A plasmid-free genetically engineered bacterium for efficiently synthesizing gamma-aminobutyric acid from scratch using a cheap carbon source as a substrate, method, and application thereof
By constructing a plasmid-free genetically engineered strain on Escherichia coli MG1655 and using CRISPR/Cas9 technology for targeted modification, multiple enzyme genes were overexpressed and metabolic pathways were dynamically regulated. This solved the stability and efficiency issues of GABA production in existing technologies and achieved efficient and inexpensive GABA synthesis.
Patent Information
- Application Number
- CN202510592031.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2045-05-09
AI Technical Summary
Existing GABA production strains rely on exogenous plasmids to express glutamate decarboxylase, which has problems such as poor plasmid stability, high cost of antibiotic use, and complex genetic background. It is difficult to meet the needs of industrial production. In addition, the metabolic flux of the synthesis pathway is unevenly distributed and the enzyme activity is greatly affected by the environment, resulting in low GABA synthesis efficiency.
A plasmid-free genetically engineered strain was constructed and modified in Escherichia coli MG1655 using CRISPR/Cas9 technology. The strain overexpressed the bacteriophage T7 RNA polymerase gene T7RNAP, deleted the GABA transaminase genes gabT and puuE, overexpressed the GABA transporter protease gene gadC, the glutamate decarboxylase gene gadbm, and the glutamate dehydrogenase gene gdh, dynamically regulated the expression of 2-oxoglutarate dehydrogenase and N-acetyltransferase genes, and used glucose as a cheap carbon source for fermentation.
The fermentation process is independent of exogenous plasmids and antibiotics, and the production performance is stable. The GABA yield reaches 35.4 g/L, and the sugar-acid conversion rate reaches 16.3%, which is the highest yield reported so far and has industrial application value.
Smart Images

Figure CN120098883B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to a plasmid-free genetic engineering bacterium that efficiently synthesizes gamma-aminobutyric acid from scratch using a cheap carbon source as a substrate, as well as a method and application thereof. Background Art
[0002] γ-Aminobutyric acid (GABA) is a non-protein amino acid that is widely present in nature. It plays a crucial role as a neurotransmitter, particularly in the central nervous system of mammals. GABA inhibits neuronal overexcitation and maintains balance in the nervous system, exhibiting numerous physiological functions, including anti-anxiety, anti-depression, and sleep promotion. Furthermore, GABA has extensive applications in food, medicine, and health supplements. For example, in the food industry, GABA is used as a functional food additive, boasting benefits such as lowering blood pressure and improving sleep quality. In medicine, GABA and its derivatives are used to treat neurological disorders such as epilepsy, anxiety, and insomnia. With the increasing market demand for GABA, the development of efficient and low-cost GABA production processes has become a research hotspot.
[0003] GABA production methods mainly include chemical synthesis, plant extraction, and microbial fermentation. Chemical synthesis was the earliest method used in GABA production, and it mainly synthesizes GABA under high temperature and high pressure conditions using chemical reagents. However, chemical synthesis has problems such as harsh reaction conditions, serious environmental pollution, and many by-products, which limit its industrial application. Plant extraction is to extract natural GABA from GABA-rich plants. Although this method is environmentally friendly and the product is natural, it is limited by the source of raw materials and extraction efficiency, making it difficult to meet the needs of large-scale production. In contrast, microbial fermentation has the advantages of a wide range of raw material sources, low production costs, and environmental friendliness, making it an ideal method for achieving industrial production of GABA.
[0004] The core of microbial fermentation for GABA production is to utilize glutamate decarboxylase (GAD) in microorganisms to convert glutamate into GABA. Glutamate decarboxylase is an enzyme that depends on pyridoxal phosphate (PLP) and is widely found in microorganisms such as lactic acid bacteria, Escherichia coli, and yeast. In recent years, with the rapid development of metabolic engineering and synthetic biology, genetic engineering of microorganisms to increase GABA production has become a research hotspot. For example, in 2005, Park et al. successfully increased GABA production to 10.2 g / L by overexpressing the glutamate decarboxylase gene from lactic acid bacteria in Escherichia coli (Applied Microbiology and Biotechnology, 2005, 68(6): 765-770.). In 2012, Li et al. further increased GABA production to 25.8 g / L by knocking out the GABA transporter gene and overexpressing the glutamate decarboxylase gene in Escherichia coli (Metabolic Engineering, 2012, 14(6): 560-568.). These studies have shown that the production efficiency of GABA can be significantly improved by optimizing the metabolic pathways of microorganisms through genetic engineering.
[0005] However, most current GABA-producing strains rely on exogenous plasmids expressing the glutamate decarboxylase gene. This poses challenges such as poor plasmid stability, high antibiotic costs, and complex genetic backgrounds, hindering industrial production. To address these issues, researchers have recently begun exploring methods for constructing plasmid-free genetically engineered strains. For example, in 2018, Zhang et al. constructed a plasmid-free GABA-producing strain by integrating the glutamate decarboxylase gene into the Escherichia coli chromosome, achieving a GABA yield of 18.5 g / L (Biotechnology for Biofuels, 2018, 11: 238). Furthermore, using gene-editing technologies such as CRISPR-Cas9, researchers can precisely manipulate microbial metabolic pathways, further improving GABA production and sugar-to-acid conversion efficiency. For example, in 2020, Wang et al. used CRISPR-Cas9 technology to knock out the by-product synthesis gene in Escherichia coli and overexpressed the glutamate decarboxylase gene, increasing the GABA production to 27.8 g / L (Microbial Cell Factories, 2020, 19: 123.).
[0006] Although genetic engineering technology has made significant progress in the construction of GABA-producing strains, most current research is still limited to laboratory scale and cannot meet the needs of industrial production. The main problems include: (1) the uneven distribution of metabolic flux in the GABA synthesis pathway, resulting in the accumulation of intermediate metabolites and the formation of by-products; (2) the activity of glutamate decarboxylase is greatly affected by factors such as pH and temperature, which limits the efficient synthesis of GABA; (3) during industrial production, the genetic stability and production activity of the strain are difficult to maintain. Therefore, the development of a plasmid-free genetically engineered strain that can efficiently synthesize GABA from scratch using an inexpensive carbon source as a substrate has important scientific significance and application value.
[0007] Through searching, no patent publication documents related to the patent application of the present invention have been found. Summary of the Invention
[0008] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a plasmid-free genetically engineered bacterium that can efficiently synthesize γ-aminobutyric acid from scratch using a cheap carbon source such as glucose as a substrate, as well as a method and application.
[0009] The technical solution adopted by the present invention to solve its technical problem is:
[0010] A plasmid-free genetically engineered bacterium that efficiently synthesizes γ-aminobutyric acid from scratch using a cheap carbon source as a substrate is described. The genetically engineered bacterium is based on wild-type Escherichia coli E. coli MG1655 and overexpresses the phage-derived T7 RNA polymerase gene T7RNAP, which is driven by a xylose promoter P xylF Control; GABA transaminase genes gabT and puuE were deleted; the endogenous GABA transporter protease gene gadC of Escherichia coli was overexpressed; the glutamate decarboxylase gene gad from Bacillus megaterium was overexpressed bm ; Overexpression of the glutamate dehydrogenase gene gdh (cgl2079) from Corynebacterium glutamicum; Overexpression of the endogenous citrate synthase gene gltA from Escherichia coli; Overexpression of the pyruvate carboxylase gene pyc (cgl0689) from Corynebacterium glutamicum; Overexpression of the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli; Use of three growth-coupled promoters, namely P rpst 、P rpsl 、P rrnc Dynamically regulate the 2-oxoglutarate dehydrogenase gene sucA and the amino acid N-acetyltransferase gene argA in the GABA production pathway of Escherichia coli.
[0011] Furthermore, some genes have been registered in Gene Bank, and those skilled in the art can obtain these genes by PCR. For example, the gabT gene is Gene ID 948067, the puuE gene is Gene ID 945446, the gadC gene is Gene ID 946057, and the gad bm The gene is KT895523.1, the gdh gene is Gene ID 1020031, the gltA gene is Gene ID 945323, the pyc gene is Gene ID 1019553, the ppc gene is Gene ID 948457, the sucA gene is Gene ID 945303, and the argA gene is Gene ID 947289;
[0012] The sequence of the T7 RNA polymerase gene is SEQ ID NO.1; the xylose promoter P xylF The sequence is SEQ ID NO.2; among the three growth-coupled promoters, P rpst The sequence is SEQ ID NO.3, P rpsl The sequence is SEQ ID NO.4, P rrnc The sequence is SEQ ID NO.5.
[0013] The method for constructing the genetically engineered bacteria as described above uses CRISPR / Cas9-mediated gene editing technology to perform targeted modification on the E. coli MG1655 genome.
[0014] Furthermore, the specific steps are as follows:
[0015] (1) The RNA polymerase gene T7RNAP from T7 phage was integrated into the lacI-lacZ site of the E. coli MG1655 genome, and the RNA polymerase gene T7RNAP was driven by the xylose promoter P xylF control;
[0016] (2) Knockout of the GABA transaminase gene gabT;
[0017] (3) Knockout of the GABA transaminase gene puuE;
[0018] (4) Integrate the endogenous GABA transporter protease gene gadC of Escherichia coli into the pseudogene site yjgX, and trc promoter control;
[0019] (5) Integrate the endogenous glutamate decarboxylase gene gad from Bacillus megaterium at the pseudogene site yciQ bm , by P T7 promoter control;
[0020] (6) The glutamate dehydrogenase gene gdh (cgl2079) from Corynebacterium glutamicum was integrated into the pseudogene site mbhA, driven by the strong promoter P trc control;
[0021] (7) The endogenous citrate synthase gene gltA from Escherichia coli was integrated into the pseudogene site ylbE, and the P trc promoter control;
[0022] (8) The pyruvate carboxylase gene pyc (cgl0689) from Corynebacterium glutamicum was integrated into the pseudogene site yghE. trc promoter control;
[0023] (9) Integrate the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli into the pseudogene site gapC;
[0024] (10) Using three growth-coupled promoters P rpst 、P rpsl 、P rrnc Replace the natural promoter of the 2-oxoglutarate dehydrogenase gene sucA;
[0025] (11) Using three growth-coupled promoters P rpst 、P rpsl 、P rrnc Replaces the native promoter of the amino acid N-acetyltransferase gene argA.
[0026] The application of the genetically engineered bacteria as described above in the production of gamma-aminobutyric acid.
[0027] The method for producing gamma-aminobutyric acid by fermentation using the genetically engineered bacteria as described above increases the yield of gamma-aminobutyric acid through a staged pH fermentation control process.
[0028] Furthermore, the method is carried out using a fermentation culture method, wherein the fermentation culture includes shake flask fermentation or fermentation tank fermentation, and the specific operation steps are as follows:
[0029] During shake flask fermentation, the genetically engineered bacteria were first inoculated from a solid slant into a triangular flask containing a seed culture medium and cultured at 37°C and 220 rpm for 12 hours. The seed culture was then inoculated with 10-15% of the inoculum into a triangular flask containing a fermentation medium for fermentation and cultured at 37°C and 220 rpm for 24 hours. During the fermentation process, ammonia was added to maintain the pH between 6.5 to ensure normal growth of the bacteria. A 60% glucose solution was added as appropriate to maintain the normal fermentation process.
[0030] During fermentation in a fermenter, a bacterial liquid of the genetically engineered bacteria is taken and evenly spread on an activated slant, and subcultured; the strain on the activated slant is inoculated into a seed culture medium and cultured at 37°C for 8-10 hours, and ammonia water is added during the culture process to maintain the pH value at 7.0-7.2; the seed liquid is inoculated into the fermentation culture medium at an inoculum rate of 15-20%, and fermentation culture is started; the initial pH value of the fermentation is controlled at 7.0-7.2, and after 6-8 hours of fermentation, ammonia water is added to maintain the pH value at 6.3-6.5; after the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is fed to maintain the final mass concentration of residual sugar at 0.1-0.5%; the temperature is controlled at 37°C and the dissolved oxygen value is controlled at 15%-30% during the entire fermentation process, and the fermentation cycle is 38 hours to obtain gamma-aminobutyric acid.
[0031] Furthermore, the slant culture medium used for the solid slant and activated slant is: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast powder 5-8 g / L, NaCl 2.5-5 g / L, agar 20 g / L;
[0032] Alternatively, the seed culture medium is: glucose 25-30 g / L, KH2PO4 1.2-1.5 g / L, MgSO4 0.5-1.0 g / L, yeast powder 5-8 g / L, FeSO4 10-12 mg / L, MnSO4 10-12 mg / L, peptone 3-5 g / L, VB1, VB3, VB5, VB 12 、V H 1.3-2.5 mg / L each; pH 7.0-7.5, 121°C, high pressure steam sterilization for 20 min;
[0033] Alternatively, the fermentation medium is: glucose 20-25 g / L, xylose 5-10 g / L, KH2PO4 2.5-5.0 g / L, MgSO4·7H2O 1.2-2.0 g / L, yeast powder 4-8 g / L, FeSO4 20-24 mg / L, MnSO4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, VB1, VB3, VB5, VB 12 、V H 2-4 mg / L each, VB6 50 mg / L; pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min.
[0034] The advantages and positive effects achieved by the present invention are:
[0035] 1. The present invention designs a reasonable metabolic modification strategy. By deleting the endogenous GABA transaminase genes gabT and puuE, the branch metabolism of GABA decomposition into succinic semialdehyde is blocked; the GABA transporter gene gadC is overexpressed to increase the GABA transmembrane transport rate and reduce product feedback inhibition; the glutamate decarboxylase gene gadC from Bacillus megaterium is overexpressed to reduce the product feedback inhibition. bm The enzyme has high enzymatic activity at near-neutral pH. Overexpression of the glutamate dehydrogenase gene gdh from Corynebacterium glutamicum enhanced the supply of the precursor glutamate. Overexpression of the citrate synthase gene gltA from Escherichia coli increased TCA cycle flux. Overexpression of the pyruvate carboxylase gene pyc from Corynebacterium glutamicum replenished oxaloacetate through pyruvate carboxylation, maintaining TCA cycle intermediate homeostasis and driving 2-oxoglutarate synthesis. Dynamic regulation of the 2-oxoglutarate dehydrogenase gene sucA and the N-acetyltransferase gene argA coupled their expression to growth, resulting in normal expression during bacterial growth and weakened expression during product synthesis, thus reducing the metabolic diversion of 2-oxoglutarate and glutamate. This combined metabolic engineering strategy established an efficient metabolic network for the flow of glucose and xylose to GABA in E. coli, providing innovative ideas for the construction of GABA fermentation production strains in E. coli.
[0036] 2. The present invention finely regulates the enzyme expression intensity of key metabolic nodes in the GABA anabolic network. For example, the T7 RNA polymerase-T7 promoter system is used to control the expression of glutamate decarboxylase, and the Trc promoter is used to control the expression of GABA transporter, glutamate dehydrogenase, citrate synthase and pyruvate carboxylase; a growth-coupled promoter is used to control the expression of 2-oxoglutarate dehydrogenase and N-acetyltransferase; these expression controls achieve metabolic balance, ensuring normal growth of the bacteria while directing more carbon metabolism to target product synthesis, thereby increasing the utilization rate of carbon atoms.
[0037] 3. The genetic manipulations involved in constructing the engineered γ-aminobutyric acid (GABA) bacteria of the present invention are all performed on the genome, leaving no plasmid residues, and requiring no antibiotics or inducers. The resulting strain exhibits stable production performance and a simple fermentation process. Using this engineered GABA strain, fermented for 38 hours under suitable conditions, without the addition of glutamate, and relying solely on inexpensive carbon sources such as glucose, the GABA yield can reach 35.4 g / L, with a sugar-to-acid conversion rate of 16.3%. This represents the highest reported yield of de novo GABA synthesis by Escherichia coli and demonstrates promising industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] Figure 1 This is a diagram of the metabolic transformation strategy of the γ-aminobutyric acid genetically engineered bacteria of the present invention;
[0039] Figure 2 This is the electrophoresis diagram for the construction and verification of the T7RNAP gene integration fragment in the present invention; wherein, M—1kb DNA Marker; 1—upstream homology arm; 2—downstream homology arm; 3—target gene; 4—overlapping fragment; 5—original bacteria PCR fragment; 6—positive single colony PCR identification fragment;
[0040] Figure 3 This is the electrophoresis diagram for the construction and verification of the gabT gene knockout fragment in the present invention; where M is a 1 kb DNA marker; 1 is an upstream homology arm; 2 is a downstream homology arm; 3 is an overlapping fragment; 4 is a PCR fragment of the original bacteria; 5 is a positive single colony PCR identification fragment;
[0041] Figure 4 This is the electrophoresis diagram for the construction and verification of the puuE gene knockout fragment in the present invention; where M is a 1 kb DNA marker; 1 is an upstream homology arm; 2 is a downstream homology arm; 3 is an overlapping fragment; 4 is a PCR fragment of the original bacteria; 5 is a positive single colony PCR identification fragment;
[0042] Figure 5 In the present invention, yjgX:: P trc - Electrophoresis diagram of gadC gene integration fragment construction and verification; where M is a 1 kb DNA marker; 1 is an upstream homology arm; 2 is a downstream homology arm; 3 is the target gene; 4 is an overlapping fragment; 5 is a PCR fragment of the original bacteria; 6 is a positive single colony PCR identification fragment;
[0043] Figure 6 yciQ::P in the present invention T7 -gad bm Electrophoresis diagram of integrated fragment construction and verification; where M is 1 kb DNA marker; 1 is upstream homology arm; 2 is downstream homology arm; 3 is target gene; 4 is overlapping fragment; 5 is original bacterial PCR fragment; 6 is positive single colony PCR identification fragment;
[0044] Figure 7 mbhA::P in the present invention trc -gdh integration fragment construction and verification electrophoresis diagram; where M is 1 kb DNA marker; 1 is upstream homology arm; 2 is target gene; 3 is downstream homology arm; 4 is overlapping fragment; 5 is original bacteria PCR fragment; 6 is positive single colony PCR identification fragment;
[0045] Figure 8 ylbE::P in the present invention trc- Electrophoresis diagram of gltA integration fragment construction and verification; where M is 1 kb DNA marker; 1 is upstream homology arm; 2 is target gene; 3 is downstream homology arm; 4 is overlapping fragment; 5 is original bacterial PCR fragment; 6 is positive single colony PCR identification fragment;
[0046] Figure 9 is yghE::P in the present invention trc -pyc integration fragment construction and verification electrophoresis diagram; where M is 1 kb DNA marker; 1 is upstream homology arm; 2 is target gene; 3 is downstream homology arm; 4 is overlapping fragment; 5 is original bacteria PCR fragment; 6 is positive single colony PCR identification fragment;
[0047] Figure 10 is gapC:: P in the present invention trc -ppc integration fragment construction and verification electrophoresis diagram; where M is 1 kb DNA marker; 1 is upstream homology arm; 2 is target gene; 3 is downstream homology arm; 4 is overlapping fragment; 5 is original bacteria PCR fragment; 6 is positive single colony PCR identification fragment;
[0048] Figure 11 This is the electrophoresis diagram for the construction and verification of the sucA gene knockout fragment in the present invention; where M is a 1 kb DNA marker; 1 is an upstream homology arm; 2 is a downstream homology arm; 3 is an overlapping fragment; 4 is a PCR fragment of the original bacteria; 5 is a positive single colony PCR identification fragment;
[0049] Figure 12 P in the present invention rpst 、P rpsl 、P rrnc ::P sucA Electrophoresis diagram of dynamic integration fragment construction and verification; M—1kb DNA Marker; 1—original bacteria PCR fragment (sucA knockout gene); 2—positive single colony PCR identification fragment (P rpst ); 3-positive single colony PCR identification fragment (P rpsl ); 4-positive single colony PCR identification fragment (P rrnc );
[0050] Figure 13 This is the electrophoresis diagram for the construction and verification of the argA gene knockout fragment in the present invention; where M is a 1 kb DNA marker; 1 is an upstream homology arm; 2 is a downstream homology arm; 3 is an overlapping fragment; 4 is a PCR fragment of the original bacteria; 5 is a positive single colony PCR identification fragment;
[0051] Figure 14 P in the present invention rpst 、P rpsl 、Prrnc ::P argA Electrophoresis diagram of dynamic integration fragment construction and verification; M—1kb DNA Marker; 1—original bacteria PCR fragment (argA knockout gene); 2—positive single colony PCR identification fragment (P rpst ); 3-positive single colony PCR identification fragment (P rpsl ); 4-positive single colony PCR identification fragment (P rrnc );
[0052] Figure 15 This is a comparison chart of γ-aminobutyric acid production by strains expressing 2-oxoglutarate dehydrogenase genes under the control of three growth-coupled promoters using shake flask fermentation of genetically engineered bacteria in the present invention;
[0053] Figure 16 This is a comparison chart of γ-aminobutyric acid production by strains expressing amino acid N-acetyltransferase genes under the control of three growth-coupled promoters using shake flask fermentation of genetically engineered bacteria in the present invention;
[0054] Figure 17 This is a process diagram for producing γ-aminobutyric acid by fermentation in a fermenter using genetically engineered bacteria in the present invention. DETAILED DESCRIPTION
[0055] The present invention will be further described below with reference to the following examples. The following examples are descriptive rather than restrictive, and the scope of protection of the present invention cannot be limited by the following examples.
[0056] The various experimental operations involved in the specific embodiments are all routine techniques in the field. For parts not specifically annotated in this document, ordinary technicians in this field can refer to various commonly used reference books, scientific literature or related instructions, manuals, etc. before the filing date of this invention to implement them.
[0057] A plasmid-free genetically engineered bacterium that efficiently synthesizes γ-aminobutyric acid from scratch using a cheap carbon source as a substrate is described. The genetically engineered bacterium is based on wild-type Escherichia coli E. coli MG1655 and overexpresses the phage-derived T7 RNA polymerase gene T7RNAP, which is driven by a xylose promoter P xylF Control; GABA transaminase genes gabT and puuE were deleted; the endogenous GABA transporter protease gene gadC of Escherichia coli was overexpressed; the glutamate decarboxylase gene gad from Bacillus megaterium was overexpressed bm; Overexpression of the glutamate dehydrogenase gene gdh (cgl2079) from Corynebacterium glutamicum; Overexpression of the endogenous citrate synthase gene gltA from Escherichia coli; Overexpression of the pyruvate carboxylase gene pyc (cgl0689) from Corynebacterium glutamicum; Overexpression of the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli; Use of three growth-coupled promoters, namely P rpst 、P rpsl 、P rrnc Dynamically regulate the 2-oxoglutarate dehydrogenase gene sucA and the amino acid N-acetyltransferase gene argA in the GABA production pathway of Escherichia coli.
[0058] Preferably, some genes have been registered in Gene Bank, and those skilled in the art can obtain these genes by PCR. As an example, the gabT gene is Gene ID 948067, the puuE gene is Gene ID 945446, the gadC gene is Gene ID 946057, and the gad bm The gene is KT895523.1, the gdh gene is Gene ID 1020031, the gltA gene is Gene ID 945323, the pyc gene is Gene ID 1019553, the ppc gene is Gene ID 948457, the sucA gene is Gene ID 945303, and the argA gene is Gene ID 947289;
[0059] The sequence of the T7 RNA polymerase gene is SEQ ID NO.1; the xylose promoter P xylF The sequence is SEQ ID NO.2; among the three growth-coupled promoters, P rpst The sequence is SEQ ID NO.3, P rpsl The sequence is SEQ ID NO.4, P rrnc The sequence is SEQ ID NO.5.
[0060] The method for constructing the genetically engineered bacteria as described above uses CRISPR / Cas9-mediated gene editing technology to perform targeted modification on the E. coli MG1655 genome.
[0061] Preferably, the specific steps are as follows:
[0062] (1) The RNA polymerase gene T7RNAP from T7 phage was integrated into the lacI-lacZ site of the E. coli MG1655 genome, and the RNA polymerase gene T7RNAP was driven by the xylose promoter P xylF control;
[0063] (2) Knockout of the GABA transaminase gene gabT;
[0064] (3) Knockout of the GABA transaminase gene puuE;
[0065] (4) Integrate the endogenous GABA transporter protease gene gadC of Escherichia coli into the pseudogene site yjgX, and trc promoter control;
[0066] (5) Integrate the endogenous glutamate decarboxylase gene gad from Bacillus megaterium at the pseudogene site yciQ bm , by P T7 promoter control;
[0067] (6) The glutamate dehydrogenase gene gdh (cgl2079) from Corynebacterium glutamicum was integrated into the pseudogene site mbhA, driven by the strong promoter P trc control;
[0068] (7) The endogenous citrate synthase gene gltA from Escherichia coli was integrated into the pseudogene site ylbE, and the P trc promoter control;
[0069] (8) The pyruvate carboxylase gene pyc (cgl0689) from Corynebacterium glutamicum was integrated into the pseudogene site yghE. trc promoter control;
[0070] (9) Integrate the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli into the pseudogene site gapC;
[0071] (10) Using three growth-coupled promoters P rpst 、P rpsl 、P rrnc Replace the natural promoter of the 2-oxoglutarate dehydrogenase gene sucA;
[0072] (11) Using three growth-coupled promoters P rpst 、P rpsl 、P rrnc Replaces the native promoter of the amino acid N-acetyltransferase gene argA.
[0073] The application of the genetically engineered bacteria as described above in the production of gamma-aminobutyric acid.
[0074] The method for producing gamma-aminobutyric acid by fermentation using the genetically engineered bacteria as described above increases the yield of gamma-aminobutyric acid through a staged pH fermentation control process.
[0075] Preferably, the method is carried out using a fermentation culture method, wherein the fermentation culture includes shake flask fermentation or fermentation tank fermentation, and the specific operation steps are as follows:
[0076] During shake flask fermentation, the genetically engineered bacteria were first inoculated from a solid slant into a triangular flask containing a seed culture medium and cultured at 37°C and 220 rpm for 12 hours. The seed culture was then inoculated with 10-15% of the inoculum into a triangular flask containing a fermentation medium for fermentation and cultured at 37°C and 220 rpm for 24 hours. During the fermentation process, ammonia was added to maintain the pH between 6.5 to ensure normal growth of the bacteria. A 60% glucose solution was added as appropriate to maintain the normal fermentation process.
[0077] During fermentation in a fermenter, a bacterial liquid of the genetically engineered bacteria is taken and evenly spread on an activated slant, and subcultured; the strain on the activated slant is inoculated into a seed culture medium and cultured at 37°C for 8-10 hours, and ammonia water is added during the culture process to maintain the pH value at 7.0-7.2; the seed liquid is inoculated into the fermentation culture medium at an inoculum rate of 15-20%, and fermentation culture is started; the initial pH value of the fermentation is controlled at 7.0-7.2, and after 6-8 hours of fermentation, ammonia water is added to maintain the pH value at 6.4-6.5; when the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is fed to maintain the final mass concentration of residual sugar at 0.1-0.5%; the temperature is controlled at 37°C and the dissolved oxygen value is controlled at 15%-30% throughout the fermentation process, and the fermentation cycle is 38 hours to obtain gamma-aminobutyric acid.
[0078] Preferably, the slant culture medium used for the solid slant and activated slant is: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast powder 5-8 g / L, NaCl 2.5-5 g / L, agar 20 g / L;
[0079] Alternatively, the seed culture medium is: glucose 25-30 g / L, KH2PO4 1.2-1.5 g / L, MgSO4 0.5-1.0 g / L, yeast powder 5-8 g / L, FeSO4 10-12 mg / L, MnSO4 10-12 mg / L, peptone 3-5 g / L, VB1, VB3, VB5, VB 12 、V H 1.3-2.5 mg / L each; pH 7.0-7.5, 121°C, high pressure steam sterilization for 20 min;
[0080] Alternatively, the fermentation medium is: glucose 20-25 g / L, xylose 5-10 g / L, KH2PO4 2.5-5.0 g / L, MgSO4·7H2O 1.2-2.0 g / L, yeast powder 4-8 g / L, FeSO4 20-24 mg / L, MnSO4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, VB1, VB3, VB5, VB 12 、V H 2-4 mg / L each, VB6 50 mg / L; pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min.
[0081] Specifically, the relevant preparation and detection are as follows:
[0082] Example 1: Construction of γ-aminobutyric acid genetic engineering strain (transformation strategy see Figure 1 ):
[0083] 1. Gene Editing Methods
[0084] The present invention utilizes a CRISPR / Cas9-mediated gene editing method, which can be performed as described in the literature (Metabolic Engineering, 2015, 31: 13-21). CRISPR / Cas9 is a precise and efficient novel gene-targeting technology. The two plasmids used in this method are pGRB and pREDCas9. The pREDCas9 plasmid is a temperature-sensitive plasmid that carries a gRNA elimination system, the lambda phage Red recombination system, and the Cas9 protein expression system. It confers spectinomycin resistance (working concentration: 100 mg / L) and has an optimal incubation temperature of 32°C. The pGRB plasmid, based on the pUC18 backbone, contains the J23100 promoter, the gRNA-Cas9 binding region, and a terminator sequence. It confers ampicillin resistance (working concentration: 100 mg / L) and has an optimal incubation temperature of 37°C.
[0085] 2. Specific process of strain construction
[0086] A plasmid-free genetically engineered bacterium that efficiently synthesizes γ-aminobutyric acid from scratch using a cheap carbon source such as glucose as a substrate. The γ-aminobutyric acid genetically engineered bacterium is based on wild-type Escherichia coli E. coli MG1655 and overexpresses the phage-derived T7 RNA polymerase gene; lacks the GABA transaminase genes gabT and puuE; overexpresses the endogenous GABA transporter protease gene gadC from E. coli; and overexpresses the glutamate decarboxylase gene gadC from Bacillus megaterium. bm; Overexpression of the glutamate dehydrogenase gene gdh (cgl2079) from Corynebacterium glutamicum; Overexpression of the endogenous citrate synthase gene gltA from Escherichia coli; Overexpression of the pyruvate carboxylase gene pyc (cgl0689) from Corynebacterium glutamicum; Overexpression of the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli; Use of three growth-coupled promoters (P rpst 、P rpsl 、P rrnc ) dynamically regulate the 2-oxoglutarate dehydrogenase gene sucA and the amino acid N-acetyltransferase gene argA in the GABA production pathway of Escherichia coli.
[0087] 2.1 Integration of the T7RNAP gene into the E. coli MG1655 genome at the lacI-lacZ site
[0088] Using the genome of E. coli MG1655 (numbered E. coli G1) as a template, upstream homology arm primers UP-lacI-lacZ-S (SEQ ID NO.11) and UP-lacI-lacZ-A (SEQ ID NO.12) and downstream homology arm primers DN-lacI-lacZ-S (SEQ ID NO.13) and DN-lacI-lacZ-A (SEQ ID NO.14) were designed based on the upper and lower sequences of its lacI-lacZ gene. The upper and lower homology arm fragments were amplified by PCR. The sequence of the T7 RNA polymerase gene T7RNAP (SEQ ID NO.1) was obtained by gene synthesis, which contains the xylose promoter P xylF (SEQ ID NO.2), primers T7RNAP-S (SEQ ID NO.15) and T7RNAP-A (SEQ ID NO.16) were designed based on the T7RNAP gene sequence, and PCR amplified the T7RNAP fragment; the above fragments were used to obtain the integration fragment of the T7RNAP gene (upstream homology arm-P xylF-T7RNAP- downstream homology arm). Primers gRNA-lacI-lacZ-S (SEQ ID NO.17) and gRNA-lacI-lacZ-A (SEQ ID NO.18) were designed to amplify a DNA fragment containing the 20 bp target sequence (SEQ ID NO.19) on the lacI-lacZ gene sequence. After recombination with the linearized pGRB vector, recombinant pGRB-lacI-lacZ was obtained. The integrated fragment and pGRB-lacI-lacZ were electroporated into E. coli G1 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification. Then, pGRB-lacI-lacZ used for gene editing was eliminated, that is, the strain E. coli G2. The verification figure is shown in the figure. Figure 2 shown.
[0089] 2.2 gabT gene knockout
[0090] Based on the upstream and downstream sequences of the gabT gene, upstream homology primers UP-gabT-S (SEQ ID NO.20) and UP-gabT-A (SEQ ID NO.21) and downstream homology primers DN-gabT-S (SEQ ID NO.22) and DN-gabT-A (SEQ ID NO.23) were designed. Using E. coli G2 as a template, PCR was used to amplify the upstream and downstream homology arms, and the gene knockout fragment (upstream homology arm-downstream homology arm) was obtained by recombinant PCR. A DNA fragment containing the 20 bp target sequence of the gabT gene (SEQ ID NO.26) was generated by annealing primers gRNA-gabT-S (SEQ ID NO.24) and gRNA-gabT-A (SEQ ID NO.25). This DNA fragment was then recombined with the linearized pGRB vector to obtain recombinant pGRB-gabT. The integration fragment and pGRB-gabT were electroporated into E. coli G2 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-gabT used for gene editing was eliminated, that is, the strain E. coli G3. Figure 3 shown.
[0091] 2.3 puuE gene knockout
[0092] Based on the upstream and downstream sequences of the puuE gene, upstream homology arm primers UP-puuE-S (SEQ ID NO.27) and UP-puuE-A (SEQ ID NO.28) and downstream homology arm primers DN-puuE-S (SEQ ID NO.29) and DN-puuE-A (SEQ ID NO.30) were designed. Using E. coli G3 as a template, PCR was used to amplify the upstream and downstream homology arms, and the gene knockout fragment (upstream homology arm-downstream homology arm) was obtained by recombinant PCR. A DNA fragment containing the 20 bp target sequence of the puuE gene (SEQ ID NO.33) was prepared by annealing primers gRNA-puuE-S (SEQ ID NO.31) and gRNA-puuE-A (SEQ ID NO.32). After recombination with the linearized pGRB vector, recombinant pGRB-puuE was obtained. The integration fragment and pGRB-puuE were electroporated into E. coli G3 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-puuE used for gene editing was eliminated, that is, the strain E. coli G4. Figure 4 shown.
[0093] 2.4 Integration of the gadC gene at the yjgX pseudogene locus
[0094] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-yjgX-S (SEQ ID NO.34) and UP-yjgX-P were designed. trc -A (SEQ ID NO.35); downstream homology arm primer DN-T trc -yjgX-S (SEQ ID NO.36) and DN-yjgX-A (SEQ ID NO.37), and PCR was used to amplify the upstream and downstream homology arms of the yjgX gene using E. coli G4 as a template; primers P were designed based on the gene sequence of gadC. trc -gadC-S (SEQ ID NO.38), gadC-T trc -A (SEQ ID NO.39), amplify the target gene. trc The promoter is designed in the antisense primer of the upstream homology arm of the pseudogene and the positive primer of the target gene; trcThe terminator is designed in the antisense primer of the target gene and the positive primer of the downstream homologous arm of the pseudogene site. The integrated fragment of the gene (upstream homologous arm-target gene-downstream homologous arm) is obtained by the recombinant PCR method. A DNA fragment containing the yjgX pseudogene 20 bp (SEQ ID NO.42) target sequence is obtained by annealing primers gRNA-yjgX-S (SEQ ID NO.40) and gRNA-yjgX-A (SEQ ID NO.41), and the recombinant pGRB-yjgX is obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-yjgX are electrotransformed into E. coli G4 competent cells containing the pREDCas9 plasmid, and single colonies are obtained by recovery culture. Positive recombinants are obtained by PCR colony verification, and then the pGRB-yjgX used for gene editing is eliminated, that is, the strain E. coli G5, as shown in the verification figure. Figure 5 shown.
[0095] 2.5 gad bm Integration of genes at the yciQ pseudogene site
[0096] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-yciQ-S (SEQ ID NO.43) and UP-yciQ-P were designed. T7 -A (SEQ ID NO.44); downstream homology arm primer DN-T T7 -yciQ-S (SEQ ID NO.45) and DN-yciQ-A (SEQ ID NO.46), and PCR was used to amplify the upstream and downstream homology arms of the pseudogene using E. coli G5 as a template; primers P T7 -gadbm-S (SEQ ID NO.47), gadbm-T T7 -A (SEQ ID NO.48), amplify the target gene. T7 The promoter is designed in the antisense primer of the upstream homology arm of the pseudogene and the positive primer of the target gene; T7The terminator is designed in the antisense chain primer of the target gene and the positive chain primer of the downstream homologous arm of the pseudogene site. The integrated fragment of the gene (upstream homologous arm-target gene-downstream homologous arm) is obtained by the recombinant PCR method. A DNA fragment containing the yciQ pseudogene 20 bp (SEQ ID NO.51) target sequence is obtained by annealing primers gRNA-yciQ-S (SEQ ID NO.49) and gRNA-yciQ-A (SEQ ID NO.50), and the recombinant pGRB-yciQ is obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-yciQ are electroporated into E. coli G5 competent cells containing the pREDCas9 plasmid, and single colonies are obtained by recovery culture. Positive recombinants are obtained by PCR colony verification, and then the pGRB-yciQ used for gene editing is eliminated, that is, the strain E. coli G6, as shown in the verification figure. Figure 6 shown.
[0097] 2.6 Integration of the gdh gene at the mbhA locus
[0098] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-mbhA-S (SEQ ID NO.52) and UP-mbhA-P were designed. trc -A (SEQ ID NO.53); downstream homology arm primer DN-T trc -mbhA-S (SEQ ID NO.54) and DN-mbhA-A (SEQ ID NO.55); using E. coli G6 genome as template, PCR technology was used to amplify the upstream and downstream homology arms of the pseudogene; according to the gene sequence of gdh, primers P trc -gdh-S (SEQ ID NO.56), gdh-T trc -A (SEQ ID NO.57), amplify the target gene. trc The promoter is designed in the antisense primer of the upstream homology arm of the pseudogene and the positive primer of the target gene; trcThe terminator was designed in the antisense primer of the target gene and the positive primer of the downstream homology arm of the pseudogene site. The integrated fragment of the gene (upstream homology arm-target gene-downstream homology arm) was obtained by recombinant PCR. A DNA fragment containing the mbhA pseudogene 20 bp (SEQ ID NO.60) target sequence was obtained by annealing primers gRNA-mbhA-S (SEQ ID NO.58) and gRNA-mbhA-A (SEQ ID NO.59), and recombined with the linearized pGRB vector to obtain recombinant pGRB-mbhA. The integrated fragment and pGRB-mbhA were electroporated into E. coli G6 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then the pGRB-mbhA used for gene editing was eliminated, that is, strain E. coli 7, as shown in the verification figure. Figure 7 shown.
[0099] 2.7 Integration of the gltA gene at the ylbE locus
[0100] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-ylbE-S (SEQ ID NO.61), UP-ylbE-P trc -A (SEQ ID NO.62); downstream homology arm primer DN-T trc -ylbE-S (SEQ ID NO.63) and DN-ylbE-A (SEQ ID NO.64). Using the E. coli G7 genome as a template, PCR technology was used to amplify the upstream and downstream homology arms of the pseudogene; primers P were designed based on the gene sequence of gltA. trc -gltA-S (SEQ ID NO.65), gltA-T trc -A (SEQ ID NO.66), amplify the target gene. trc The promoter is designed in the antisense primer of the upstream homology arm of the pseudogene and the positive primer of the target gene; trcThe terminator was designed in the antisense primer of the target gene and the positive primer of the downstream homology arm of the pseudogene site. The integrated fragment of the gene (upstream homology arm-target gene-downstream homology arm) was obtained by recombinant PCR. A DNA fragment containing the target sequence of the ylbE pseudogene 20bp (SEQ ID NO.69) was obtained by annealing primers gRNA-ylbE-S (SEQ ID NO.67) and gRNA-ylbE-A (SEQ ID NO.68), and recombined with the linearized pGRB vector to obtain recombinant pGRB-ylbE. The integrated fragment and pGRB-ylbE were electroporated into E. coli G7 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then the pGRB-ylbE used for gene editing was eliminated, that is, the strain E. coli G8, as shown in the verification figure. Figure 8 shown.
[0101] 2.8 Integration of the pyc gene at the yghE locus
[0102] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-yghE-S (SEQ ID NO.70), UP-yghE-P trc -A (SEQ ID NO.71) and downstream homology arm primer DN-T trc -yghE-S (SEQ ID NO.72), DN-yghE-A (SEQ ID NO.73). Using E. coli G8 genome as template, PCR technology was used to amplify upstream and downstream homology arms; primers P were designed according to the gene sequence of PyC. trc -pyc-S (SEQ ID NO.74), pyc-T trc -A (SEQ ID NO.75), amplify the target gene. trc The promoter is designed in the antisense primer of the upstream homology arm of the pseudogene and the positive primer of the target gene; trcThe terminator was designed in the antisense primer of the target gene and the positive primer of the downstream homologous arm of the pseudogene site. The integrated fragment of the gene (upstream homologous arm-target gene-downstream homologous arm) was obtained by recombinant PCR. A DNA fragment containing the target sequence of the yghE pseudogene 20 bp (SEQ ID NO.78) was obtained by annealing primers gRNA-yghE-S (SEQ ID NO.76) and gRNA-yghE-A (SEQ ID NO.77), and recombined with the linearized pGRB vector to obtain the recombinant pGRB-yghE. The integrated fragment and pGRB-yghE were electroporated into E. coli G8 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then the pGRB-yghE used for gene editing was eliminated, that is, the strain E. coli G9. The verification figure is as shown. Figure 9 shown.
[0103] 2.9 Integration of the ppc gene at the gapC locus
[0104] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-gapC-S (SEQ ID NO.79), UP-gapC-P trc -A (SEQ ID NO.80) and downstream homology arm primer DN-T trc -gapC-S (SEQ ID NO.81), DN-gapC-A (SEQ ID NO.82). Using E. coli G9 genome as template, PCR technology was used to amplify upstream and downstream homology arms; primers P were designed based on the gene sequence of ppc. trc -ppc-S (SEQ ID NO.83), ppc-T trc -A (SEQ ID NO.84), amplify the target gene. The integrated fragment of the gene (upstream homology arm-target gene-downstream homology arm) was obtained by recombinant PCR. A DNA fragment containing the target sequence of gapC pseudogene 20 bp (SEQ ID NO.87) was obtained by annealing primers gRNA-gapC-S (SEQ ID NO.85) and gRNA-gapC-A (SEQ ID NO.86), and recombined with the linearized pGRB vector to obtain recombinant pGRB-gapC. The integrated fragment and pGRB-gapC were electroporated into E. coli G9 competent cells containing pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-gapC used for gene editing was eliminated, that is, strain E. coli G10, as shown in the verification figure. Figure 10 shown.
[0105] 2.10 Dynamic regulation strategy of the sucA gene
[0106] Dynamic regulation employed a knockout-first, integration-later strategy. Based on the upstream and downstream sequences of the sucA gene, upstream homology primers UP-sucA-S (SEQ ID NO.88) and UP-sucA-A (SEQ ID NO.89) and downstream homology primers DN-sucA-S (SEQ ID NO.90) and DN-sucA-A (SEQ ID NO.91) were designed. Using E. coli G10 as a template, PCR was used to amplify the upstream and downstream homology arms. Recombinant PCR was then used to obtain the knockout fragment (upstream homology arm-downstream homology arm). Annealing of primers gRNA-sucA-S (SEQ ID NO.92) and gRNA-sucA-A (SEQ ID NO.93) generated a DNA fragment containing the 20 bp (SEQ ID NO.94) target sequence of the sucA gene. This fragment was then recombined with the linearized pGRB vector to obtain recombinant pGRB-sucA. The integrated fragment and pGRB-sucA were electroporated into E. coli G10 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-sucA used for gene editing was eliminated, that is, the strain E. coli G11. The verification figure is shown in the figure. Figure 11 On this basis, according to the upstream and downstream sequences of sucA gene and three growth-coupled promoters P rpsl 、P rpst 、P rrnc The upstream homology arm primers UP-sucA-S (SEQ ID NO.88), UP-P rpsl -A (SEQ ID NO.95), UP-P rpst -A1 (SEQ ID NO.96), UP-P rpst -A2 (SEQ ID NO.97), UP-P rrnc -A1 (SEQ ID NO.98), UP-P rrnc -A2 (SEQ ID NO.99) and downstream homology arm primer DN-P rpsl -S (SEQ ID NO.100), DN-P rpst -S1 (SEQ ID NO. 101), DN-P rpst -S2 (SEQ ID NO. 102), DN-P rrnc -S1 (SEQ ID NO. 103), DN-P rrnc-S2 (SEQ ID NO.104), DN-sucA-A (SEQ ID NO.91), and the target sequence gene of plasmid No. 4 20 bp (SEQ ID NO.10) was designed in the downstream primer of the upstream homology arm of the gene sucA and the upstream primer of the downstream homology arm. Using the E. coli G11 genome as a template, the upstream and downstream homology arms were amplified by PCR technology; the integrated fragment of the gene (upstream homology arm-P rpsl -sucA-downstream homology arm), (upstream homology arm-P rpst -sucA-downstream homology arm), (upstream homology arm-P rrnc -sucA- downstream homology arm). A DNA fragment containing the exogenous plasmid gene target sequence No. 4 was prepared by annealing primers gRNA-S1 (SEQ ID NO.105) and gRNA-A1 (SEQ ID NO.106), and the recombinant pGRB-sucA2 was obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-sucA2 were electroporated into E. coli G11 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-sucA2 used for gene editing was eliminated, i.e., strains E. coli G12, E. coli G13, and E. coli G14. The verification figure is as shown. Figure 12 As shown. Plasmid No. 4 and gene segmentation integration method refer to the literature (Journal of Industrial Microbiology & Biotechnology, 2019, 46(1):81-90.)
[0107] 2.11 Dynamic Regulation Strategy of the argA Gene
[0108] Dynamic regulation employed a knockout-first, then integration strategy. Based on the upstream and downstream sequences of the argA gene, upstream homology arm primers UP-argA-S (SEQ ID NO.107) and UP-argA-A (SEQ ID NO.108) and downstream homology arm primers DN-argA-S (SEQ ID NO.109) and DN-argA-A (SEQ ID NO.110) were designed. Using E. coli G13 as a template, PCR was used to amplify the upstream and downstream homology arms. Recombinant PCR was then used to obtain the knockout fragment (upstream homology arm-downstream homology arm). Annealing of primers gRNA-argA-S (SEQ ID NO.111) and gRNA-argA-A (SEQ ID NO.112) yielded a DNA fragment containing the 20bp target sequence of the argA gene (SEQ ID NO.113). This fragment was then recombined with the linearized pGRB vector to obtain recombinant pGRB-argA. The integration fragment and pGRB-argA were electroporated into E. coli G13 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-argA used for gene editing was eliminated, that is, the strain E. coli G15. The verification figure is shown in the figure. Figure 13 On this basis, according to the upstream and downstream sequences of the argA gene and the three growth-coupled promoters P rpst 、P rpsl 、P rrnc The upstream homology arm primers UP-argA-S (SEQ ID NO.107), UP-P rpst -AA1 (SEQ ID NO.114), UP-P rpst -AA2 (SEQ ID NO.115), UP-P rpsl -AA (SEQ ID NO. 116), UP-P rrnc -AA1 (SEQ ID NO.117), UP-P rrnc -AA2 (SEQ ID NO. 118) and downstream homology arm primer DN-P rpst -SS1 (SEQ ID NO. 119), DN-P rpst -SS2 (SEQ ID NO. 120), DN-P rpsl -SS (SEQ ID NO.121), DN-P rrnc -SS1 (SEQ ID NO. 122), DN-P rrnc-SS2 (SEQ ID NO.123), DN-argA-A (SEQ ID NO.110), and the 20 bp gene sequence of plasmid No. 4 (SEQ ID NO.10) were designed in the downstream primer of the upstream homology arm of gene argA and the upstream primer of the downstream homology arm. Using the E. coli G15 genome as a template, the upstream and downstream homology arms were amplified by PCR technology; the integrated fragment of the gene (upstream homology arm-P rpst -argA-downstream homology arm), (upstream homology arm-P rpsl -argA-downstream homology arm), (upstream homology arm-P rrnc -argA- downstream homology arm). A DNA fragment containing the exogenous plasmid gene target sequence No. 4 was prepared by annealing primers gRNA-S1 (SEQ ID NO.105) and gRNA-A1 (SEQ ID NO.106), and the recombinant pGRB-argA2 was obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-argA2 were electroporated into E. coli G15 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-argA2 for gene editing was eliminated, i.e., strains E. coli G16, E. coli G17, and E. coli G18. The verification figure is as shown. Figure 14 As shown. Plasmid No. 4 and gene segmentation integration method refer to the literature (Journal of Industrial Microbiology & Biotechnology, 2019, 46(1):81-90.)
[0109] 3. Primers used in strain construction
[0110] All primers used in the strain construction process are shown in the table below:
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119] Example 2: Production of γ-aminobutyric acid by shake flask fermentation using genetically engineered bacteria.
[0120] First, the genetically engineered strain was inoculated from a solid slant into a flask containing seed culture medium and cultured at 37°C and 220 rpm for 12 hours. The seed culture was then inoculated into a flask containing fermentation medium at a 10-15% inoculum and cultured at 37°C and 220 rpm for 24 hours. During the fermentation process, ammonia was added to maintain the pH between 6.5 to ensure normal growth of the strain. A 60% glucose solution was added as needed to maintain the fermentation process.
[0121] The slant culture medium of the solid slant is formulated as follows: 1 g / L glucose, 10 g / L peptone, 10 g / L beef extract, 5 g / L yeast powder, 2.5 g / L sodium chloride, and 30 g / L agar.
[0122] The seed culture medium comprises: 25-30 g / L glucose, 1.2-1.5 g / L KH2PO4, 0.5-1.0 g / L MgSO4, 5-8 g / L yeast extract, 10-12 mg / L FeSO4, 10-12 mg / L MnSO4, 3-5 g / L peptone, 1.3-2.5 mg / L each of VB1, VB3, VB5, VB12, and VH, pH 7.0-7.5, and is sterilized at 121°C with high pressure steam for 20 min.
[0123] The fermentation medium formula is: glucose 20-25 g / L, xylose 5-10 g / L, KH2PO4 2.5-5.0 g / L, MgSO4·7H2O 1.2-2.0 g / L, yeast powder 4-8 g / L, FeSO4 20-24 mg / L, MnSO4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, VB1, VB3, VB5, VB 12 、V H 2-4 mg / L each, VB6 50 mg / L, pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min.
[0124] The concentration of γ-aminobutyric acid in the fermentation supernatant was detected by high performance liquid chromatography. First, the effects of different growth-coupled promoters on the regulation of sucA gene expression were compared. Figure 15 As shown, strain E. coil G12 (P rpsl promoter controls the sucA gene), E. coil G 13 (P rpstpromoter controls the sucA gene), E. coil G 14 (P rrnc The GABA production of the argA gene controlled by the promoter was 9.5 g / L, 10.8 g / L, and 8.4 g / L, respectively. Therefore, the E. coil G 13 strain was selected for subsequent genetic manipulation. Secondly, the effects of different strength growth-coupled promoters on the regulation of argA gene expression were compared, such as Figure 16 As shown, strain E. coil G 16 (P rpst promoter controls the argA gene), E. coil G 17 (P rpsl promoter controls the argA gene), E. coil G 18 (P rrnc The GABA production of the strains expressing the argA gene controlled by the promoter was 14.8 g / L, 12.3 g / L, and 11.7 g / L, respectively. Therefore, the E. coil G 16 strain was selected for the subsequent 5 L fermentation tank scale-up optimization experiment.
[0125] Example 3: Production of γ-aminobutyric acid using genetically engineered bacteria E. coli G16 in a 5 L fermenter.
[0126] Use an inoculation loop to dip the bacterial liquid in the bacterial preservation tube, evenly spread it on the activated slant, and perform subculture; inoculate the strain on the activated slant into the seed culture medium, culture at 37 ℃ for 8 hours, and maintain the pH value at 7.2 by adding ammonia water during the culture process. Inoculate the seed liquid into the fermentation medium at an inoculation rate of 15% and start fermentation culture. The initial pH value of fermentation is controlled at 7.0, and after 8 hours of fermentation, the pH value is maintained at 6.4 by adding ammonia water. After the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is added to maintain the final mass concentration of residual sugar at 0.1-0.5%. The temperature is controlled at 37 ℃ throughout the fermentation process, the dissolved oxygen value is controlled at 15%-30%, the fermentation cycle is 38 hours, and the fermentation results are as follows: Figure 17 shown.
[0127] The slant culture medium formula is: glucose 1 g / L, peptone 10 g / L, beef extract 10 g / L, yeast powder 5 g / L, sodium chloride 2.5 g / L, agar 30 g / L;
[0128] The seed culture medium formula is: glucose 25-30 g / L, KH2PO4 1.2-1.5 g / L, MgSO4 0.5-1.0 g / L, yeast powder 5-8 g / L, FeSO4 10-12 mg / L, MnSO4 10-12 mg / L, peptone 3-5 g / L, VB1, VB3, VB5, VB 12 、V H1.3-2.5 mg / L each, pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min.
[0129] The fermentation medium formula is: glucose 20-25 g / L, xylose 5-10 g / L, KH2PO4 2.5-5.0 g / L, MgSO4·7H2O 1.2-2.0 g / L, yeast powder 4-8 g / L, FeSO4 20-24 mg / L, MnSO4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, VB1, VB3, VB5, VB 12 、V H 2-4 mg / L each, VB6 50 mg / L, pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min.
[0130] The concentration of γ-aminobutyric acid in the fermentation supernatant was detected by high-performance liquid chromatography. The GABA production of the E. coil G16 genetically engineered strain was as high as 35.4 g / L after 38 hours of fermentation, which is the highest yield of γ-aminobutyric acid synthesized from scratch by E. coli reported so far.
[0131] The gene sequence of the present invention:
[0132] SEQ ID NO.1: T7 RNA polymerase gene
[0133]
[0134] Xylose promoter P xylF The sequence is SEQ ID NO.2:
[0135] GAGATAATTCACAAGTGTGCGCTCGCTCGCAAAATAAAATGGAATGATGAAACTGGGTAATTCCTCGAAGAGAAAAAATGCAATAAGTACAATTGCGCAACAAAAGTAAGATCTCGGTCATAAATCAAGAAATAAACCAAAATCGTA ATCGAAAGATAAAAATCTGTAATTGTTTTCCCCTGTTTAGTTGCTAAAAATTGGTTACGTTTATCGCGGTGATTGTTACTTATTAAAACTGTCCTCTAACTACAGAAGGCCCTACACCATGGGATTTACTAACTGGAAGAGGCACTAA
[0136] Growth-coupled promoter P rpst The gene sequence is SEQ ID NO.3:
[0137] TCATTGCCATGGCGCAAATCACGGGAAGAAACTGACCGCCTGCTGCAATTTTTATCGCGGAAAAGCTGTATTCACACCCCGCAAGCTGGTAGAATCCTGCGCCATCACTACGTAACGAGT;
[0138] P rpsl The gene sequence is SEQ ID NO.4:
[0139] TCGTCAGACTTACGGTTAAGCACCCCAGCCAGATGGCCTGGTGATGGCGGGATCGTTGTATATTTCTTGACACCTTTTCGGCATCGCCCTAAAATTCGGCGTCCTCATA
[0140] P rrnc The gene sequence is SEQ ID NO.5:
[0141] CTTAAAGGCATTACTTATCTCCTTTTTCTTTTTATTCCTCCTTAGTATGCCACCAGGAAGTGTGATTACGGTTGCAAAAACGGCAAATTGCTTGTTTTATGGCACATTAACGGGGCTTTTGCTGAAAAAATGCGCGGTCAGAAAATTATTTTAAATTTCCTCTTGTCAGGCCGGAATAACTCCCTATAATGCGCCACCA;
[0142] The strong promoter P trc The gene sequence is SEQ ID NO.6:
[0143] TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC;
[0144] The T trc The gene sequence of the terminator is SEQ ID NO.7:
[0145] CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAAT;
[0146] The strong promoter P T7 The gene sequence is SEQ ID NO.8:
[0147] TAATACGACTCACTATAGGGTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC;
[0148] The T T7 The gene sequence of the terminator is SEQ ID NO.9:
[0149] CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG;
[0150] The sgRNA targeting recognition sequence of plasmid No. 4 is SEQ ID NO. 10:
[0151] TGCGCTGGTTGATTTCTTCT.
[0152] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.
Claims
1. A plasmid-free genetically engineered bacterium that efficiently synthesizes γ-aminobutyric acid de novo using an inexpensive carbon source as a substrate, characterized by: The genetically engineered bacteria are wild-type Escherichia coli E. coli Based on MG1655, overexpression of the phage-derived T7 RNA polymerase gene T7RNAP , driven by the xylose promoter P xylF Control; GABA transaminase gene deleted gabT and puuE ; Overexpression of the endogenous GABA transporter proteinase gene in Escherichia coli gadC ; Overexpression of glutamate decarboxylase gene from Bacillus megaterium gad bm ; Overexpression of glutamate dehydrogenase gene from Corynebacterium glutamicum gdh Right now cgl2079 ; Overexpression of the endogenous citrate synthase gene in Escherichia coli gltA ; Overexpression of the pyruvate carboxylase gene from Corynebacterium glutamicum pyc Right now cgl0689 ; Overexpression of the endogenous phosphoenolpyruvate carboxylase gene in Escherichia coli ppc ; Using growth-coupled promoter P rpst Dynamic regulation of the 2-oxoglutarate dehydrogenase gene in the GABA production pathway in Escherichia coli sucA and amino acid N-acetyltransferase genes argA ; The gene gabT The accession number in Gene Bank is Gene ID 948067. puuE The accession number in Gene Bank is Gene ID 945446. gadC The accession number in Gene Bank is Gene ID 946057. gad bm The accession number in GeneBank is KT895523.
1. gdh The accession number in Gene Bank is Gene ID 1020031. gltA The accession number in Gene Bank is Gene ID 945323. pyc The accession number in Gene Bank is Gene ID1019553. ppc The accession number in Gene Bank is Gene ID 948457. sucA The accession number in Gene Bank is Gene ID 945303. argA The accession number in Gene Bank is Gene ID 947289; Gene T7RNAP The sequence is SEQ ID NO.1; xylose promoter P xylF The sequence is SEQ ID NO.2; among the three growth-coupled promoters, P rpst The sequence is SEQ ID NO. 3; The method for constructing the genetically engineered bacteria is to use CRISPR / Cas9-mediated gene editing technology to E. coli The MG1655 genome was subjected to targeted modification; The specific steps are as follows: (1) In Escherichia coli E. coli MG1655 genome lacI-lacZ Integration of RNA polymerase gene from T7 phage T7RNAP , driven by the xylose promoter P xylF control; (2) Knockout of the GABA transaminase gene gabT ; (3) Knockout of GABA transaminase gene puuE ; (4) At pseudogene sites yjg Integration of the endogenous GABA transporter gene of Escherichia coli gadC , by P trc promoter control; (5) At pseudogene sites yciQ Integration of the endogenous glutamate decarboxylase gene from Bacillus megaterium gad bm , by P T7 promoter control; (6) At pseudogene sites mbhA Integration of the glutamate dehydrogenase gene from Corynebacterium glutamicum gdh Right now cgl2079 , driven by a strong promoter P trc control; (7) At pseudogene sites ylbE Integration of endogenous citrate synthase gene from Escherichia coli gltA , by P trc promoter control; (8) At pseudogene sites yghE Integration of the pyruvate carboxylase gene from Corynebacterium glutamicum pyc Right now cgl0689 , by P trc promoter control; (9) At pseudogene sites gapC Integration of the endogenous phosphoenolpyruvate carboxylase gene from Escherichia coli ppc ; (10) Using growth-coupled promoter P rpst Replacement of 2-oxoglutarate dehydrogenase gene sucA The natural promoter of (11) Using the growth-coupled promoter P rpst Replacement of amino acid N-acetyltransferase gene argA natural promoter.
2. Use of the genetically engineered bacteria as claimed in claim 1 in the production of γ-aminobutyric acid.
3. The method for producing γ-aminobutyric acid by fermentation using the genetically engineered bacteria according to claim 1, characterized in that: The method improves the yield of gamma-aminobutyric acid through a staged pH fermentation control process.
4. The method according to claim 3, wherein: The method is carried out by a fermentation culture method, wherein the fermentation culture includes shake flask fermentation or fermentation tank fermentation, and the specific operation steps are as follows: During shake flask fermentation, the genetically engineered bacteria were first inoculated from a solid slant into a triangular flask containing a seed culture medium and cultured at 37°C and 220 rpm for 12 hours. The seed culture was then inoculated with 10-15% of the inoculum into a triangular flask containing a fermentation medium for fermentation and cultured at 37°C and 220 rpm for 24 hours. During the fermentation process, ammonia was added to maintain the pH between 6.5 to ensure normal growth of the bacteria. A 60% glucose solution was added as appropriate to maintain the fermentation process. During fermentation in a fermenter, a bacterial liquid of the genetically engineered bacteria is taken and evenly spread on an activated slant, and subcultured; the strain on the activated slant is inoculated into a seed culture medium and cultured at 37°C for 8-10 hours, and ammonia water is added during the culture process to maintain the pH value at 7.0-7.2; the seed liquid is inoculated into the fermentation culture medium at an inoculum rate of 15-20%, and fermentation culture is started; the initial pH value of the fermentation is controlled at 7.0-7.2, and after 6-8 hours of fermentation, ammonia water is added to maintain the pH value at 6.3-6.5; after the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is fed to maintain the final mass concentration of residual sugar at 0.1-0.5%; the temperature is controlled at 37°C and the dissolved oxygen value is controlled at 15%-30% during the entire fermentation process, and the fermentation cycle is 38 hours to obtain gamma-aminobutyric acid.
5. The method according to claim 4, characterized in that: The slant culture medium used for the solid slant and activated slant is: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast powder 5-8 g / L, NaCl 2.5-5 g / L, agar 20 g / L, and the solvent is water; Alternatively, the seed culture medium is: glucose 25-30 g / L, KH2PO4 1.2-1.5 g / L, MgSO4 0.5-1.0 g / L, yeast powder 5-8 g / L, FeSO4 10-12 mg / L, MnSO4 10-12 mg / L, peptone 3-5 g / L, VB1, VB3, VB5, VB 12 、V H 1.3-2.5 mg / L each, solvent is water; pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min; Alternatively, the fermentation medium is: glucose 20-25 g / L, xylose 5-10 g / L, KH2PO4 2.5-5.0 g / L, MgSO4·7H2O 1.2-2.0 g / L, yeast powder 4-8 g / L, FeSO4 20-24 mg / L, MnSO4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, VB1, VB3, VB5, VB 12 、V H 2-4 mg / L each, VB6 50 mg / L, solvent is water; pH is 7.0-7.5, 121℃, high pressure steam sterilization for 20 min.
Citation Information
Patent Citations
Genetically engineered bacterium for producing L-ornithine as well as construction method and application of genetically engineered bacterium
CN116162581A
Gamma-aminobutyric acid production strain as well as construction method and application thereof
CN118165907A
Cited By
Preparation method and application of amino acid water-soluble fertilizer containing GABA (gamma-aminobutyric acid)
CN121698688A
Genetically engineered bacterium for efficiently synthesizing gamma-aminobutyric acid from beginning by efficiently utilizing mixed carbon source, method and application
CN121801790A