Antibacterial peptide Clavanin A-1, encoding gene and its application

Abstract

The present invention relates to the field of biotechnology, and specifically relates to an antimicrobial peptide Clavanin A-1, its encoding gene and applications thereof. The present invention provides an antimicrobial peptide Clavanin A-1 with good thermal stability, acid-base stability and resistance to degradation by endogenous proteases, which can significantly inhibit the growth of Escherichia coli, Salmonella and Staphylococcus aureus, and has broad application prospects in the fields of food, hygiene products, cosmetics, biological pesticides, biological feed additives or natural food preservatives, etc.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically relates to antimicrobial peptide Clavanin A-1, its encoding gene and applications thereof. Background Art

[0002] In animal husbandry, bacterial diseases such as bacterial diarrhea seriously endanger animal health and cause significant losses to farming. Currently, it is mainly treated and prevented by using antibiotics. However, the overuse and abuse of antibiotics continuously lead to the emergence of drug-resistant strains and drug resistance, thus threatening human health. Antimicrobial peptides (AMPs) are short peptides produced by organisms, usually composed of 6 - 60 amino acids, and have good acid-base stability and thermal stability. The multi-site targeting and rapid killing ability of AMPs make the affected microorganisms not have enough time to acquire resistance to AMPs, which is one of the main mechanisms lacking in traditional antibiotics. In addition, the fact that AMPs may only act on eukaryotic cells infected by pathogens but have almost no side effects on healthy eukaryotic cells is also an important advantage. AMPs have attracted great interest in the scientific community due to their antibacterial, antifungal, antiviral and anticancer cell properties and have been widely used in fields such as food engineering, drug treatment, medical devices and agriculture.

[0003] Clavanin A is a defensin derived from the invertebrate Styela clava, an α-helical antimicrobial peptide composed of 23 amino acid residues, showing antibacterial activity comparable to that of magainins and cecropins. Currently, Clavanin A is only limited to chemical synthesis. Although chemical synthesis of antimicrobial peptides has a short cycle, small workload and can randomly combine amino acid residues, there are problems of racemization and high production costs. Genetic engineering technology mainly through prokaryotic expression and eukaryotic expression pathways has the characteristics of simple operation, easy separation and purification, and low production costs, making it have the potential for large-scale and industrial production and becoming a research hotspot in recent years. Therefore, it is of great significance to obtain a new type of antimicrobial peptide Clavanin A-1 with good thermal stability, acid-base stability and strong antibacterial activity by using biological genetic engineering technology. Summary of the Invention

[0004] Aiming at the deficiencies of the prior art, the present invention provides antimicrobial peptide Clavanin A-1, its encoding gene and applications thereof, and proves that it has inhibitory effects on Escherichia coli, Salmonella and Staphylococcus aureus, and has good thermal stability, acid-base stability and the characteristic of resistance to endogenous protease degradation.

[0005] To achieve the above object, the present invention provides an antibacterial peptide Clavanin A-1, which is characterized by being a protein composed of the amino acids shown in SEQ ID NO. 1;

[0006] The protein of the above antibacterial peptide Clavanin A-1 can tolerate a high-temperature environment of pH 3-11, 90-95 °C and degradation by endogenous proteases, and can be applied to the preparation of biotechnology fields such as food, hygiene products, cosmetics, biological pesticides, biological feed additives or natural food preservatives.

[0007] In a second aspect, the present invention also provides a coding gene for the antibacterial peptide Clavanin A-1. Further, the nucleotide sequence of the gene is the nucleotide sequence shown in SEQ ID NO. 2;

[0008] Those skilled in the art fully understand that since the same amino acid may be determined by multiple different codons, the nucleotide sequence encoding the above protein is not limited to one, and can be a nucleotide sequence obtained by synonymous mutation of one or more nucleotides in the mutant nucleotide sequence shown in SEQ ID NO. 2, or a nucleotide sequence that can encode the mutant amino acid sequence of the present invention designed according to codon optimization.

[0009] In a third aspect, recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the above gene also belong to the protection scope of the present invention.

[0010] In a fourth aspect, a preparation method of the antibacterial peptide Clavanin A-1 also belongs to the protection scope of the present invention, including the following steps: fusing the coding gene of the antibacterial peptide Clavanin A-1 with a SUMO fragment, constructing a recombinant expression vector, introducing the recombinant expression vector into a host cell, and obtaining the recombinantly expressed antibacterial peptide Clavanin A-1.

[0011] Further, the recombinant expression vector is selected from one or more of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a Lactobacillus expression vector, a Streptomyces expression vector, a phage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector; preferably, it is selected from pET-28a(+).

[0012] Further, the recombinant bacteria or transgenic line for recombinantly expressing the antibacterial peptide Clavanin A-1 is selected from one of an Escherichia coli host cell, a yeast host cell, a Bacillus subtilis host cell, a Lactobacillus host cell, an actinomycete host cell, a filamentous fungus host cell, an insect cell, or a mammalian cell; preferably, it is selected from BL21(DE3).

[0013] Fifth aspect, the present invention also provides the application of antibacterial peptide Clavanin A-1 in the preparation of food, hygiene products, cosmetics, biological pesticides, biological feed additives or natural food preservatives.

[0014] Furthermore, antibacterial peptide Clavanin A-1 is used to inhibit the growth of one or more bacteria among Escherichia coli, Salmonella and Staphylococcus aureus.

[0015] Sixth aspect, an antibacterial drug comprising the antibacterial peptide Clavanin A-1 also belongs to the protection scope of the present invention.

[0016] Beneficial effects: The present invention provides an antibacterial peptide Clavanin A-1 with good thermal stability, acid-base stability and resistance to degradation by endogenous proteases, which can significantly inhibit the growth of Enterobacter, Salmonella and Staphylococcus aureus, and has broad application prospects in the fields of food, hygiene products, cosmetics, biological pesticides, biological feed additives or natural food preservatives, etc. Description of the Drawings

[0017] Figure 1 It is the PCR amplification verification electrophoresis diagram of antibacterial peptide Clavanin A-1 in the present invention;

[0018] Figure 2 It is the antibacterial activity diagram of Clavanin A-1 in the present invention;

[0019] Figure 3 It is the pH stability diagram of antibacterial peptide Clavanin A-1 in the present invention;

[0020] Figure 4 It is the thermal stability diagram of antibacterial peptide Clavanin A-1 in the present invention;

[0021] Figure 5 It is the endogenous protease stability diagram of antibacterial peptide Clavanin A-1 in the present invention. Detailed Embodiments

[0022] To enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be described in detail below in conjunction with specific embodiments. The experimental methods without specific conditions noted in the following examples are generally carried out under conventional conditions or according to the conditions recommended by the manufacturer. The test materials used in the following examples are, unless otherwise specified, purchased from regular biochemical reagent stores. Unless otherwise stated, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described herein are for illustrative purposes only.

[0023] Some experimental materials and reagents used in the present invention:

[0024] Strains and vectors: Escherichia coli BL21(DE3) was purchased from TransGen Biotech Co., Ltd. in Beijing; the pET-28a(+) expression vector was obtained from Wuhan Miaoling Biotechnology Co., Ltd.

[0025] Enzymes and other biochemical reagents: ClonExpress II One Step Cloning Kit was purchased from Nanjing Novoprotein Scientific Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; Pfu-Mix high-fidelity enzyme was purchased from Takara Biotechnology Co., Ltd.; porcine pepsin, trypsin, and chymotrypsin were purchased from Shanghai Yuanye Bio-Technology Co., Ltd.; others were domestic reagents (all can be purchased from ordinary biochemical reagent companies).

[0026] Media: LB medium: Peptone 10 g, Yeastextract 5 g, NaCl 10 g, add distilled water to 1000 mL, pH natural (about 7.0). Solid medium adds 2.0% (w / v) agar on this basis.

[0027] Example 1 Obtaining of the encoding gene of antibacterial peptide Clavanin A-1

[0028] Download the antimicrobial peptide Clavanin A (amino acid sequence shown in SEQ ID NO.3) from the Antimicrobial Peptide Database (https: / / aps.unmc.edu / AP / ), mutate N14L, S20L, H21L, V22K, and F23K of the antimicrobial peptide Clavanin A to obtain the antimicrobial peptide Clavanin A-1 (amino acid sequence shown in SEQ ID NO.1), optimize the codons of the amino acids of the antimicrobial peptide Clavanin A-1 to obtain the amino acids encoding Clavanin A-1 (nucleotide sequence shown in SEQ ID NO.2), synthesize the sequence encoded by Clavanin A-1, and ligate it to the pMD-19-T cloning vector to obtain the target fragment named Clavanin A-1, which is 72 bp in length and the GC content of the sequence is 43.48%.

[0029] Experimental Example 2 Construction and Transformation of the Recombinant Antimicrobial Peptide Clavanin A-1 Expression Vector

[0030] 2.1 Use Clavanin A-1-pMD-19-T as a template and perform PCR amplification. The amplification reaction system is as follows: 12.5 μL of Pfu-Mix, 1.5 μL each of the primers Clavanin A-1-F3 and Clavanin A-1-R4, 0.25 μL of plasmid template DNA, and make up to 25 μL with ddH2O. The amplification reaction conditions are: denaturation at 95°C for 30 sec; then denaturation at 95°C for 30 sec, annealing at 52°C for 30 sec, extension at 72°C for 1 min, for 30 cycles; incubation at 72°C for 10 min. After gel recovery and purification of the PCR product, store it at -20°C for later use.

[0031] Forward primer Clavanin A-1-F3 (sequence shown in SEQ ID NO.4):

[0032] AGATTGGCGGCGCCACATATGTCTTCCAGTTCCTGGGTAAAATC

[0033] Reverse primer Clavanin A-1-R4 (sequence shown in SEQ ID NO.5):

[0034] TGGTGGTGGTGGTGGTGCTCGAGTTATTTTTTCAGCAGGAAACCATG

[0035] 2.2 Download the SUMO family protein SMT3 (amino acid sequence shown in SEQ ID NO.6) from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), optimize the codons of its amino acid sequence, synthesize the sequence of the modified coding gene, and ligate it to the pMD-19-T cloning vector. The obtained target fragment is named SUMO (nucleotide sequence shown in SEQ ID NO.7), with a length of 303 bp.

[0036] 2.3 Using SUMO-pMD-19-T as a template, perform PCR amplification. The amplification reaction system is as follows: 12.5 μL of Pfu-Mix, 1.5 μL each of primers SUMO-F1 and SUMO-R2, 0.25 μL of plasmid template DNA, and make up to 25 μL with ddH2O. The amplification reaction conditions are: denaturation at 95°C for 30 sec; then denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1 min 30 sec, for 30 cycles; incubation at 72°C for 10 min. After gel recovery and purification of the PCR product, store it at -20°C for later use.

[0037] Forward primer SUMO-F1 (sequence shown in SEQ ID NO.8):

[0038] TGGTGCCGCGCGGCAGCCATATGATGAGTGATTCTGAAGTTAATCAA

[0039] Reverse primer SUMO-R2 (sequence shown in SEQ ID NO.9):

[0040] TTACCCAGGAACTGGAAGACATATGTGGCGCCGCCAATCTGTTC

[0041] 2.4 Using the target fragments recovered in 2.1 and 2.3 as templates, the target fragment SUMO-Clavanin A-1 was amplified by PCR using primers SUMO-F1 and Clavanin A-1-R4. The amplification reaction system was as follows: 25.0 μL of Pfu-Mix, 2.0 μL each of primers SUMO-F1 and Clavanin A-1-R4, 0.5 μL each of templates SUMO and Clavanin A, and made up to 50 μL with ddH2O. The amplification reaction conditions were: 94°C for 5 min; 94°C for 30 sec, 63°C to 49°C for 30 sec, 72°C for 1 min 30 sec, for a total of 28 cycles, with the annealing temperature decreasing by 0.5°C for each cycle; 94°C for 30 sec, 49°C for 30 sec, 72°C for 1 min 30 sec, for a total of 7 cycles; finally, 72°C for 10 min; 4°C for 10 min. After gel recovery of the PCR product, it was purified and recovered, and stored at -20°C for later use.

[0042] 2.5 The expression vector pET-28a(+) was digested with restriction enzymes (NdeI and XhoI). The digested products of SUMO-Clavanin A-1 and pET-28a(+) after gel recovery and purification were ligated by the recombinase of ClonExpress II One Step Cloning Kit to obtain the recombinant plasmid SUMO-Clavanin A-1-pET-28a(+) containing SUMO-Clavanin A-1; the nucleotide sequence formed by the recombinant SUMO-Clavanin A-1 was as shown in SEQ ID NO.10;

[0043] 2.6 The recombinant plasmid SUMO-Clavanin A-1-pET-28a(+) was transformed into Escherichia coli BL21(DE3) by heat shock to obtain the recombinant strain BL21(DE3) / SUMO

[0044] -Clavanin A-1.

[0045] Experimental Example 3 Preparation of Recombinant Antibacterial Peptide Clavanin A-1

[0046] 3.1 The recombinant strain BL21(DE3) / SUMO-Clavanin A-1 obtained in Example 2 was inoculated into LB (containing 50 μg / mL kanamycin) culture medium at an inoculum size of 2.0%, and shaken in a shaker at 37°C and 200 rpm / min for 12 - 16 h for activation.

[0047] 3.2 Inoculate the activated bacterial solution in 3.1 into fresh LB (containing 50 μg / mL kanamycin) culture medium at an inoculation amount of 2.0%, and culture it with shaking in a shaker at 37 °C and 200 rpm / min for about 3 - 4 h (OD 600nm is about 0.7), then add IPTG with a final concentration of 0.6 mM for induction, and continue to culture it with shaking in a shaker at 16 °C and 150 rpm / min for about 20 h to induce the production of recombinant protein.

[0048] 3.3 Centrifuge at 4 °C and 8000 rpm / min for 10 min to collect the bacterial cells. Suspend the bacterial cells with an appropriate amount of citric acid - phosphate buffer with pH = 7.0, and then disrupt the bacterial cells by ultrasonic wave in a low - temperature water bath. After the crude enzyme solution concentrated intracellularly is centrifuged at 13000 rpm / min for 15 min, aspirate the supernatant and purify the target protein by affinity chromatography with Nickel - NTA Agarose and imidazole with a concentration range of 0 - 500 mM.

[0049] The SDS - PAGE results of the purified protein are as Figure 1 shown, where M is the protein Marker, and A - 1 is the recombinant fusion antibacterial peptide Clavanin A - 1. The results show that the recombinant fusion antibacterial peptide Clavanin A - 1 has been expressed and purified, and the product is a single band.

[0050] Experimental Example 4 Investigation of the antibacterial activity of recombinant antibacterial peptide Clavanin A - 1

[0051] The antibacterial activity of recombinant antibacterial peptide Clavanin A - 1 was determined by the inhibition zone method. The specific method is as follows: (1) Inoculate Escherichia coli K88, Escherichia coli K99, Salmonella choleraesuis, Salmonella enteritidis and Staphylococcus aureus into 20 mL of liquid medium respectively, and culture them overnight in a shaker at 37 °C and 200 rpm / min; (2) Take 200 μL of the overnight - cultured bacterial strains and inoculate them into 20 mL of sterile medium respectively, and culture them in a shaker at 37 °C and 200 rpm / min for 0.5 - 1 h to make OD 600 nm about 0.1. At this time, the concentration of bacterial cells reaches about 1 × 10 8 CFU / mL, which is in the logarithmic growth phase or the early logarithmic growth phase; (3) Dip a sterile cotton swab into a little bacterial solution and spread it on the LB solid medium; (4) Use forceps to pick up a sterilized Oxford cup and place it evenly on the plate paved with the indicator bacteria, aspirate 50 μL of the recombinant antibacterial peptide Clavanin A - 1 sample into the Oxford cup, and use sterile water as a control; (5) After loading the sample, place the plate horizontally in an incubator at 37 °C for 12 h, and observe whether an inhibition zone is formed.

[0052] The results showed that the recombinant antimicrobial peptide Clavanin A-1 had inhibitory effects on Escherichia coli, Staphylococcus aureus and Salmonella ( Figure 2 ), while there was no inhibition zone in the control group with sterile water. The inhibition zone sizes of 40 μg / mL recombinant antimicrobial peptide Clavanin A-1 against Escherichia coli K88, Escherichia coli K99, Salmonella choleraesuis, Salmonella enteritidis and Staphylococcus aureus reached 12.00 mm, 14.00 mm, 15.00 mm, 13.00 mm and 20.00 mm respectively.

[0053] Determine the minimum inhibitory concentration (MIC) of the recombinant antimicrobial peptide Clavanin A-1: The specific determination method of MIC is the micro-dilution method: The indicator bacteria were cultured in LB liquid medium until the logarithmic growth phase, and each bacterial cell was collected and diluted to a cell concentration of 1 × 10 8 CFU / mL for standby. This step is the preparation of the bacterial suspension; The purified antimicrobial peptide Clavanin A-1 solution was equally mixed with LB liquid medium in the first column of the 96-well plate to an initial concentration of 200 μg / mL of the antimicrobial peptide sample, and serial two-fold dilutions were carried out in the subsequent columns to form a concentration gradient. An equal amount of the diluted bacterial suspension was added to the samples with the concentration gradient in the 96-well plate, and it was incubated in an incubator at 37 °C for 16 h. After incubation, the turbidity of each well was observed with the naked eye. The minimum concentration that could make the well clear was the MIC of the antimicrobial peptide Clavanin A-1 against each bacterium. The results are shown in Table 1. The recombinant antimicrobial peptide Clavanin A-1 had good inhibitory activity against the three bacteria. The recombinant antimicrobial peptide Clavanin A-1 had stronger inhibitory activity against Gram-positive bacteria, and the MIC against Staphylococcus aureus was 4.6875 μg / mL.

[0054] Table 1 Minimum inhibitory concentration of recombinant antimicrobial peptide Clavanin A-1 against different bacteria

[0055]

[0056] Example 4 Investigation on the stability determination of recombinant antimicrobial peptide Clavanin A-1 at different pH values

[0057] The samples of the recombinant antimicrobial peptide Clavanin A-1 were respectively placed in different buffers with pH 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0 and treated for 2 hours. The samples treated with different pH values were used as the test samples, and the untreated samples were used as the control to determine the bactericidal rate of Staphylococcus aureus (see Figure 3), The specific method for measuring the bactericidal rate of Staphylococcus aureus is as follows: After culturing Staphylococcus aureus to the logarithmic growth phase, the bacteria are collected by centrifugation at 10,000 rpm / min for 3 minutes, resuspended in an equal amount of 0.1 M PBS buffer, centrifuged, and the supernatant is removed. The above steps are repeated 3 times. Finally, the bacteria are diluted with PBS buffer to a concentration of 1 × 10 8 CFU / mL of bacterial suspension for standby; The antibacterial peptide samples treated with different pH values are mixed with the diluted Staphylococcus aureus bacterial suspension and lysed at 37 °C for 1 hour. The viable bacteria in the lysed bacterial solution are counted using the dilution plating method; Using the untreated sample as a control, calculate the bactericidal rate of the sample against Staphylococcus aureus after treatment with different pH values for 2 hours; Bactericidal rate (%) = number of viable bacteria in the treatment group / total number of colonies in the control group * 100%.

[0058] As Figure 3 shown, the bactericidal rate of the recombinant antibacterial peptide Clavanin A-1 against Staphylococcus aureus shows almost no obvious change after treatment with different pH values. The bactericidal rate against Staphylococcus aureus can still reach more than 87% after treatment with each pH value for 2 hours, indicating that the recombinant antibacterial peptide Clavanin A-1 has good acid-base tolerance.

[0059] Example 5 Investigation of the thermal stability of the recombinant antibacterial peptide Clavanin A-1

[0060] The samples of the recombinant antibacterial peptide Clavanin A-1 are respectively heated at 25 °C, 37 °C, 50 °C, 70 °C, 90 °C and 95 °C for 30 min. The heat-treated samples are used as the test samples, and the untreated samples are used as the control for the determination of the bactericidal rate of Staphylococcus aureus (see Figure 4 ).

[0061] As Figure 4 shown, the bactericidal rate of the recombinant antibacterial peptide Clavanin A-1 against Staphylococcus aureus shows almost no obvious change after treatment at different temperatures. After treatment at high temperatures of 90 °C and 95 °C for 30 min, the bactericidal rates against Staphylococcus aureus still remain at 88.64% and 87.54%, indicating that the recombinant antibacterial peptide Clavanin A-1 has good thermal stability and can withstand the high-temperature treatment process of industrial processing.

[0062] Example 6 Investigation of the stability of the recombinant antibacterial peptide Clavanin A-1 against endogenous proteases

[0063] The recombinant antimicrobial peptide Clavanin A-1 samples were respectively placed in buffer solutions containing 737.5 U / mL of porcine pepsin, 760.0 U / mL of trypsin, and 95.6 U / mL of chymotrypsin and treated for 4 hours. The samples treated with proteases were used as the samples to be tested, and the untreated samples were used as the control for the determination of the bactericidal rate against Staphylococcus aureus (see Figure 5 ).

[0064] As Figure 5 shown, after the recombinant antimicrobial peptide Clavanin A-1 was treated with 737.5 U / mL of porcine pepsin for 4 hours, the bactericidal rate against Staphylococcus aureus was 90.21%; after being treated with 760.0 U / mL of trypsin and 95.6 U / mL of chymotrypsin for 4 hours, the bactericidal rate against Staphylococcus aureus still remained above 90%; indicating that the endogenous proteases in the porcine gastrointestinal tract had no effect on the bactericidal rate of the recombinant antimicrobial peptide Clavanin A-1.

[0065] Finally, it should be noted that the above description is only the preferred embodiment of the present invention. Those skilled in the art can make various similar representations under the inspiration of the present invention without departing from the purpose and claims of the present invention. Such transformations all fall within the protection scope of the present invention.

Claims

1. An antibacterial peptide Clavanin A-1, characterized in that, A protein composed of the amino acids shown in SEQ ID NO.

1.

2. The coding gene of the antibacterial peptide Clavanin A-1 according to claim 1, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

3. A recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the encoding gene according to claim 2.

4. A preparation method of antibacterial peptide Clavanin A-1, characterized in that: The encoding gene according to claim 2 is fused with a SUMO fragment to construct a recombinant expression vector, and the recombinant expression vector is introduced into a host cell to obtain the recombinantly expressed antimicrobial peptide Clavanin A-1.

5. The preparation method according to claim 4, characterized in that, The recombinant expression vector is selected from one of an Escherichia coli expression vector, a yeast expression vector, a lactic acid bacterium expression vector, a Streptomyces expression vector, a phage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, and a mammalian cell expression vector.

6. The preparation method according to claim 4, characterized in that, The host cell is selected from one of an Escherichia coli host cell, a yeast host cell, a lactic acid bacterium host cell, an actinomycete host cell, a filamentous fungus host cell, an insect cell, and a mammalian cell.

7. The preparation method according to claim 4, characterized in that, The recombinant expression vector is selected from pET-28a(+), and / or The host cell is selected from BL21(DE3).

8. Use of the antimicrobial peptide Clavanin A-1 according to claim 1 in the preparation of food, hygiene products, cosmetics, biopesticides, biofeed additives or food preservatives.

9. The application according to claim 8, wherein For inhibiting the growth of one or more bacteria among Escherichia coli, Salmonella and Staphylococcus aureus.

10. An antibacterial drug, characterized in that, Comprising the antimicrobial peptide Clavanin A-1 according to claim 1.

Images