present invention provides a reagent, which comprises the shRNA of the seventh aspect of the present invention and / or the biological material of the eighth aspect of the present invention.

[0065] In some embodiments of the present invention, the reagent is used to improve the efficacy of adoptive NK cell therapy for triple-negative breast cancer.

[0066] The tenth aspect of the present invention provides the use of the shRNA of the seventh aspect of the present invention, the biological material of the eighth aspect of the present invention, and / or the reagent of the ninth aspect of the present invention in the preparation of a product for improving the efficacy of adoptive NK cell therapy for triple-negative breast cancer.

[0067] In some embodiments of the present invention, the product includes reagents, kits, and drugs.

[0068] The beneficial effects of the present invention are:

[0069] The present invention discloses for the first time that circDEK in breast cancer tissues can be used as an evaluation of the sensitivity of adoptive NK cell therapy for triple-negative breast cancer. Specifically, based on triple-negative breast cancer, the expression level of circDEK in tumor tissues is related to the efficacy of adoptive NK cells (the lower the expression of circDEK, the better the efficacy of adoptive NK cells), thereby predicting the sensitivity of adoptive NK cell therapy for triple-negative breast cancer. Further, the present invention provides that by detecting the expression level of circDEK in the tumor tissues of triple-negative breast cancer patients, the efficacy of adoptive NK cell therapy can be accurately predicted (sensitivity 82.69%, specificity 94.23%, and AUC is 0.9331).

[0070] The kit for evaluating the sensitivity of adoptive NK cell therapy for triple-negative breast cancer provided by the present invention can detect circDEK in tumor tissues by obtaining tumor specimens, realizing convenient operation.

[0071] Based on the real-time fluorescence quantitative PCR method, the present invention can realize the prediction and evaluation of the efficacy of adoptive NK cell therapy for triple-negative breast cancer, screen patients with high treatment benefits, guide clinical individualized treatment, and improve the accuracy of treatment.

[0072] The present invention designs a specific shRNA against circDEK that can effectively improve the efficacy of adoptive NK cell therapy for triple-negative breast cancer patients. It has been verified by experiments that by reducing the expression level of circDEK in tumor tissues, the efficacy of adoptive NK cell therapy for triple-negative breast cancer patients can be significantly improved. Description of the Drawings

[0073] Figure 1 It shows the expression differences of circDEK detected by the kit of the present invention in different breast cancer cell lines in Example 3.

[0074] Figure 2 It shows the tumor volume differences of adoptive NK cell therapy in vivo for breast cancer tumors with different expression levels of circDEK in Example 4. In the figure, ns means no significant difference, ***P<0.001, ****P<0.0001.

[0075] Figure 3 It shows the expression differences of circDEK detected by the kit of the present invention in different patient samples in Example 5, N = 110.

[0076] Figure 4 It shows the analysis result diagram of the relationship between circDEK expression and the efficacy of immunotherapy in Example 5. In the figure, ****P<0.0001.

[0077] Figure 5ROC curve for the correlation between the clinical prognosis and the sensitivity of predicting the efficacy of detecting circDEK samples using the kit of the present invention in Example 5, with a sensitivity of 82.69% and a specificity of 94.23%. Detailed implementation manners

[0078] The content of the present invention will be further described in detail below through specific examples.

[0079] It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.

[0080] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Those not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments not specified by the manufacturer are all conventional products that can be obtained through commercial purchase.

[0081] The features and performance of the present invention will be further described in detail below in combination with the examples.

[0082] Example 1

[0083] A kit that can be used to evaluate the prognostic risk of breast cancer, the kit includes amplification primers for circDEK; amplification primers for the internal reference genes U6 and β-actin; reagents for extracting RNA; reagents for preparing a reverse transcription reaction system; reagents for preparing a real-time fluorescence quantitative PCR (RT-PCR) reaction system;

[0084] The amplification primer sequences of the circDEK are as follows:

[0085] Forward primer: 5’-CCCCTACAGATGAAGAGTT-3’ (SEQ ID NO:1);

[0086] Reverse primer: 5’-GACTTGCATTGTCAACCTC-3’ (SEQ ID NO:2);

[0087] The amplification primers of the internal reference gene U6 are as follows:

[0088] Forward primer: 5’-GCTTCGGCAGCACATATACTAAAAT-3’ (SEQ ID NO:3);

[0089] Reverse primer: 5’-CGCTTCACGAATTTGCGTGTCAT-3’ (SEQ ID NO:4);

[0090] The amplification primers of the internal reference gene β-actin are as follows:

[0091] Forward primer: 5’-CTGGAACGGTGAAGGTGACA-3’ (SEQ ID NO:5);

[0092] Reverse primer: 5’-AAGGGACTTCCTGTAACAATGCA-3’ (SEQ ID NO:6);

[0093] The reagents for RNA extraction include those used in current common RNA extraction methods, such as commercially available RNA extraction kits;

[0094] The reagents for preparing the reverse transcription reaction system include reverse transcriptase, reverse transcription buffer, and pure water;

[0095] The reagents for preparing the real-time fluorescence quantitative PCR reaction system include SYBR green and nuclease-free pure water.

[0096] The nucleotide sequence of circDEK is shown as SEQ ID NO:7.

[0097] AAAAGAGTCTCATCGTGGAAGGCAAGAGGGAAAAGAAAAAAGTAGAGAGGTTGACAATGCAAGTCTCTTCCTTACAGAGAGAGCCATTTACAATTGCACAAGGAAAGGGGCAGAAACTTTGTGAAATTGAGAGGATACATTTTTTTCTAAGTAAGAAGAAAACCGATGAACTTAGAAATCTACACAAACTGCTTTACAACAGGCCAGGCACTGTGTCCTCATTAAAGAAGAATGTGGGTCAGTTCAGTGGCTTTCCATTTGAAAAAGGAAGTGTCCAATATAAAAAGAAGGAAGAAATGTTGAAAAAATTTAGAAATGCCATGTTAAAGAGCATCTGTGAGGTTCTTGATTTGGAGAGATCAGGTGTAAATAGTGAACTAGTGAAGAGGATCTTGAATTTCTTAATGCATCCAAAGCCTTCTGGCAAACCATTGCCGAAATCTAAAAAAACTTGTAGCAAAGGCAGTAAAAAGGAACGGAACAGTTCTGGAATGGCAAGGAAGGCTAAGCGAACCAAATGTCCTGAAATTCTGTCAGATGAATCTAGTAGTGATGAAGATGAAAAGAAAAACAAGGAAGAGTCTTCAGATGATGAAGATAAAGAAAGTGAAGAGGAGCCACCAAAAAAGACAGCCAAAAGAGAAAAACCTAAACAGAAAGCTACTTCTAAAAGTAAAAAATCTGTGAAAAGTGCCAATGTTAAGAAAGCAGATAGCAGCACCACCAAGAAGAATCAAAACAGTTCCAAAAAAGAAAGTGAGTCTGAGGATAGTTCAGATGATGAACCTTTAATTAAAAAGTTGAAGAAACCCCCTACAGATGAAGAGTTAAAGGAAACAATAAAGAAATTACTGGCCAGTGCTAACTTGGAAGAAGTCACAATGAAACAGATTTGCAAAAAG(SEQ ID NO:7).

[0098] Example 2

[0099] The method for detecting sample circRNA using the kit of Example 1 includes the following steps:

[0100] (1) RNA extraction: Extract the RNA of the sample using a reagent for RNA extraction. Specifically, in this example, a rapid RNA extraction kit for paraffin-embedded tissues (centrifugal column type) (biotake, rp5322 (100 times)) is used to extract the RNA of paraffin-embedded tissues:

[0101] 1) Cut the paraffin-embedded tissue into thin slices of 5-10 μm and place them in a 1.5 mL centrifuge tube.

[0102] 2) Add 1 mL of xylene and vortex for 10 s.

[0103] 3) Centrifuge at 12,000 rpm for 2 min at room temperature. Discard the supernatant, being careful not to discard the precipitate.

[0104] 4) Add 1 mL of absolute ethanol, vortex to mix well, and centrifuge at 12,000 rpm for 2 min at room temperature.

[0105] 5) Discard the supernatant, being careful not to discard the precipitate. Air dry at room temperature for 10 min or until the remaining ethanol has completely evaporated.

[0106] 6) Add 240 μL of solution PTL and 10 μL of proteinase K solution, vortex to mix well. Incubate at 55 °C for 15 min, then at 80 °C for 15 min.

[0107] 7) Add 750 μL of lysis buffer MRL, vortex to mix well, and let stand at room temperature for 2 min.

[0108] 8) Add 0.2 mL of chloroform. Tighten the lid of the sample tube, shake vigorously for 15 s and incubate it at room temperature for 3 min.

[0109] 9) Centrifuge at 12,000 rpm for 10 min at 4 °C. The sample will be divided into three layers: the lower organic phase, the middle layer, and the upper colorless aqueous phase. The RNA is present in the aqueous phase. Transfer the aqueous phase (about 600 μL) to a new tube for the next step.

[0110] 10) Add an equal volume of 70% ethanol (please first check if absolute ethanol has been added), invert to mix well (precipitation may occur at this time). Transfer the resulting solution and the possible precipitate together into the adsorption column RA (the adsorption column is sleeved in the collection tube, and if the solution is too much, it can be passed through the column in batches).

[0111] 11) Centrifuge at 10,000 rpm for 45 s, discard the waste liquid, and put the adsorption column back into the collection tube.

[0112] 12) Add 500 μL of deproteinization solution RE, centrifuge at 12,000 rpm for 45 s, and discard the waste liquid.

[0113] 13) Add 700 μL of wash buffer RW (please first check whether absolute ethanol has been added), centrifuge at 12,000 rpm for 60 s, and discard the waste liquid.

[0114] 14) Add 500 μL of wash buffer RW, centrifuge at 12,000 rpm for 60 s, and discard the waste liquid.

[0115] 15) Place the adsorption column RA back into the empty collection tube, open the lid of the centrifugal column, centrifuge at 12,000 rpm for 2 min, and try to remove as much wash buffer as possible to avoid the residual ethanol in the wash buffer from inhibiting downstream reactions.

[0116] 16) Take out the adsorption column RA, place it in an RNAse free centrifuge tube, add 30 μL of RNAse free water (heating in a water bath at 65 - 70 °C beforehand has a better effect), let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 1 min. The purified RNA is collected and stored at -20 °C or lower temperature for standby.

[0117] (2) Preparation of cDNA (RT)

[0118] Electrophoretically examine the quality of the RNA sample.

[0119] Pre - denaturation: Prepare Mix1 (10 μL system, see Table 1 for details), heat at 65 °C for 5 min to denature and disrupt the secondary structure of RNA, and then place it on ice for 2 min after completion.

[0120] Table 1 Mix 1

[0121]

[0122] Prepare Mix2 (Table 2) when performing pre - denaturation.

[0123] Table 2 Mix2

[0124]

[0125] Aliquot Mix2 into each tube that has completed pre - denaturation and cooled. If there are bubbles, centrifuge slightly. Let it stand at room temperature for 5 min. Set the PCR instrument according to the working temperature of the reverse transcriptase, and the program is as follows:

[0126] 30 °C for 10 min;

[0127] 42 - 50 °C, 15 - 30 min;

[0128] 95 °C for 5 min;

[0129] The first strand of the synthesized cDNA is stored at -20 °C for standby.

[0130] (3) RT-PCR (Reverse Transcription PCR of Fluorescence Quantitative Technology) Detection

[0131] Prepare the PCR reaction solution (10 μL system) according to the composition shown in Table 3.

[0132] Table 3 PCR Reaction System

[0133]

[0134] PCR Reaction Program:

[0135] Reaction Conditions for 3STEP PCR:

[0136] 94°C for 30 sec, 55 - 65°C for 30 sec, 30 cycles, 72°C, 1 min / kbp.

[0137] Risk Value Calculation: Use the 2 -ΔΔCt method to calculate the relative expression level of circDEK obtained.

[0138] Example 3 Differential Expression of circDEK in Triple-Negative Breast Cancer

[0139] 1. Experimental Method

[0140] (1) Use the kit described in Example 1 to detect the expression level of circDEK in breast cancer cell lines (including hormone receptor-positive cell lines: ZR75-1 cells, T47D cells, MCF-7 cells, HER-2 overexpressing cell lines: SKBR-3 cells and BT-474 cells, triple-negative cell lines: HCC-1937 cells, MDA-MB-468 cells, MDA-MB-231 cells, BT-549 cells and HS-578T cells) and mammary epithelial cells (MCF10A cells). The detection method is as described in Example 2;

[0141] (2) Statistical Analysis

[0142] Perform statistical analysis using GraphPad Prism software (Version 8.0.2). All mean values are calculated from at least 3 independent experiments

[0143] 2. Experimental Results

[0144] In this example, the expression of circDEK was detected in 1 type of mammary epithelial cell and 10 breast cancer cell lines. The results showed that circDEK was differentially expressed in triple-negative breast cancer cell lines and hormone receptor-positive cell lines, and had a relatively low expression level in HER-2 overexpressing cell lines ( Figure 1 ).

[0145] 3. Experimental Conclusions

[0146] circDEK is differentially expressed in triple-negative breast cancer cell lines.

[0147] Example 4 Breast cancer cell lines with low expression of circDEK have better responsiveness to adoptive NK therapy.

[0148] 1. Experimental methods

[0149] (1) Construction of a mouse orthotopic transplantation tumor model

[0150] Breast cancer cell lines with different circDEK expressions were constructed using shRNA and overexpression plasmids with pCD25 as the vector. The specific steps are as follows:

[0151] CircDEK short hairpin RNA (shRNA) and negative control lentiviruses were purchased from Guangzhou Aiji Biotechnology Co., Ltd. (Guangzhou, China). The sequences are as follows:

[0152] shcircDEK-1: 5’-TTTGCAAAAAGAAAAGAGT-3’ (SEQ ID NO:8);

[0153] shcircDEK-2: 5’-CAGATTTGCAAAAAGAAAA-3’ (SEQ ID NO:9);

[0154] CircDEK overexpression (OE) and negative control lentiviruses were purchased from Guangzhou Aiji Biotechnology Co., Ltd. (Guangzhou, China). Primary breast cancer cells were seeded in low-attachment 6-well plates at a density of 1×10 5 cells / well, and 10 μg / mL polybrene was added to improve transfection efficiency. After adding and mixing the lentivirus (MOI = 10), the volume was supplemented to 2 mL of complete culture medium. At 48 h after transfection, when the cell state was good, according to the resistance tag contained in the lentiviral vector, puromycin or blasticidin was used to screen for stably transfected cells. The transfection efficiency was verified by qPCR and subsequent experiments were carried out.

[0155] Female NSG mice at 4 - 5 weeks of age and weighing 15 - 16 g were selected as experimental animals. After 7 days of adaptive feeding after purchase, the experiment was carried out; 1×10^6 breast cancer cells were injected into the mammary fat pad of each mouse: the cells were thoroughly resuspended with a pipette tip, then 100 μL was aspirated with a 1 mL syringe, the needle was inserted at a 45° angle, and slowly injected subcutaneously into the mouse. After injection, stay for a while, slowly withdraw the needle, disinfect the skin with an alcohol swab, and no further treatment is required; the tumor formation was observed 1 week later. During the observation period, the tumor formation was recorded every three days, the tumor size (length × width2 × 0.5) was measured and recorded, and a mouse orthotopic transplantation tumor model was constructed.

[0156] (2) Adoptive NK cell therapy

[0157] The NK-92 cell line was amplified and cultured, irradiated (10 Gy) before infusion. On the third day after tumor implantation, 1×10^7 NK-92 cells per mouse were injected peritumorally. After 28 days, the mice were euthanized by overdose anesthesia and the tumors were excised. If the following conditions occurred, the mice were euthanized as the humane endpoint of this experiment: the tumor-bearing volume reached 10% of the mouse body weight, the average diameter exceeded 10 mm, the body weight rapidly decreased by about 15%, hemiplegia, decreased appetite and other abnormal symptoms, or persistent hypothermia, obvious dying manifestations, etc.

[0158] 2. Experimental results

[0159] In this example, two groups of high-expression circDEK cell lines (denoted as the high-expression circDEK group) and two groups of low-expression circDEK cell lines (denoted as the low-expression circDEK group) were constructed. Mouse experiments found that the low-expression circDEK group had a better response to adoptive NK therapy and had a smaller tumor volume, while the high-expression circDEK group had a poor response to adoptive NK therapy and a larger tumor burden in mice ( Figure 2 ).

[0160] 3. Experimental conclusion

[0161] Breast cancer mice with low expression of circDEK had a better response to adoptive NK therapy.

[0162] Example 5 Prediction of NK therapy reactivity by circDEK expression status

[0163] 1. Experimental method

[0164] (1) circDEK detection

[0165] Same as Example 2 of the present invention.

[0166] (2) Establishment of primary tumor cell lines

[0167] Fresh breast cancer tissue specimens of patients who underwent breast cancer surgery at Sun Yat-sen Memorial Hospital, Sun Yat-sen University from September 2020 to December 2024 were collected. Excess adipose tissue and necrotic tissue were trimmed off and rinsed thoroughly with DEME. Then, they were minced with scissors and scalpel and placed in digestive solution (collagenase Ⅰ / collagenase Ⅱ 1:1, trypsin, dissolved in DMEM), and incubated in a constant temperature shaker at 37 °C and 100 rpm for 1 - 2 h. Observe the digestion effect. If the tissue is not significantly loose or the tissue mass is large, the digestion time can be appropriately extended. After digestion, the cell suspension was filtered through a 100-mesh sieve, and the filtrate was collected in a 50-mL centrifuge tube. Centrifuge at 1000 rpm for 5 min and discard the supernatant. Add complete medium, resuspend the cells and seed them into culture flasks.

[0168] (3) Co-culture of tumor cells and NK cells in vitro

[0169] After counting the tumor cells, 5×10^4 cells / well were seeded into 24-well plates. After overnight incubation, 5×10^5 NK-92 cells were placed in the upper chamber with a pore size of 0.4 μm. After co-culture for 4 - 6 h, the NK-92 cells were taken for subsequent experiments.

[0170] (4) Flow cytometry analysis of NK cells

[0171] Take NK-92 cells and centrifuge at 500 g and 4 °C for 5 min. Take the precipitated cells and stain them with flow cytometry primary antibody (biolegend). Dilute the primary antibody according to the ratio in the instruction manual to 100 μL per sample and incubate in the dark on ice for 30 min. After incubation, wash the cells with 1 mL PBS, centrifuge at 500 g and 4 °C for 5 min, remove the supernatant, and repeat three times. Use a fixation and permeabilization kit for fixation and cell membrane perforation, and the washing steps are the same as above. Then perform intracellular antibody staining (biolegend), dilute according to the ratio in the instruction manual, 100 μL per sample, and incubate in the dark on ice for 30 min.

[0172] 2. Experimental results

[0173] In this example, the expression level of circDEK was detected in 110 patients with triple-negative breast cancer. The steps were independently repeated three times, and the cut-off value was 0.00088 ( Figure 3 ). According to the flow cytometry results of NK cells, and based on the IFN-γ production level, the NK functional responses stimulated by different tumor cells were distinguished and defined as Responder and Non-Responder. The experimental results suggest that in the Responder group, circDEK showed a low expression state ( Figure 4 ).

[0174] Furthermore, ROC curves were established according to different circDEK expression levels to reflect the circDEK expression level in tumors and predict the responsiveness to adoptive NK cell therapy. The results showed that the sensitivity was 82.69%, the specificity was 94.23%, and the area under the curve (AUC) was 0.9331( Figure 5 ), indicating that circDEK has a high accuracy as a biomarker for predicting adoptive NK cell therapy in patients with triple-negative breast cancer.

[0175] 3. Experimental conclusions

[0176] Breast cancer samples with low circDEK expression have high NK cell reactivity, suggesting that detecting the expression level of circDEK in patients' breast cancer tissues can effectively predict the efficacy of adoptive NK cell therapy in patients with triple-negative breast cancer.

[0177] The embodiments of the present invention have been described in detail above in conjunction with the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made without departing from the spirit of the present invention within the scope of knowledge possessed by those of ordinary skill in the art. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Application of circDEK as a biomarker in the preparation of products for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer.

2. Use of substances for detecting circDEK in the preparation of products for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer; Preferably, the substance for detecting circDEK includes a substance for quantitatively detecting circDEK; Preferably, the substance comprises a substance for detecting the circDEK by PCR, a biochip method, or a nucleic acid sequencing method; preferably, the substance comprises at least one of a substance specific to circDEK, a circDEK-specific probe, a gene chip, and a PCR primer; Preferably, the nucleotide sequences of the PCR primers are shown in SEQ ID NOs: 1-2.

3. A primer set for detecting circDEK, the nucleotide sequence of the primer set is shown in SEQ ID NO: 1-2.

4. A kit comprising the primer set according to claim 3; Preferably, the kit further comprises an RNA extraction reagent, a reagent for RNA reverse transcription reaction, and a reagent for PCR reaction.

5. A system for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer, characterized in that: The system includes: a data collection module, which collects samples from patients, measures the expression level of circDEK, and outputs the circDEK expression level data to a model calculation module; Model calculation module: obtain the patient's risk coefficient and cut-off value, using 2 -ΔΔCt The method calculates the patient's risk coefficient; the output prediction module: outputs the patient's adoptive NK therapy efficacy according to the patient's risk coefficient and the cut-off value; preferably, the cut-off value is 0.00088; Preferably, when the patient's risk factor is lower than the cut-off value, the patient is determined to be a Responder, otherwise the patient is determined to be a Non-Responder.

6. Use of a circDEK inhibitor in the preparation of a product for improving the efficacy of adoptive NK therapy for triple-negative breast cancer; preferably, the circDEK inhibitor includes at least one of a substance that inhibits circDEK activity, a substance that reduces circDEK content, and a substance that reduces circDEK expression level; Preferably, the substance that reduces the expression level of circDEK is at least one of (1) to (3): (1) sgRNA, siRNA, dsRNA, miRNA, ribozyme or shRNA targeting circDEK; (2) a nucleic acid molecule encoding the sgRNA, siRNA, dsRNA, miRNA, ribozyme or shRNA targeting circDEK described in (1); (3) an expression cassette, vector, transgenic cell line or microorganism comprising the nucleic acid molecule described in (1); Preferably, the nucleotide sequence of the shRNA targeting circDEK is shown as SEQ ID NO:8 or SEQ ID NO:

9.

7. A shRNA, characterized in that The nucleotide sequence of the shRNA is shown in SEQ ID NO:8 or SEQ ID NO:

9.

8. The biological material of the shRNA according to claim 7, wherein the biological material comprises any one of 1) to 12): 1) A nucleic acid molecule encoding the shRNA according to claim 7; 2) an expression cassette comprising the nucleic acid molecule described in 1); 3) a vector comprising the nucleic acid molecule described in 1); 4) a vector comprising the expression cassette described in 2); 5) A transgenic cell line comprising the nucleic acid molecule described in 1); 6) A transgenic cell line comprising the expression cassette described in 2); 7) A transgenic cell line comprising the vector described in 3); 8) A transgenic cell line comprising the vector described in 4); 9) A recombinant microorganism containing the nucleic acid molecule described in 1); 10) a recombinant microorganism containing the expression cassette described in 2); 11) A recombinant microorganism containing the vector described in 3); 12) A recombinant microorganism containing the vector described in 4).

9. A reagent, characterized in that The reagent comprises the shRNA according to claim 7 and / or the biological material according to claim 8.

10. Use of the shRNA according to claim 7, the biomaterial according to claim 8 and / or the reagent according to claim 9 in the preparation of a product for improving the efficacy of adoptive NK therapy for triple-negative breast cancer.

Images