Bacillus subtillis tolerant to vanillin and application of bacillus subtillis

Abstract

The invention relates to a recombinant bacillus subtillis for chassis transformation, which can improve the tolerance of the bacillus subtillis to vanillin, and belongs to the technical field of metabolic engineering. According to the recombinant bacillus subtilis, the vanillin tolerance is improved by knocking out a fragment containing an mhqR gene on a bacillus subtilis genome, and the tolerance concentration of the vanillin can be increased to 4.5 g / L from 2g / L of a wild strain. The strain can be applied to construction of vanillin-tolerant chassis bacteria or construction and production of vanillin / vanillin precursor / vanillin derivative production strains, the production capacity is improved, and the yield of corresponding products is increased.

Description

Technical field:

[0001] The invention relates to a recombinant Bacillus subtilis with chassis modification, which can improve the tolerance of Bacillus subtilis to vanillin and belongs to the technical field of metabolic engineering. Background technology:

[0002] Aldehyde is an important organic compound characterized by a -CHO group. Since aldehyde molecules contain a carbonyl group, they can be reduced to alcohols or oxidized to acids, so aldehydes have both oxidizing and reducing properties. Many aldehydes have aromatic flavors, such as cinnamaldehyde and vanillin, so aldehyde compounds are widely used in the food and cosmetic fields.

[0003] Vanillin, also known as vanillin, is an aldehyde compound with a milky aroma. As a broad-spectrum high-end spice, vanillin is widely used in food, tobacco, medicine and chemical industries. In the food field, vanillin is used as a flavor additive with multiple functions because of its strong sweetness and very rich creamy vanilla flavor. Vanillin is not only used to enhance the flavor of food and beverages, but also used as a biological preservative because of its antibacterial and antioxidant activities, as well as anti-mutagenic activity. Synthetic vanillin is also used to manufacture many household products, such as deodorants, air fresheners, floor polishes and herbicides, and it is also used in the medical field as a precursor of dopamine, etc.

[0004] The market demand for vanillin, known as the "king of spices", exceeds 20,000 tons. At present, the production methods of vanillin include plant extraction, chemical synthesis and microbial synthesis. Among them, the plant extraction method mainly extracts vanillin from the pods of the vanilla plant vanilla. Since the conventional cultivation, harvesting and maintenance process of vanilla plants is time-consuming and the yield is extremely low, the output of naturally extracted vanillin is less than 2,000 tons. Therefore, the natural vanillin obtained by plant extraction is expensive and the supply is very limited. Vanillin produced by microorganisms is natural vanillin, which has high purity and activity of natural vanillin. It can effectively solve the problems of land area occupied by plant cultivation, slow plant growth cycle and low yield in plant extraction, and can avoid the pollution and toxic effects of chemical synthesis.

[0005] Since vanillin has an antibacterial effect, it will have a strong inhibitory effect on the growth of microorganisms, affecting the growth activity of microorganisms, resulting in the inability to achieve high yields of vanillin. Therefore, improving the tolerance of microbial cells to vanillin is an important way to increase the yield of vanillin by microbial methods.

[0006] The research on the antibacterial mechanism of vanillin mainly includes three aspects: acting on the cell membrane to destroy the integrity of the membrane; acting on the enzyme to inactivate the essential enzyme; acting on the genetic material to inactivate the genetic material or destroy its structure. Destroy cell integrity: The phenolic group in vanillin is hydrophobic, and the lower the pH value, the stronger the hydrophobicity. It can make the cell membrane unstable, destroy the cell membrane structure, cause the cell wall to be concave, the cell membrane to protrude inward, the cytoplasm to condense and vacuoles to form, etc. Inactivate essential enzymes: Organisms are composed of cells. Each cell can perform life functions and the metabolism in the body can proceed due to the presence of enzymes. Enzymes are proteins, RNA or their complexes that catalyze specific chemical reactions. They are biological catalysts. The chemical nature of most enzymes is protein, and their activity is affected by some external conditions, such as pH, salt ion concentration, temperature, etc. Vanillin destroys the cell membrane, causing changes in the intracellular environment, indirectly inhibiting the activity of enzymes, and affecting the metabolism in cells. For example, vanillin inhibits the activity of DNA polymerase. Inactivation of genetic material or destruction of structure: The genetic material of most organisms (organisms with cell structures and DNA viruses) is DNA, which can guide the synthesis of proteins, thereby controlling metabolism and biological traits. Vanillin can hinder the synthesis and expression of genetic material in microorganisms during the lag period. The reason may be that the cell membrane is destroyed, which indirectly inhibits the enzymes involved in the synthesis and expression of genetic material.

[0007] Bacillus subtilis is a typical model industrial microorganism. It is recognized as a biosafe (GRAS) host strain and is widely used in many fields including protease preparations, fine chemicals, nutrients and pharmaceuticals. Although Bacillus subtilis has good application prospects, the expression of non-essential genes and the accumulation of non-target chemicals in production applications cause the loss of precursor substances, the dispersion of metabolic flows and the expression of bypass pathways in production applications, resulting in waste of resources and energy. Therefore, the redundancy of some non-essential genes in chassis cells is one of the limiting bottlenecks for industrial applications. By knocking out some non-essential genes in Bacillus subtilis, it is possible to delete non-essential genes in the genome that are sensitive to vanillin, thereby improving the vanillin tolerance of Bacillus subtilis. Summary of the invention:

[0008] The purpose of the present invention is to provide a method for improving vanillin tolerance and a Bacillus subtilis chassis cell constructed thereby, so as to overcome the problem of vanillin intolerance in subsequent related metabolic pathway production, and to be used for the fermentation production of vanillin, vanillin precursors (vanillic acid, etc.), and vanillin derivatives (ethyl vanillin, etc.).

[0009] The present invention starts from a wild-type Bacillus subtilis strain and screens a microbial strain that can tolerate high concentrations of vanillin by knocking out a large genomic fragment. Compared with the wild-type, a strain that tolerates high concentrations of vanillin is successfully screened, that is, a method for improving the vanillin tolerance of Bacillus subtilis is obtained, and a Bacillus subtilis strain with enhanced vanillin tolerance constructed according to the method is obtained.

[0010] One of the technical solutions provided by the present invention is a method for improving the vanillin tolerance of Bacillus subtilis, wherein the method improves the vanillin tolerance by knocking out a fragment containing the mhqR gene on the genome of Bacillus subtilis;

[0011] Furthermore, the fragment containing the mhqR gene is a fragment from kinD to motA on the Bacillus subtilis genome, comprising kinD, mhqR, motB, and motA genes.

[0012] The second technical solution provided by the present invention is a strain of Bacillus subtilis with high tolerance to vanillin, wherein the strain is a Bacillus subtilis with a defective mhqR gene segment;

[0013] The defects are not limited to gene knockout, gene inactivation, etc.;

[0014] Furthermore, the starting strain of the Bacillus subtilis with high vanillin tolerance is Bacillus subtilis 168;

[0015] The mhqR gene fragment has Gene ID 939303, as shown in SEQ ID NO.2;

[0016] Furthermore, the Bacillus subtilis strain with high tolerance to vanillin is obtained by knocking out a 3760bp large fragment including the mhqR gene fragment on the genome of Bacillus subtilis 168 as the starting strain, and the large fragment is located at positions 1431486-1435245 on the genome of Bacillus subtilis 168, as shown in SEQ ID NO.1; the recombinant bacteria after the knockout are named Bacillus subtilis strain 20 (referred to as Bs-20 strain);

[0017] Furthermore, the position number of the knockout sequence on the genome refers to https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_000009045.1 / , and the GenBank accession number of the whole genome of Bacillus subtilis 168 is: NC_000964.3.

[0018] The third technical solution provided by the present invention is the application of the above-mentioned Bacillus subtilis with high tolerance to vanillin, especially in the production of vanillin, more particularly in the construction of vanillin-tolerant chassis bacteria, or in the construction of vanillin / vanillin precursor / vanillin derivative production strains. Those skilled in the art can continue to construct vanillin production strains or vanillin precursor / derivative production strains based on the knockout of the mhqR gene fragment or the above-mentioned 3760bp large fragment in Bacillus subtilis.

[0019] Furthermore, the vanillin precursor includes but is not limited to: vanillic acid, vanillyl alcohol, protocatechuic acid, protocatechuic aldehyde, etc.;

[0020] Furthermore, the vanillin derivatives include but are not limited to: ethyl vanillin, cinnamic acid, etc.

[0021] Beneficial effects:

[0022] The present invention provides a base bacteria for the production of vanillin / vanillin precursor / vanillin derivative by constructing a vanillin tolerant strain, which is beneficial to improving the production capacity of vanillin and its precursors and derivatives and increasing the yield of corresponding products.

[0023] The present invention uses Bacillus subtilis 168 as a starting strain, and the Bacillus subtilis No. 20 strain constructed after knocking out the large fragment at positions 1431486-1435245 on the genome, or the strain obtained by deleting the mhqR gene, has significantly improved vanillin tolerance. The growth of the wild-type Bacillus subtilis 168 strain is severely inhibited under the condition of 2g / L vanillin, while the Bacillus subtilis No. 20 strain can tolerate 4.5g / L vanillin and grow normally. At the same time, through single gene knockout verification, it is found that the mhqR gene fragment knockout strain has a vanillin tolerance performance and growth curve comparable to that of the No. 20 strain.

[0024] The vanillin tolerant strain constructed by the present invention can provide a base strain with vanillin tolerance for the construction of vanillin production strains, laying a foundation for further achieving high vanillin production. Among them, the vanillin production strain constructed with Bacillus subtilis No. 20 strain as the base strain has a vanillin production yield of about 37% higher than that of the vanillin production strain constructed with Bacillus subtilis 168 strain as the base strain. Description of the drawings:

[0025] Figure 1 Tolerance of Bacillus subtilis 168 strain to vanillin

[0026] Among them, Figure (a) shows the growth curve of Bacillus subtilis 168 strain under different concentrations of vanillin;

[0027] Figure (b) shows the growth status of Bacillus subtilis 168 strain at 24 hours under different concentrations of vanillin.

[0028] Figure 2 Colony PCR verification of Bacillus subtilis strain 20

[0029] Among them, lane m is the marker, lane 1 is the wild-type 168 strain, and lanes 2-9 are the positive transformants of the recombinant bacteria.

[0030] Figure 3 Tolerance of Bacillus subtilis strain 20 to vanillin

[0031] Among them, Figure (a) shows the growth curves of Bacillus subtilis strain 168 and strain 20 under 2.5g / L vanillin;

[0032] Figure (b) shows the growth curve of Bacillus subtilis strain 20 under different concentrations of vanillin.

[0033] Figure 4 Vanillin and vanillic acid production of different recombinant strains.

[0034] Figure 5 Vanillin production graph of recombinant strains constructed using Bacillus subtilis strain 20 and wild-type strain 168 as chassis bacteria.

[0035] Figure 6 Vanillin tolerance growth curve of single gene knockout strain. Specific implementation method:

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0037] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0038] The following examples are detailed descriptions and explanations of the technical solutions of the present invention and are not intended to limit the present invention.

[0039] Table 1 Some primers and sequences involved in the embodiments of the present invention

[0040]

[0041]

[0042]

[0043] The Bacillus subtilis 168 strain in the present invention and the embodiments has been widely disclosed in the prior art, such as in the document "Harwood CR, Wipat A. Sequencing and functional analysis of the genome of Bacillus subtilis strain 168. FEBS Lett. 1996 Jun 24; 389(1):84-7. doi:10.1016 / 0014-5793(96)00524-8. PMID:8682212." It is also a commonly used model bacteria in the field of biotechnology and can be obtained by the public from the Enzymology and Metabolic Engineering Laboratory of Beijing Institute of Technology.

[0044] The present invention is further explained below by means of specific examples.

[0045] Example 1: Tolerance of Bacillus subtilis 168 strain to vanillin

[0046] This example is used to illustrate the tolerance of Bacillus subtilis 168 strain to vanillin.

[0047] Prepare seed solution: Take out the frozen bacteria of Bacillus subtilis 168 strain stored in a -80℃ refrigerator, place it in an ice box or on ice to let it thaw, and use an inoculation loop to dip a small amount of bacterial solution on a solid LB medium in a clean bench for streaking. Then place it in a 30℃ incubator and culture it at a constant temperature overnight until a single colony grows. A single colony was randomly picked from the plate and inoculated into 20 mL of fresh LB medium and cultured overnight in a shaker at 37°C and 220 rpm as a seed; a culture medium with a vanillin concentration gradient was set up in a sterilized 96-well plate: 1 ml of LB medium was added to the well, and a vanillin aqueous solution was added to make the final concentrations reach 0 g / L (control group), 0.5 g / L, 1 g / L, 1.5 g / L, 2 g / L, 2.5 g / L, 3 g / L, 3.5 g / L, 4 g / L, 4.5 g / L, and 5 g / L, respectively; inoculation and detection: the seed solution was inoculated into the culture medium of each concentration gradient, and the initial OD was ensured to be 600 =0.05, and cultured in a shaker at 37°C and 220 rpm. Within the first 12 hours, 200 μL of samples were taken every four hours to measure OD 600 After 12 hours, take samples and measure OD again at 12-hour intervals. 600 .

[0048] The results are as follows Figure 1As shown in (a), under the growth pressure brought by vanillin, the growth was relatively slow within 8 hours after inoculation. By comparing the growth state of the strain at different concentrations at the same time, it can be found that the density of the strain decreases with the increase of the initial concentration of vanillin, and high concentrations of vanillin completely inhibit the growth of the strain. Figure 1 (b) shows that at 24 h, the growth of Bacillus subtilis 168 strain was severely inhibited when the vanillin concentration reached 2 g / L, and it did not grow at all when the vanillin concentration reached 2.5 g / L.

[0049] After determining the tolerance of Bacillus subtilis 168 strain to vanillin, a concentration of 2.5 g / L, which can completely inhibit the growth of the strain, was used as a screening condition to try to find a fragment deletion mutant strain that performed better in terms of vanillin tolerance.

[0050] Example 2: Construction of Bacillus subtilis Bs-20

[0051] This example is used to illustrate the construction method of Bacillus subtilis 20.

[0052] (1) In this example, Bacillus subtilis 168 strain was used as the starting strain, and a large fragment of 3760 bp in length from kinD to motA (as shown in the sequence table SEQ ID NO.1, located at the 1431486 bp-1435245 bp sequence on the Bacillus subtilis 168 genome NC_000964.3) was deleted to obtain Bacillus subtilis 20 strain, hereinafter referred to as Bs-20 strain.

[0053] The region from 1431486bp to 1435245bp on the genome of Bacillus subtilis strain 168 contains genes and their functions are as follows:

[0054] Table 2

[0055] Gene name Starting position / bp End position / bp Gene size / bp Gene ID Protein function kinD 1431486 1433006 1520 939300 Histidine kinase phosphorylation mxDV 1433199 1433636 437 939303 Transcriptional regulator (MarR) motB 1433676 1434461 785 939304 Motor protein B: the motB component of flagellar components motA 1434433 1435245 812 939302 Motor protein A: the motA component of flagella

[0056] Targeting the above-mentioned genomic fragments, CRISPR / Cas9 technology was used to construct a large fragment deletion strain Bs-20 based on the Bacillus subtilis 168 strain.

[0057] (2) Construction of CRISPR / Cas9 editing plasmid: The double N20 method was used to knock out the target gene.

[0058] The target gene sequence (1431486bp-1435245bp) was input into the Zhang Feng laboratory website (https: / / zlab.bio / guide-design-resources) to predict the N20 efficiency, and two N20 sequences, N20-1 and N20-2, were determined. Among them, the sequence of N20-1 is: ctccttcaggcattgactcg; the sequence of N20-2 is: tgagcccattcagagaacat.

[0059] In order to introduce two N20s into the editing plasmid at the same time, primers Δ20-N20-1-1, Δ20-N20-1-2, Δ20-N20-2-1, and Δ20-N20-2-2 were designed, with N20-1 used as the overlapping region (overlap) of Δ20-N20-1-1 and Δ20-N20-1-2; and N20-2 used as the overlapping region (overlap) of Δ20-N20-2-1 and Δ20-N20-2-2.

[0060] Using plasmid pJOE-8999 as a template, the editing plasmid pJOE-8999 was linearized by PCR reaction using primers CasA and CasB as well as Δ20-N20-1-1, Δ20-N20-1-2, Δ20-N20-2-1, and Δ20-N20-2-2, wherein CasA and Δ20-N20-1-1 were primers for amplifying the plasmid backbone, and the PCR fragment size was 2270 bp; CasB and Δ20-N20-1-2 were primers for introducing N20-1, and the PCR fragment size was 2309 bp; Δ20-N20-2-2 and Δ20-N20-2-1 were primers for introducing N20-2, and the PCR fragment size was 3011 bp. N20-1 and N20-2 were introduced into plasmid pJOE-8999 to construct the knockout plasmid pJOE-8999-N20.

[0061] The PCR reaction system is as follows:

[0062]

[0063] According to the reaction system shown in the above table, the PCR reaction system of the plasmid backbone linear fragment 20-1, the linear fragment 20-2 introduced into N20-1 and the linear fragment 20-3 introduced into N20-2 were respectively prepared in the corresponding PCR tubes, and after shaking and mixing, the tubes were placed in a PCR instrument for PCR reaction. The PCR reaction procedure is as follows:

[0064]

[0065] (3) After the three PCR systems were completed, linear fragments 20-1, 20-2 and 20-3 were obtained. After agarose gel electrophoresis, they were compared with DNA markers to obtain the target size bands in the above table. The remaining reaction products in the PCR tubes were recovered for DNA recovery to obtain purified linear fragments 20-1, 20-2 and 20-3.

[0066] (4) The three purified DNA fragments were connected, and ligase and 2 μL ddHO were added to the PCR tube. 2 O, 1μL 20-1, 1μL 20-2, 1μL 20-3, mix well with a pipette tip and put into a 50℃ constant temperature water bath for connection. The connection time is half an hour. The product after connection is pJOE-8999-N20 with N20-1 and N20-2 introduced.

[0067] (5) After the ligation, 10 μL of the product was transferred into 100 μL of JM109 competent cells using a pipette, placed on ice, and placed in an ice bath for 25 min. After the ice bath, the centrifuge tube was placed in a 42°C water bath for heat shock for 1 min 30 s. After the heat shock, the centrifuge tube was placed back on ice for an ice bath for 2 min. After the ice bath, 900 μL of SOC medium was added to the centrifuge tube, which was then placed in a 37°C shaker. After 45 min of recovery at 220 r, the tube was coated with a kanamycin-resistant plate, and the plate was placed in a 37°C constant temperature incubator for overnight growth.

[0068] (6) The next day, the colonies on the plate were verified by PCR (the verification primers were Δ20-Test-1 and Δ20-Test-2), and a band of about 1 kb was obtained, indicating that N20 was successfully introduced. A single colony of the strain successfully introduced into N20 was picked and inoculated into a 5 ml sterilized shake tube, 5 ml of LB medium and 5 μL of kanamycin were added, and the tube was placed in a 37°C shake tube for overnight culture. The next day, the plasmid was extracted using the TIANGEN plasmid extraction kit to obtain pJOE-8999-N20.

[0069] (7) Plasmid pJOE-8999-N20 is used for the insertion of homology arms. Plasmid pJOE-8999-N20 is used as a template. The linear fragment N20-G of the double N20 backbone is first amplified, and the repair template is introduced on this basis. Using the genome of Bacillus subtilis 168 as a template, primers Δ20-HA-1 and Δ20-HA-2 and Δ20-HA-3 and Δ20-HA-4 are used for PCR amplification to obtain the upstream and downstream homology arms (20-5HA, 20-3HA) of the 3760bp gene to be knocked out (the fragment from kinD to motA on the genome), and Overlap PCR is used to splice the upstream and downstream homology arms together to form a repair template. The PCR reaction system is as follows:

[0070]

[0071] According to the table above, the PCR reaction system of the linear fragment N20-G of the double N20 backbone, the repair template 20-5HA and the repair template 20-3HA were respectively prepared in the corresponding PCR tubes, and after oscillation and mixing, the mixture was placed in the PCR instrument for PCR reaction. The PCR reaction procedure of N20-G is as follows:

[0072]

[0073]

[0074] The PCR reaction system for 20-5HA and 20-3HA is as follows:

[0075]

[0076] (8) After the three PCR systems were completed, linear fragments of N20-G, 20-5HA and 20-3HA were obtained. After agarose gel electrophoresis, they were compared with DNA markers to obtain the target size bands in the above table. The remaining reaction products in the PCR tubes were subjected to DNA recovery to obtain purified linear fragments of N20-G, 20-5HA and 20-3HA.

[0077] (9) The three purified DNA fragments were connected, and ligase and 2 μL ddHO were added to the PCR tube. 2 O, 1μL N20-G, 1μL 20-5HA, 1μL 20-3HA, mix well with a pipette tip and put into a 50℃ constant temperature water bath for connection. The connection time is half an hour. The product after connection is named knockout plasmid pCas20.

[0078] (10) After the ligation, 10 μL of the product was transferred into 100 μL of JM109 competent cells using a pipette and placed on ice for 25 min. After the ice bath, the centrifuge tube was placed in a 42°C water bath for heat shock for 1 min 30 s. After the heat shock, the centrifuge tube was placed back on ice for 2 min. After the ice bath, 900 μL of SOC medium was added to the centrifuge tube, which was then placed in a 37°C shaker and revived at 220 r for 45 min. After that, the tube was coated with a kanamycin-resistant plate and placed in a 37°C constant temperature incubator for overnight growth.

[0079] (11) The next day, the colonies on the plate were verified by PCR (the verification primers were HA-5 and HA-3), and a band of about 2402 bp was obtained, indicating that the repair template was successfully introduced. A single colony of the strain that successfully introduced the repair template was picked and inoculated into a 5 ml sterilized shaking tube, 5 ml of LB medium and 5 μL of kanamycin were added, and the tube was placed in a 37 ° C shaking tube for overnight culture. The next day, the plasmid was extracted using the TIANGEN plasmid extraction kit to obtain the knockout plasmid pCas20.

[0080] (12) CRISPR / Cas9 induction and editing: 10 μL of the constructed editing plasmid pCas20 was transferred into Bacillus subtilis 168 competent cells using a pipette. After resuscitation at 220 rpm in a 37°C shaker for 1 h, the cells were spread on LB plates containing 20 μg / mL kanamycin resistance and 0.2% mannose and cultured in a 30°C incubator overnight.

[0081] (13) Detection of CRISPR / Cas9 gene editing results: On the LB editing plate containing kanamycin and mannose, single colonies were randomly selected, and positive clones were screened by colony PCR using two pairs of inner and outer primers designed for the missing gene fragment. Sanger sequencing was performed to further verify the genome editing. The PCR reaction system is as follows:

[0082]

[0083]

[0084] The PCR reaction system is as follows:

[0085]

[0086] The PCR products were subjected to agarose gel electrophoresis. If the same colony could not obtain a band within 20-, but could obtain a band outside 20- and the band size was 2.15 kb, the colony was successfully edited. Figure 2 As shown, Figure 2 The upper figure shows the band 20-outer obtained by PCR using primers outside the homology arm, and the lower figure shows the band 20-inner obtained by PCR using primers inside the homology arm. The first lane is a marker, and the second to tenth lanes are the single colony PCR results of the Bs-20 knockout strain. Figure 2 The results showed that when PCR was performed on 9 single colonies of the Bs-20 knockout strain, a 20-outer fragment of 2.15 kb was obtained, while a 20-inner fragment could not be obtained, indicating that these colonies were successfully edited.

[0087] (14) Elimination of the editing plasmid: After the gene editing is successfully completed, the editing plasmid in the bacteria needs to be eliminated for subsequent gene manipulation. Since the editing plasmid carries the temperature-sensitive Bacillus subtilis replication start point pE194ts, the loss of the editing plasmid can be achieved by increasing the culture temperature of Bacillus subtilis. Pick the correctly edited positive mutant and inoculate it into the antibiotic-free LB liquid culture medium, and place it in a shaker at 50°C and 220rpm for overnight culture. Dip an appropriate amount of bacterial liquid with a sterilized inoculation loop, streak it on the antibiotic-free LB agar plate, and place it at 42°C for constant temperature culture until a single colony grows. The single colony is inoculated into the LB liquid culture medium containing kanamycin and the antibiotic-free LB culture medium at the same time to verify whether the plasmid has been eliminated. When the same colony grows normally on the antibiotic-free LB plate but cannot grow on the kanamycin LB plate, the colony has successfully lost the editing plasmid. After discarding the plasmid, the obtained strain was named Bacillus subtilis strain 20 (referred to as Bs-20 strain) and stored in a -80°C refrigerator.

[0088] Example 3: Study on the tolerance of Bacillus subtilis strain 20 to vanillin

[0089] This example is used to illustrate that Bacillus subtilis strain No. 20 can tolerate high concentrations of vanillin.

[0090] (1) Vanillin-tolerant strain No. 20: Take out the frozen bacteria of Bacillus subtilis No. 20 and Bacillus subtilis 168 stored in a -80℃ refrigerator, place them in an ice box or on ice to let them thaw, use an inoculation loop to dip a small amount of bacterial solution in the clean bench, and streak the plates on the solid culture medium. Then place them in a 30℃ incubator and culture them at a constant temperature overnight until a single colony grows. Randomly pick a single colony from each plate and inoculate it in 20mL of fresh LB culture medium and culture it in a shaker at 37℃ and 220rpm overnight as the seed liquid. Randomly pick a single colony from the plate and inoculate it in 20mL of fresh LB culture medium and culture it in a shaker at 37℃ and 220rpm overnight as the seed liquid. Add 20ml of LB liquid culture medium to the shake flask, and add vanillin aqueous solution to make the final concentration reach 2.5g / L. Inoculate the seed liquid into the culture medium with a vanillin concentration of 2.5g / L to make its initial OD 600 =0.05, 37°C, 220rpm shaker culture, sample and test. Within the first 12 hours, sample 200 μL every three hours to measure OD 600 After 12 hours, take samples every 9 hours and measure OD again 600 If the bacterial solution is too concentrated, it needs to be diluted a certain number of times. Three parallel experiments are set up for each experimental group, and a blank control is set up as a whole.

[0091] The results are as follows Figure 3As shown in (a), Bacillus subtilis strain 20 can grow normally in the presence of 2.5 g / L vanillin, i.e., a vanillin-tolerant strain is obtained. However, the wild-type Bacillus subtilis strain 168 does not grow at all in the presence of 2.5 g / L vanillin.

[0092] (2) Vanillin tolerance of vanillin-tolerant strain No. 20: According to the test method of step (1), the vanillin concentrations were set to 2.5 g / L, 3 g / L, 3.5 g / L, 4 g / L, 4.5 g / L, and 5 g / L, respectively, and the tolerance of strain No. 20 to different concentrations of vanillin was measured. The results are as follows: Figure 3 (b) as shown.

[0093] Depend on Figure 3 (b) It can be seen that the No. 20 strain can grow normally when the vanillin concentration is 4g / L, the growth begins to be inhibited at 4.5g / L, and the growth is completely inhibited at 5g / L. The No. 20 vanillin tolerant strain can tolerate 4.5g / L vanillin.

[0094] Example 4: Deletion of fragment 20 (1431486 bp-1435245 bp) can increase the production of vanillin and vanillin precursor vanillic acid

[0095] This example is used to illustrate that the knockout of fragment 20 of Bacillus subtilis is beneficial to the production of vanillin and its precursor vanillic acid.

[0096] (1) The recombinant chassis Bs-11VA of Bacillus subtilis constructed in our laboratory was used as the starting chassis. Bs-11VA was obtained by knocking out the 1102560bp-1107516bp, VdhT gene (Gene ID: 938788) and aroK gene (Gene ID: 938343) on the genome of Bs-168 as the starting strain. On this basis, fragment 20 (the sequence of the 1431486bp-1435245bp on the genome, the specific knockout method is shown in Example 2) was knocked out to obtain the Bs-11VA20 strain, which was used as the chassis strain for the subsequent construction of the production strain.

[0097] (2) Construction of the plasmid pSDCC for the metabolic pathway from shikimic acid to vanillin: To synthesize vanillin from shikimic acid, it is necessary to express the shikimate dehydrogenase gene sdh from Eucalyptus camaldulensis (GenBank: BBL52470.1), the 3-dehydroshikimate dehydratase gene dsd from Sporangium boydii (GenBank: VBB81286.1), the catechol methyltransferase gene comt from Vanilla foetida (GenBank: AAS64572.1), and the carboxylic acid reductase gene car from Carnotia paniculata (GenBank: AAR91681.1).

[0098] Gene sequence fragments of sdh, dsd, comt and car were obtained by gene synthesis, and the above genes were constructed on the pUC-19 plasmid to obtain the vanillin production plasmid pSDCC of the shikimic acid pathway. They were transformed into Bs-11VA and Bs-11VA20 to obtain two vanillin production strains of the shikimic acid pathway, namely Bs-11VA-SDCC and Bs-11VA20-SDCC (see Example 4 for the specific construction steps, just replace the corresponding primers, and see Table 1 for the specific primers).

[0099] (3) Take out Bs-11VA-SDCC and Bs-11VA20-SDCC stored in a -80℃ refrigerator, place them in an ice box or on ice and wait for them to melt, use an inoculation loop to dip a small amount of bacterial solution in the clean bench, and streak the plates on the solid culture medium. Then place them in an incubator at 30℃ and culture them overnight at a constant temperature until a single colony grows. Randomly pick a single colony from each plate and inoculate it in 20mL of fresh LB culture medium and culture it in a shaking incubator at 37℃ and 220rpm overnight as seed liquid. Add 20mL of culture medium, 20mL of kanamycin and 200μL of seed liquid to the shake flask, respectively, and culture it in a shaking incubator at 37℃ and 220rpm overnight. Set up a blank control and three parallel experiments for each group of experiments. After 8h, add the substrate shikimic acid to make its final concentration 3mM. Take samples every 24h to detect the vanillin production of the fermentation broth.

[0100] (4) The results are as follows Figure 4 As shown, the yield of vanillin produced by Bs-11VA-SDCC from shikimic acid was 0.218mM, with a conversion rate of 7.3%; the yield of vanillic acid produced by shikimic acid was 0.223mM, with a conversion rate of 7.4%. The yield of vanillin produced by Bs-11VA20-SDCC from shikimic acid was 0.3mM, with a conversion rate of 10%; the yield of vanillic acid produced by shikimic acid was 0.503mM, with a conversion rate of 16.8%. This shows that the knockout of Bacillus subtilis fragment 20 is beneficial to the production of vanillin and vanillic acid.

[0101] It also shows that in addition to the fact that knocking out the 20th fragment on the basis of Bs-168 can improve the production capacity of vanillin, knocking out the 20th fragment on the basis of other Bacillus subtilis can also improve the production capacity of vanillin and its precursors / derivatives. Example 5: Construction of vanillic acid production strains using wild-type Bacillus subtilis 168 and Bacillus subtilis strain 20 In this example, the 20th strain of Bacillus subtilis Bs-20 and the Bacillus subtilis 168 strain Bs-WT were used as base bacteria, respectively, and the production pathway from ferulic acid to vanillin was first established, and then the endogenous alcohol dehydrogenase VdhT of Bacillus subtilis was used to oxidize vanillin to vanillic acid, thereby obtaining the vanillic acid production strains Bs-20-EF and Bs-WT-EF.

[0102] The specific construction method is as follows:

[0103] (1) Construction of a plasmid for vanillin production using ferulic acid as a substrate: The gene fcs of feruloyl-CoA synthetase (Fcs) from Amycolatopsis spp. and the gene ech of feruloyl-CoA hydratase (Ech) from Pseudomonas fluorescens were selected to construct a vanillin production pathway using ferulic acid as a substrate. The sequences of the gene fcs (NCBI RefSeq: WP_020422604.1) and the gene ech (GenBank: AAZ23790.1) were obtained from NCBI, and the gene sequence fragments of ech and fcs were obtained by gene synthesis. The vanillin production plasmid pBAPEF was constructed by Gibson ligation of ech, fcs and pUC-19. The PCR reaction system is as follows:

[0104]

[0105]

[0106] According to the above table, the PCR reaction system for amplifying the linear fragment EF-G of the plasmid backbone, the Ech fragment containing the ech gene, and the Fcs fragment containing the fcs gene was respectively configured in the corresponding PCR tubes, and after oscillation and mixing, the tubes were placed in a PCR instrument for PCR reaction. The PCR reaction procedure is as follows:

[0107]

[0108] (2) After the three PCR systems were completed, the EF-G, Ech and Fcs fragments were obtained, which were subjected to agarose gel electrophoresis and compared with DNA markers to obtain the target size bands shown in the above table.

[0109] (3) The remaining reaction products in the PCR tube are subjected to DNA recovery to obtain purified linear fragments of the DNA amplification products, namely EF-G, Ech and Fcs.

[0110] (4) The three purified DNA fragments were connected: ligase, 2 μL ddH2O, 1 μL EF-G, 1 μL Ech, and 1 μL Fcs were added to the PCR tube. The mixture was mixed by blowing with a pipette tip and then placed in a 50°C constant temperature water bath for connection. The connection time was half an hour. The connected product was named plasmid pBAPEF.

[0111] (5) Transfer the ligated product into 100 μL JM109 competent cells: Transfer all 10 μL of the ligated product into 100 μL competent cells, place on ice, and place in an ice bath for 25 min. After the ice bath, place the centrifuge tube in a 42°C water bath for heat shock for 1 min 30 s. After the heat shock, place the centrifuge tube back on ice for an ice bath for 2 min. After the ice bath, add 900 μL SOC medium to the centrifuge tube, then place in a 37°C shaker, resuscitate at 220 rpm for 45 min, and then apply kanamycin resistance plates. Place the plates in a 37°C constant temperature incubator for overnight growth.

[0112] (6) The next day, a single colony was picked for PCR to verify whether the plasmid was successfully constructed. The PCR reaction system is as follows:

[0113]

[0114] According to the table above, a PCR reaction system for verifying whether the plasmid is successfully constructed is configured in a PCR tube. After oscillation and mixing, the tube is placed in a PCR instrument for PCR reaction. The PCR reaction procedure is as follows:

[0115]

[0116] After the PCR reaction was completed, agarose gel electrophoresis was performed and the bands were compared with the DNA Marker to obtain the correct target bands in the above table, indicating that the vanillin production plasmid pBAPEF was successfully constructed.

[0117] (7) Take 10 μL of plasmid pBAPEF and transform it into 400 μL of competent cells of Bs-20 and Bs-WT (i.e., Bs-168), ice bath for 25 min, water bath at 42°C for 1 min 30s, and ice bath for 2 min, then add 1 ml of SOC medium and resuscitate at 37°C 220 rpm for 45 min, then evenly spread on LB plate with kanamycin, and place in a 37°C incubator for overnight culture. The next day, pick a single colony on the plate, shake it and store it at -80°C. Two vanillin production strains using ferulic acid as substrate were obtained, namely Bs-20-EF and Bs-WT-EF.

[0118] Example 6: Production of vanillic acid using vanillic acid producing strains

[0119] This example is used to illustrate that the knockout of fragment 20 helps to increase the yield of vanillin derivatives.

[0120] Take out the Bs-20-EF and Bs-WT-EF strains stored in a -80℃ refrigerator, place them in an ice box or on ice and wait for them to melt, dip a small amount of bacterial solution with an inoculation loop in the clean bench, and streak the plates on the solid culture medium. Then place it in an incubator at 30℃ and culture it overnight at a constant temperature until a single colony grows. Randomly pick a single colony from each plate and inoculate it in 20mL of fresh LB culture medium and culture it in a shaker at 37℃ and 220rpm overnight as seed liquid. Add 20ml of culture medium, 20μL of kanamycin and 200μL of seed liquid to the shake flask, respectively, and culture it in a shaker at 37℃ and 220rpm overnight. Set up a blank control and three parallels for each group of experiments. After 12h, add the substrate ferulic acid to a final concentration of 0.5g / L. Take samples every 12h to detect the vanillic acid yield of the fermentation broth.

[0121] The results are as follows Figure 5 As shown, at 60h, the yield of vanillic acid produced by Bs-WT-EF from ferulic acid was 0.240g / L, and the conversion rate was 0.48g / g, and the yield of vanillic acid produced by strain Bs-20-EF from ferulic acid was 0.323g / L, and the conversion rate was 0.65g / g. It can be seen that the No. 20 chassis constructed by the present invention is also suitable for the production of vanillic acid, a vanillin derivative.

[0122] Example 7: Study on the vanillin tolerance of Bacillus subtilis with mhqR gene knocked out.

[0123] In order to further verify whether the vanillin tolerance of strain No. 20 is caused by the deletion of a single gene, we used Bacillus subtilis 168 strain as the starting strain, and knocked out single genes respectively (the specific genes are shown in Table 2, and the KinD, mhqR, motB, and motA genes were knocked out respectively. The specific knockout method is shown in Example 2, and the corresponding primers can be replaced. The specific primers are shown in Table 1, and a single N20 knockout strategy is adopted) to construct Bs-ΔKinD strain, Bs-ΔmhqR strain, Bs-ΔmotA strain and Bs-ΔmotB strain, and the vanillin tolerance of the single gene knockout strain was tested (the determination method is the same as step Example 3), and the wild type 168 strain and Bs-20 strain were set as controls.

[0124] The experimental results are as follows Figure 6As shown in the figure, in the medium with a vanillin concentration of 2.5 g / L, the growth of wild-type Bacillus subtilis 168 was inhibited, and the growth of Bs-ΔKinD strain, Bs-ΔmotA strain and Bs-ΔmotB strain was the same as that of wild-type 168 strain, and all were inhibited. The Bs-ΔmhqR strain is a strain in which the transcriptional regulatory factor MarR has been knocked out. Like the Bs-20 strain, it can grow normally in the medium with a vanillin concentration of 2.5 g / L and the growth curve is basically consistent, indicating that the mhqR gene is the main factor that causes the Bs-20 strain to have vanillin tolerance.

[0125] The mhqR gene fragment of the present invention has Gene ID 939303, as shown in SEQ ID NO.2:

[0126] Atgacagaaaaatcactgaagttatttatcgtgctgtcgcgcgcgtatcggtctattaacgatcatatgaataagcatattcataagcatgggctgaatccgactgaat ttgctgtgctagagcttttgtaccataaaggcgatcagccgctgcagcagataggagataaaattctcttggctagcgggagcatcacatacgttgtagataagctggag caaaaagaacttctcattcggaaagcgtctcctacagacagacgagtgacatttgcgcaaattactgaaaaaggcatcggtcttttgaacgatattttccctgatcacgc tgctgaaattgatgaaatgatcagcgtattaagcgaagaagaggtagagatgtgcaccgaaatgttaaaaagagtaggattaaacgcaaaacagtttcataataagtaa.

[0127] The 3760 bp large fragment located at the 1431486 bp to 1435245 bp position on the Bacillus subtilis 168 genome of the present invention is shown in SEQ ID NO.1:

[0128]

[0129] Although the present invention has been disclosed as above in terms of preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various changes, modifications, substitutions and variations in form and details to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. A method for improving the vanillin tolerance of Bacillus subtilis, It is characterized in that The method is to improve vanillin tolerance by knocking out a fragment containing the mhqR gene on the genome of Bacillus subtilis.

2. A method for improving the vanillin tolerance of Bacillus subtilis as claimed in claim 1, It is characterized in that The fragment containing the mhqR gene is a fragment from kinD to motA on the genome of Bacillus subtilis, comprising kinD, mhqR, motB and motA genes.

3. A strain of Bacillus subtilis with high tolerance to vanillin, It is characterized in that The strain is Bacillus subtilis with a defective mhqR gene segment.

4. The Bacillus subtilis strain with high vanillin tolerance according to claim 3, It is characterized in that The starting strain of the Bacillus subtilis with high vanillin tolerance is Bacillus subtilis 168.

5. The Bacillus subtilis strain with high vanillin tolerance according to claim 3, It is characterized in that The mhqR gene fragment has Gene ID 939303, as shown in SEQ ID NO.

2.

6. The Bacillus subtilis strain with high vanillin tolerance according to claim 3, It is characterized in that The Bacillus subtilis strain with high vanillin tolerance is obtained by taking Bacillus subtilis 168 as the starting strain, and knocking out a 3760bp large fragment including the mhqR gene fragment on the genome, wherein the large fragment is located at positions 1431486-1435245 on the Bacillus subtilis 168 genome, as shown in SEQ ID NO.

1.

7. Use of the strain according to any one of claims 3 to 6 in the production of vanillin, a vanillin precursor, or a vanillin derivative.

8. The use according to claim 7, It is characterized in that The vanillin precursors include but are not limited to vanillic acid, vanillyl alcohol, protocatechuic acid, and protocatechuic aldehyde; the vanillin derivatives include but are not limited to ethyl vanillin and cinnamic acid.

9. Use of the strain according to any one of claims 3 to 6 in the construction of vanillin-tolerant chassis bacteria.

Images