Reagent and method for detecting feline herpesvirus type 1 and application

Abstract

The invention provides a reagent and a kit for detecting feline herpesvirus type 1 nucleic acid and application of the reagent and the kit. The reagent comprises a reagent for detecting a first region and / or a second region of the feline herpesvirus type 1, the first region is selected from any fragment in SEQ ID NO: 1, and the second region is selected from any fragment in SEQ ID NO: 2. By applying the reagent or the kit provided by the invention, the feline herpesvirus type 1 can be identified in a high-specificity, sensitive and accurate manner.

Description

Technical Field

[0001] The present invention relates to the field of detection of feline herpesvirus type 1, and in particular to a reagent and a kit for detecting feline herpesvirus type 1 nucleic acid and an application thereof. Background Art

[0002] Feline herpesvirus-1 (FHV-1) belongs to the family Herpesviridae and the subfamily Alphaherpesvirus. It mainly causes infectious rhinotracheitis in felines and is a highly infectious disease of the acute upper respiratory tract of cats. Since American scientists Crandel and Maurer first isolated the virus from the trachea of ​​sick kittens in 1985, some countries and regions in Europe and the United States have reported the occurrence of the disease. In recent years, there have also been reports of tigers and other felines infected with FHV-1. At present, FHV-1 has become prevalent worldwide and has seriously affected the health of pet cats and wild felines as the main pathogen of upper respiratory tract infections and eye injuries.

[0003] FHV-1 mainly infects kittens. After infection, it replicates in the upper respiratory mucosa, causing clinical symptoms such as fever, depression, coughing, sneezing, and complications such as chronic sinusitis and keratoconjunctivitis. The morbidity rate is 100%, and the mortality rate of kittens can reach 50%. After the infected cats recover, FHV-1 lurks in the trigeminal nerve, optic nerve, tonsils, submandibular lymph nodes, nasal concha, and oral, nasal and ocular secretions, causing persistent and latent infection, and can also be reactivated to cause secondary disease in infected cats.

[0004] In adult cats, the positive rate of FHV-1 neutralizing antibodies is 50%-75%, 12%-31% of cats are FHV-1 carriers, and 80% of cats will carry the virus for life after infection. The virus can induce feline rhinotracheitis, the incidence of feline rhinotracheitis caused by the virus can reach 100%, and the mortality rate can reach 50%. The virus can proliferate in the nose, throat, trachea and bronchi of sick cats, as well as the tongue, conjunctiva, etc., and spread through direct contact.

[0005] In recent years, with the increase in the number of pet cats in my country, respiratory diseases in cats have become more and more common, many of which are suspected to be feline infectious rhinotracheitis infections. Therefore, early diagnosis of feline herpesvirus type 1 and latent infection are particularly important. Summary of the invention

[0006] The present invention aims to provide a reagent, method and application for detecting feline herpesvirus type 1, so as to solve the technical problem of missed detection of feline herpesvirus type 1 in the prior art.

[0007] To achieve the above object, according to one aspect of the present invention, a reagent for detecting feline herpesvirus type 1 is provided. The reagent includes: a reagent for detecting the first region and / or the second region of feline herpesvirus type 1, wherein the first region is selected from any fragment of SEQ ID NO: 1, and the second region is selected from any fragment of SEQ ID NO: 2.

[0008] Further, the first region is selected from any fragment between the (1-6)-(83-95)th bases of SEQ ID NO: 1; and / or

[0009] or the second region is selected from any fragment between the (1-6)-(83-93)th bases of SEQ ID NO: 2.

[0010] Further, the reagent includes a primer pair for detecting the nucleic acid sequence of SEQ ID NO: 1. The primer pair includes an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 19-26 consecutive nucleotides between the (1-6)-(83-95)th bases of SEQ ID NO: 1; and / or

[0011] The reagent includes a primer pair for detecting the nucleic acid sequence of SEQ ID NO: 2. The primer pair includes an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 20-27 consecutive nucleotides between the (1-6)-(83-93)th bases of SEQ ID NO: 2.

[0012] Further, the reagent primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 7-8, and / or the nucleotide sequences shown in SEQ ID NOs: 10, 13;

[0013] Preferably, the reagent further includes a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 9; and / or the nucleotide sequence shown in SEQ ID NO: 14;

[0014] wherein, SEQ ID NO: 7 is 5’-TAAATCTGGAAGGAACCCCTGA-3’,

[0015] SEQ ID NO: 8 is 5’-GTGCATATCACATGCGGCTATAA-3

[0016] SEQ ID NO: 9 is 5’-CCGCCGCCTTGGGAGCACT-3’,

[0017] SEQ ID NO: 10 is 5’-AGATTCCAAGAGGCCATTCGATA-3’,

[0018] SEQ ID NO: 13 is 5'-ACTCGATTCTCCTCTAGAGTCGTTG-3',

[0019] SEQ ID NO: 14 is 5'-TCCCGCCATACCGTCTGGGAGTG-3'.

[0020] Furthermore, the 5'-end and 3'-end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group;

[0021] Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse;

[0022] More preferably, the 5'-end of the probe is FAM and / or VIC group, and the 3'-end is BHQ group.

[0023] According to another aspect of the present invention, there is provided a kit, which includes any one of the above reagents for detecting feline herpesvirus type 1 nucleic acid in a test sample.

[0024] Furthermore, the kit further includes at least one of the following: a qPCR premix, including a qPCR buffer and AK Taq DNA polymerase. Preferably, the concentration of AK Taq DNA polymerase is 5 U / μL.

[0025] According to still another aspect of the present invention, there is provided a method for fluorescence quantitative PCR detection of feline herpesvirus type 1, which uses any one of the above reagents or kits for detecting feline herpesvirus type 1 nucleic acid in a test sample to perform fluorescence quantitative PCR detection.

[0026] Furthermore, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92-98°C for 30 s-90 s; denaturation treatment at 92-98°C for 2-8 s, annealing at 58-62°C for 8-12 s and collecting fluorescence signal processing, for a total of 40-44 cycles.

[0027] According to still another aspect of the present invention, there is provided an application of a reagent or kit for detecting feline herpesvirus type 1 nucleic acid in a test sample in the detection of feline herpesvirus type 1.

[0028] Applying the technical solution of the present invention, the reagent for detecting feline herpesvirus type 1 nucleic acid of the present application has high specificity for feline herpesvirus type 1 and also has higher sensitivity. Therefore, compared with the existing detection reagents, it has significant advantages of high specificity, sensitivity and accuracy in the identification of feline herpesvirus type 1. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The accompanying drawings forming a part of this application are used to provide a further understanding of the present invention. The schematic embodiments and descriptions thereof of the present invention are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0030] FIG. 1 shows the amplification curve of the primer-probe combination in Example 1 at the A5 concentration;

[0031] FIG. 2 shows the amplification curve of the primer-probe combination in Example 1 at the A6 concentration;

[0032] FIG. 3 shows the amplification curve of the primer-probe combination in Example 1 at the A7 concentration;

[0033] FIG. 4 shows the amplification curves of the positive samples in Example 2 in the FAM and VIC channels;

[0034] Figure 5 shows the amplification curves of the negative samples in Example 2 in the FAM and VIC channels;

[0035] FIG. 6 shows the amplification curves of different detection limits in Example 3 in the FAM and VIC channels;

[0036] FIG. 7 shows the amplification curve of reconfirmation of the 500 copies / mL detection limit in Example 3 in the FAM and VIC channels;

[0037] Figure 8 shows the amplification curve of the non-specific samples in Example 4;

[0038] Figure 9 shows the amplification curves of the kit of the present invention and the competitor product for Sample 1 in Example 5;

[0039] Figure 10 shows the amplification curves of the kit of the present invention and the competitor product for Sample 1 in Example 5. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0040] It should be noted that, without conflict, the embodiments in the present application and the features in the embodiments may be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in conjunction with the embodiments.

[0041] Currently, the main methods for diagnosing feline herpesvirus type 1 include virus isolation, immunochromatography, and molecular genetics diagnosis. Among them, the virus isolation method is time-consuming and has cumbersome steps, making it impossible to achieve rapid and efficient results; immunochromatography utilizes the principle of specific binding of antigens and antibodies and is easy to perform, but its specificity is low, prone to false positives; while molecular biological detection such as fluorescence quantitative PCR has gradually been applied to pathogen detection. This method is achieved through specific amplification of the nucleic acid of the pathogen's genetic material. Due to its high sensitivity and specificity, it has become the mainstream and new standard for laboratory diagnosis.

[0042] Real-time fluorescence quantitative PCR detects and analyzes the target gene by detecting the real-time changes of fluorescence signals during the PCR process. Fluorescent PCR can rapidly detect the target gene DNA with high sensitivity and specificity, and can sensitively detect even when the specimen contains trace amounts of parvovirus DNA. Among them, the key step is to design primers and probes with appropriate length and high amplification efficiency in the conserved region of the virus gene.

[0043] Therefore, the inventors compared the TK gene and gD gene of feline herpesvirus type 1 registered in Genbank and found that specific primers and probes can be designed for the above amplification regions, which can detect feline herpesvirus type 1 with high specificity, sensitivity, and accuracy, and have no cross-reaction with other common feline respiratory pathogens.

[0044] According to a typical embodiment of the present invention, a reagent for detecting feline herpesvirus type 1 is provided. The reagent includes: a reagent for detecting the first region and / or the second region of feline herpesvirus type 1, wherein the first region is selected from any fragment of SEQ ID NO: 1, and the second region is selected from any fragment of SEQ ID NO: 2.

[0045] Applying the technical solution of the present invention can accurately detect feline herpesvirus type 1.

[0046] Due to the uniqueness of the above first region and second region, detecting any fragment of any length selected from one or both of these regions can achieve highly specific detection of feline herpesvirus type 1. To further improve the specificity and sensitivity of detection, in some preferred embodiments, the first region is selected from any fragment between the (1-6)-(83-95)th bases of SEQ ID NO: 1; and / or the second region is selected from any fragment between the (1-6)-(83-93)th bases of SEQ ID NO: 2.

[0047] For any fragment of any length in the above two regions, appropriate primers or primer-probe combinations can be designed for detection. In some preferred embodiments, the reagent comprises a primer pair, the primer pair comprising an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair having a nucleotide sequence complementary or identical to 19-26 consecutive nucleotides between positions (1-6)-(83-95) in SEQ ID NO: 1; and / or the reagent comprises a primer pair for detecting the nucleic acid sequence of SEQ ID NO: 2, the primer pair comprising an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair having a nucleotide sequence complementary or identical to 20-27 consecutive nucleotides between positions (1-6)-(83-93) in SEQ ID NO: 2.

[0048] In some more preferred embodiments, the primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 7-8, and / or the nucleotide sequences shown in SEQ ID NOs: 10, 13.

[0049] In some more preferred embodiments, the above reagent further comprises a probe, the probe being selected from the nucleotide sequences shown in SEQ ID NO: 9; and / or the nucleotide sequence shown in SEQ ID NO: 14. Specifically, the above primers and probes form two primer-probe combinations.

[0050] The first group:

[0051] Forward primer 1: 5'-TAAATCTGGAAGGAACCCCTGA-3' (SEQ ID NO: 7);

[0052] Reverse primer 1: 5'-GTGCATATCACATGCGGCTATAA-3' (SEQ ID NO: 8);

[0053] Probe 1: 5'-CCGCCGCCTTGGGAGCACT-3' (SEQ ID NO: 9).

[0054] The second group:

[0055] Forward primer 2: 5'-AGATTCCAAGAGGCCATTCGATA-3' (SEQ ID NO: 10);

[0056] Reverse primer 2: 5'-ACTCGATTCTCCTCTAGAGTCGTTG-3' (SEQ ID NO: 13);

[0057] Probe 2: 5'-TCCCGCCATACCGTCTGGGAGTG-3' (SEQ ID NO: 14).

[0058] The two primer-probe combinations of the present application have the advantages of high specificity, high sensitivity, and high detection accuracy in the detection of feline herpesvirus type 1.

[0059] In the above primer-probe combination, the 5'-end and 3'-end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group. Having a fluorescent reporter group and a fluorescent quenching group facilitates accurate and rapid detection by fluorescence quantitative PCR. Therefore, any group that can emit fluorescence and absorb fluorescence of the corresponding wavelength is applicable to the present application.

[0060] In some preferred embodiments, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7.; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse. When the above fluorescent reporter group and fluorescent quenching group are specifically used, they are reasonably selected and matched according to the wavelength of the emitted fluorescence and the wavelength that can absorb the fluorescence.

[0061] Considering from the perspectives of cost, effect, wide application and convenience, in some more preferred embodiments, the 5'-end of the above probe selects FAM group and / or VIC group, and the 3'-end selects BHQ group (specifically, it can be BHQ1, BHQ2 or BHQ3).

[0062] In the second typical embodiment of the present application, a kit is provided, and the kit includes any of the above reagents. Using this kit for the detection of feline herpesvirus type 1 has the advantages of high specificity, high sensitivity, and high detection accuracy.

[0063] In order to further improve the convenience of the detection of the kit, in some preferred embodiments, the above kit further includes at least one of the following: qPCR premix, and the qPCR premix includes qPCR buffer and AK Taq DNA polymerase. Preferably, the concentration of AK Taq DNA polymerase is 5U / μL. A suitable qPCR buffer can be selected from existing known products for application. Details are not described here. It should be noted that the DNA polymerase used in this qPCR premix is AK Taq DNA polymerase produced by PhyNexus, and the use of other DNA polymerases with similar effects is not excluded here.

[0064] The positive control in the kit is usually a gene fragment containing the object to be detected. In a preferred embodiment of the present application, the above positive control is a gene fragment containing 95bp and 93bp of feline herpesvirus type 1, and this gene fragment is shown as SEQ ID NO: 1 and SEQ ID NO: 2.

[0065] SEQ ID NO: 1:

[0066] TAAATCTGGAAGGAACCCCTGATGAATGTGCCGCCGCCTTGGGAGCACTGAGACAAGATATGGATATGACATTTATAGCCGCATGTGATATGCAC;

[0067] SEQ ID NO: 2:

[0068] AGATTCCAAGAGGCCATTCGATATGATCGTCCCGCCATACCGTCTGGGAGTGAGGATTCGAAACGGTCCAACGACTCTAGAGGAGAATCGAGT.

[0069] The negative control in the kit is a plasmid without the target gene fragment and is a control that will not amplify the target fragment. Preferably, the negative control is deionized water.

[0070] In the third typical embodiment, a method for fluorescence quantitative PCR detection of feline herpesvirus type 1 is provided, and this method includes performing fluorescence quantitative PCR detection using the above primer-probe composition or the above kit.

[0071] Preferably, the above-mentioned composition of one or two pairs of primers and probes is used to perform fluorescence quantitative PCR detection on the 95bp and 93bp target gene fragments to be detected respectively.

[0072] In some preferred embodiments, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92 - 98 °C (preferably 95 - 98 °C) for 30 s - 90 s (preferably 30 s - 60 s); denaturation treatment at 95 - 98 °C for 2 - 8 s (preferably 2 - 5 s), annealing or fluorescence signal collection treatment at 58 - 62 °C (preferably 59 - 61 °C) for 8 - 12 s, and a total of 40 - 44 cycles are performed.

[0073] In some more preferred embodiments, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 95 °C for 1 min; denaturation treatment at 95 °C for 5 s, annealing or fluorescence signal collection treatment at 60 °C for 10 s, and a total of 42 cycles are performed.

[0074] In the fourth typical embodiment, the application of the above reagent or the above kit in the detection of feline herpesvirus type 1 is provided. By applying a primer or a primer-probe combination (one or two groups) capable of differentiating feline herpesvirus type 1, the present application can amplify the target fragment in the sample of the nasal, oral and ocular secretions of diseased cats, and can sensitively and accurately identify feline herpesvirus type 1.

[0075] The beneficial effects of the present application will be further explained in detail below in conjunction with specific examples. It should be noted that the primers in the following examples were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Unless otherwise specified, the relevant reagents are all commercially available products.

[0076] Example 1: Screening of primers for feline herpesvirus type 1 - target 1 and target 2

[0077] Referring to the mRNA sequences of the TK gene (accession number MH027342.1) and the gD gene (accession number MH027311.1) of feline herpesvirus type 1 registered on NCBI, multiple sets of primer-probes were designed, synthesized by Sangon Biotech (Shanghai) Co., Ltd. and then diluted for use.

[0078] In the process of designing the above primers and probes, primer-probe fragments with fewer cases of hairpin structures, internal dimers of primers, dimers between primers, and formation of mismatches were selected as much as possible. Then, the designed primer-probe sequences were analyzed by alignment on the NCBI Blast online database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to avoid non-specific binding and amplification with other pathogenic bacteria or human genes.

[0079] Table 1. Specific primer-probe sequences of feline herpesvirus type 1

[0080]

[0081]

[0082] In order to screen the primer-probe combination with the best amplification efficiency, the present invention synthesized the target fragments of the target genes of feline herpesvirus type 1, inserted these sequences into the cloning vector, and purified the plasmids containing the positive fragments through monoclonal screening.

[0083] Using the recombinant plasmid containing the target gene of feline herpesvirus type 1 synthesized by Sangon Biotech (Shanghai) Co., Ltd., the plasmid concentration was measured using a NanoDrop 2000C (Thermo Scientific, America) ultra-micro spectrophotometer and converted into copies / mL, which was used as the plasmid standard. The constructed plasmid standard was diluted to 10 of the original solution with molecular-grade purified water.5 times, 10 6 times, 10 7 times, denoted as A5, A6, A7, with a sample loading volume of 5 μl.

[0084] Establish a 15-μL Real-time PCR reaction system and amplify it on the Applied Biosystems TM 7500 Real-time Fluorescent Quantitative PCR System. Among them, the 2×Mix (containing amplification buffer, dNTPs, UDG enzyme, MgCl2) and 5 U / μl Taq enzyme in the preparation table are all from the self-produced raw materials developed by Phoenix Biotech Co., Ltd.

[0085] Table 2. Reaction System of Real-time PCR

[0086] Name Dosage / μl 2×Mix 10μl Taq enzyme (5μ / μl) 0.3μl Probe-P (25μM) 0.1μl Forward primer-F (25μM) 0.2μl Reverse primer-R (25μM) 0.2μl Sterilized purified water Make up to 15μl

[0087] Three pairs of upstream and downstream primers designed for the TK gene can be combined into three primer combinations in total (equal amounts of FHV1-TK-P probes are paired in different primer combinations); the upstream and downstream primers designed for the gD gene are cross-combined, and a total of four primer combinations can be formed (equal amounts of FHV1-gD-P probes are paired in different primer combinations).

[0088] The amplification program is shown in Table 3 below:

[0089] Table 3. Real-time PCR Amplification Program

[0090]

[0091]

[0092] Among them, the target detection signal is FAM;

[0093] The amplification results are shown in Table 4, and the amplification curves are as Figure 1A , Figure 1B (A5 concentration), Figure 2A , Figure 2B (A6 concentration), Figure 3A , Figure 3B (A7 concentration) shown:

[0094] Table 4. Screening Results of Primers and Probes for Feline Herpesvirus 1

[0095] System Combination A5 A6 A7 1 TK-F1-R1 25.11 28.3 31.4 2 TK-F2-R2 24.94 28.01 31.5 3 TK-F3-R3 24.56 27.83 30.98 4 gD–F1-R1 24.92 28.7 32.31 5 gD–F1-R2 24.57 27.74 31.17 6 gD–F2-R1 24.66 28.13 32.03 7 gD–F2-R2 24.93 28.39 31.71

[0096] The results showed that the overall amplification effects of TK-F3-R3 and gD–F1-R2 were relatively good, with a better linearity and higher signal values. Meanwhile, the primer-probe combination of TK-F3-R3 and gD–F1-R2 was used as the dual-target primer-probe combination for this product.

[0097] Example 2: Detection of real samples

[0098] Oral swabs were taken from 5 cats diagnosed with feline herpesvirus type 1 infection and 5 healthy cats respectively, and the extraction of 200 μL samples was completed using the virus DNA / RNA rapid extraction reagent (magnetic bead method) developed by our company. Then, the system was prepared and detected according to the system in Table 5. The results are shown in Table 6, and the amplification curves are as Figure 4A , Figure 4B , Figure 5 shown:

[0099] Table 5. Reaction system of dual-target Real time PCR

[0100]

[0101]

[0102] Table 6. Clinical sample test of feline herpesvirus type 1

[0103] Sample name Ct value (FAM channel) Ct value (VIC channel) Positive sample 1 27.02 27.73 Positive sample 2 28.84 29.21 Positive sample 3 27.85 28.52 Positive sample 4 21.24 20.49 Positive sample 5 23.94 24.16 Negative sample 1 No Ct No Ct Negative sample 2 No Ct No Ct Negative sample 3 No Ct No Ct Negative sample 4 No Ct No Ct Negative sample 5 No Ct No Ct

[0104] The test results of this kit were consistent with the interpretation results of the control kit, and the positive coincidence rate and negative coincidence rate were both 100%.

[0105] Example 3: Sensitivity

[0106] The plasmid of feline herpesvirus type 1 in Example 1 above was detected for its concentration using an ultraviolet spectrophotometer, and then diluted to concentrations of 1000 copies / mL, 500 copies / mL, and 250 copies / mL with deionized water respectively. The diluted plasmids were detected using the determined reaction system above. The results are shown in Table 7, Figure 6A , Figure 6B shown. Then, the plasmid of feline herpesvirus type 1 with a concentration of 500 copies / mL was confirmed. The results are shown in Table 8, Figure 7A , Figure 7B shown. The results indicated that the detection method of the present invention had a high sensitivity, and the sensitivity could reach 500 copies / mL.

[0107] Table 7. Amplification results of sensitivity

[0108]

[0109]

[0110] Table 8. Sensitivity confirmation results

[0111]

[0112]

[0113] Example 4: Non-specificity (NTC, other pathogens)

[0114] Take oral swabs of cats infected with respiratory pathogens such as feline calicivirus, feline chlamydia, feline mycoplasma, and Bordetella bronchiseptica, and fecal samples of cats infected with feline parvovirus and feline coronavirus for specific detection. After extracting the samples, nucleic acids are detected. The results are shown in Table 9 Figure 8 As shown. According to the results, it is judged that both dual targets detect feline herpesvirus type 1 virus, and the results meet the expectations, verifying that the primer-probe or kit has good specificity.

[0115] Table 9. Specificity results of feline herpesvirus type 1

[0116] Sample name Ct value Feline calicivirus No ct Feline chlamydia No ct Feline mycoplasma No ct Bordetella bronchiseptica No ct Feline parvovirus No ct Feline coronavirus No ct

[0117] Example 5: Performance comparison with competing products

[0118] Use the kit of the present invention and the feline herpesvirus type 1 fluorescence PCR detection kit (GZP003) of a competing product to detect two samples positive for feline herpesvirus type 1. After extracting nucleic acids, PCR amplification is carried out. The results are shown in Table 10 Figure 9 , Figure 10 As shown, the dual-target detection effect of the kit of the present invention is better than that of the competing product kit.

[0119] Table 10. Performance comparison of competing product kits

[0120] Sample name Ct value of self-developed TK target Ct value of self-developed gD target Ct value of Phyllostachys viridis competitor Sample 1 28.09 28.12 29.36 Sample 2 30.05 30.79 32.23

[0121] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A reagent for detecting feline herpesvirus type 1, characterized in that, the reagent comprises: a reagent for detecting the first region and / or the second region of feline herpesvirus type 1, wherein the first region is selected from any fragment of SEQ ID NO: 1, and the second region is selected from any fragment of SEQ ID NO:

2.

2. The reagent according to claim 1, characterized in that, the first region is selected from any fragment between the bases at positions (1-6)-(83-95) of SEQ ID NO: 1; and / or the second region is selected from any fragment between the bases at positions (1-6)-(83-93) of SEQ ID NO:

2.

3. The reagent according to claim 2, characterized in that, the reagent comprises a primer pair, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 19-26 consecutive nucleotides between the bases at positions (1-6)-(83-95) of SEQ ID NO: 1; and / or the reagent comprises a primer pair, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 20-27 consecutive nucleotides between the bases at positions (1-6)-(83-93) of SEQ ID NO:

2.

4. The reagent according to claim 3, characterized in that, the primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 7-8, and / or the nucleotide sequences shown in SEQ ID NOs: 10, 13; Preferably, the reagent further comprises a probe, and the probe is selected from the nucleotide sequences shown in SEQ ID NO: 9; and / or the nucleotide sequence shown in SEQ ID NO: 14; wherein, SEQ ID NO: 7 is 5'-TAAATCTGGAAGGAACCCCTGA-3', SEQ ID NO: 8 is 5'-GTGCATATCACATGCGGCTATAA-3' SEQ ID NO: 9 is 5'-CCGCCGCCTTGGGAGCACT-3', SEQ ID NO: 10 is 5'-AGATTCCAAGAGGCCATTCGATA-3', SEQ ID NO: 13 is 5'-ACTCGATTCTCCTCTAGAGTCGTTG-3', SEQ ID NO: 14 is 5'-TCCCGCCATACCGTCTGGGAGTG-3'.

5. The reagent according to claim 4, characterized in that, the 5' end and the 3' end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group; Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse; More preferably, the 5'-end of the probe is FAM and / or VIC group, and the 3'-end is BHQ group.

6. A kit, characterized in that, the kit comprises the reagent for detecting the nucleic acid of feline herpesvirus type 1 in a sample to be detected according to any one of claims 1 to 5.

7. The kit according to claim 6, characterized in that, the kit further comprises at least one of the following: qPCR premix, the qPCR premix comprises qPCR buffer and AK Taq DNA polymerase, preferably, the concentration of the AK Taq DNA polymerase is 5U / μL.

8. A method for fluorescent quantitative PCR detection of feline herpesvirus type 1, characterized in that, the fluorescent quantitative PCR detection is carried out by using the reagent for detecting the nucleic acid of feline herpesvirus type 1 in a sample to be detected according to any one of claims 1 to 5 or the kit according to claim 6 or 7.

9. The method according to claim 8, characterized in that, the conditions for the fluorescent quantitative PCR detection are: pre-denaturation at 92-98°C for 30s-90s; denaturation at 92-98°C for 2-8s, annealing at 58-62°C for 8-12s and collecting fluorescence signal processing, for a total of 40-44 cycles.

10. Use of the reagent for detecting the nucleic acid of feline herpesvirus type 1 in a sample to be detected according to any one of claims 1 to 5 or the kit according to claim 6 or 7 in the detection of feline herpesvirus type 1.

Images