Lipase mutant with high specific activity and application thereof in grease processing
By performing R170A single point mutation on lipase, its specific vitality is significantly improved, thus solving the problem of insufficient specific vitality of lipase in the prior art and promoting its wide application in the fields of oil processing and other fields.
Patent Information
- Application Number
- CN202510594386.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-05-09
AI Technical Summary
In the prior art, the specific vitality of lipase is insufficient, which limits its wide application in industrial fields such as oil processing.
By mutating the amino acid sequence of lipase, especially replacing the amino acid Arg (arginine) at the 170th position of lipase with Ala (alanine), the resulting mutant has significantly improved its specific vitality.
The mutated lipase specific activity increased by 23.1%, reaching 544U/mg, significantly improving its application potential in oil processing and other fields.
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of genetic engineering and protein engineering, and in particular to a high specific activity lipase mutant and application thereof in oil and fat processing. Background Art
[0002] Lipase is a triacylglycerol acyl hydrolase, which catalyzes the hydrolysis of natural substrate oils and fats to produce fatty acids, glycerol and mono- or di-glycerides. The basic components of lipase are only amino acids, usually with only one polypeptide chain, and its catalytic activity is determined by its protein structure. According to the differences in structure and function, lipase can be divided into acidic, neutral and alkaline lipases.
[0003] Lipase is widely present in animals, plants and microorganisms. The seeds of oil crops, such as castor seeds and rapeseed, contain more lipase in plants. When the oil seeds germinate, lipase can work together with other enzymes to catalyze the decomposition of oils and fats to produce sugars, providing the nutrients and energy necessary for the rooting and germination of seeds; the pancreas and adipose tissue of higher animals contain more lipase in animals. There is a small amount of lipase in the intestinal fluid to supplement the insufficient fat digestion of pancreatic lipase. There is a small amount of butyric acid glycerol esterase in the gastric juice of carnivorous animals. In animals, various lipases control processes such as digestion, absorption, fat reconstruction and lipoprotein metabolism; the lipase content in bacteria, fungi and yeast is richer. Because microorganisms are of many types, reproduce quickly, and are prone to genetic variation, they have a wider range of pH, temperature and substrate specificity than animals and plants, and lipases from microorganisms are generally secreted extracellular enzymes, which are suitable for large-scale industrial production and obtaining high-purity samples. Therefore, microbial lipase is an important source of industrial lipase.
[0004] As a highly efficient biocatalyst, lipase plays an important role in the fields of oil processing and fine chemicals. In oil processing, lipase decomposes triglycerides into fatty acids and glycerol by catalyzing hydrolysis reactions, providing raw materials for industries such as food and detergents; its transesterification function can improve the physical properties of oils and fats, and is used in the production of special oils such as margarine and cocoa butter substitutes. At the same time, it catalyzes the transesterification reaction of animal and vegetable oils with methanol in the preparation of biodiesel, promoting the development of green energy. In the field of fine chemicals, lipase can highly selectively synthesize food emulsifiers such as monoglycerides and sucrose esters, participate in the splitting of chiral drug intermediates, and catalyze the synthesis of high value-added products such as flavor esters. In addition, lipase shows unique advantages in green chemical processes, which can replace traditional chemical methods, reduce the use of organic solvents, improve reaction efficiency and environmental friendliness, and make it have broad application prospects in industries such as food, energy, medicine and daily chemicals. Summary of the invention
[0005] The present invention solves the problems of the prior art and provides a high specific activity lipase mutant and its application in oil processing. The specific activity of the mutant is significantly improved compared with the wild type, which is conducive to its wide application in industrial fields such as oil processing.
[0006] One aspect of the present invention relates to a lipase mutant, which is obtained by mutating the 170th amino acid of the lipase with the amino acid sequence of SEQ ID NO: 1 from Arg to Ala.
[0007] The amino acid sequence of the lipase mutant is SEQ ID NO:5.
[0008] The present invention also relates to a DNA molecule encoding the above lipase mutant.
[0009] The present invention also relates to a recombinant expression plasmid comprising the above DNA molecule.
[0010] The present invention also relates to a host cell comprising the above recombinant expression plasmid.
[0011] When the above plasmid is transferred into host cells, the specific activity of the recombinantly expressed lipase mutant is significantly improved.
[0012] In some embodiments of the present invention, the host cell is Pichia pastoris ( Pichia pastoris ).
[0013] The present invention also provides application of the lipase mutant in the field of oil and fat processing.
[0014] The present invention is based on the wild-type lipase PSL and provides a lipase mutant containing a single-point mutation of R170A, the specific activity of which is increased by 23.1% to as high as 544 U / mg, achieving an unexpected technical effect.
[0015] In summary, the specific activity of the lipase mutant provided by the present invention is significantly improved, which is beneficial to production costs and promotes its wide application in industrial fields such as oil processing. DETAILED DESCRIPTION
[0016] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, for example MOLECMLAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS INMOLECMLAR BIOLOGY (Ausubel, 2003) in the method of recording. These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, on the basis of the technical solutions recorded in the present invention, adopt other conventional methods, experimental schemes and reagents in this area, and are not limited to the limitation of the specific embodiments of the present invention. For example, the present invention can select the following experimental materials and reagents: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vectors pPIC9k, Amp, and G418 were purchased from Invitrogen.
[0017] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.
[0018] Culture medium formula: Escherichia coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose; Yeast screening medium (MD medium): 2% peptone, 2% agarose; BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol; BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol; LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0; LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.
[0019] The present invention will be further described below in conjunction with embodiments: Example 1 Expression plasmid construction Burkholderia cepacia ( Burkholderia cepacia The lipase gene of ) was codon optimized according to the codon preference of Pichia pastoris, and 6 bases GAATTC (EcoR I restriction site) were added before its start codon ATG, and GCGGCCGC (Not I restriction site) was added after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. The lipase was named PSL, its amino acid sequence is SEQ ID NO: 1, and the encoding nucleotide sequence is SEQ ID NO: 2.
[0020] The lipase gene was digested with restriction enzymes EcoR I and Not I (Fermentas); at the same time, the plasmid pPIC9K was digested with restriction enzymes EcoR I and Not I. The digestion products were purified using a gel purification kit and ligated with T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α Escherichia coli (Invitrogen) and selected with ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).
[0021] The plasmid was purified from the E. coli clone with the correct sequencing results using a plasmid miniprep kit (Omega) to obtain an expression plasmid, which was named pPIC9K-PSL.
[0022] Example 2 Screening of high specific activity lipase mutants In order to further improve the enzymatic activity of lipase PSL, the applicant analyzed its protein structure. The protein is a G11 family lipase, and its structure is a β-jelly roll structure. The applicant screened a large number of mutations of the enzyme through directed evolution technology.
[0023] 1.1 Design PCR primers PSL-F1, PSL-R1: PSL-F1: GGC GAATTC ATGGCTTCCAGAGATGGTCA (as shown in SEQ ID NO: 3, the underline indicates the restriction endonuclease EcoRI recognition site); PSL-R1: ATA GCGGCCGC TTAGGCACATCTAGCTGCTCT (as shown in SEQ ID NO: 4, the underline indicates the recognition site of restriction endonuclease NotI).
[0024] PSL gene (SEQ ID NO: 2) was used as a template, and PCR amplification was performed using the above primers and GeneMorph II random mutation PCR kit. The PCR product was recovered by gel, digested with EcoRI and NotI, and ligated with the pET21a vector digested with the same enzymes, transformed into Escherichia coli BL21 (DE3), spread on LB-Amp plates, and cultured inverted at 37°C. After transformants appeared, they were picked up one by one with a toothpick to a 96-well plate, 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well, and cultured at 37°C and 220 rpm for about 6 h. The supernatant was discarded by centrifugation, the bacteria were resuspended in buffer, and the cells were repeatedly frozen and thawed to obtain Escherichia coli cell lysate containing lipase.
[0025] Take out 30 μL of lysate to two new 96-well plates; add 30 μL of substrate to one of the 96-well plates, react at 37°C for 30 min, and determine the reducing sugar generated by DNS method; add 150 μL of Coomassie Brilliant Blue solution to the other plate, let it stand for 10 min, and determine the protein content by Coomassie Brilliant Blue (Bradford) binding method, and calculate the enzyme activity level and protein content of different mutants. Finally, the applicant screened out the mutation site R170A that significantly improved the specific activity of lipase from more than 20,000 transformants.
[0026] Based on the above wild-type lipase PSL, the present invention provides a mutant containing a single mutation site R170A, and its amino acid sequence is shown in SEQ ID NO:5.
[0027] Example 3 Expression of lipase in Pichia pastoris 3.1 Expression plasmid construction The gene sequences of lipase PSL and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthetic sequence, respectively.
[0028] According to the method described in Example 1, the gene sequences of the synthesized lipase PSL and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector that had been digested with the same enzymes at 16°C overnight, and transformed into Escherichia coli DH5a, spread on LB-Amp plates, and inverted cultured at 37°C. After the transformants appeared, colony PCR (reaction system: template-picked single clone, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5'AOX primer (10 mM): 0.5 μL, 3'AOX primer: 0.5 μL, ddH 2O 14.5μL, reaction procedure: 95℃ pre-denaturation 5min, 30 cycles: 94℃ 30sec, 55℃ 30sec, 72℃ 2min, 72℃ 10min). The positive clones were verified and the correct recombinant expression plasmid was obtained after sequencing verification.
[0029] 3.2 Construction of Pichia pastoris engineered strains 3.2.1 Preparation of competent yeast The Pichia pastoris GS115 strain was activated on a YPD plate, and then cultured at 30°C for 48 h. The activated GS115 monoclonal was inoculated into 6 mL of YPD liquid medium. The culture was carried out at 30°C and 220 rpm for about 12 h, and then the bacterial solution was transferred to a conical flask containing 30 mL of YPD liquid medium. The culture was carried out at 30°C and 220 rpm for about 5 h. The bacterial density was detected by a UV spectrophotometer. When the OD600 value was in the range of 1.1–1.3, 4 mL of the bacterial cells were collected into sterile EP tubes by centrifugation at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The remaining supernatant was absorbed with sterile filter paper, and the bacterial cells were resuspended with 1 mL of pre-cooled sterile water. The cells were centrifuged at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were washed once with 1 mL of sterile water, and then centrifuged at 4°C and 9000 rpm for 2 min. min, gently discard the supernatant, and resuspend the cells in 1 mL of pre-cooled sorbitol (1 mol / L); centrifuge at 4°C and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the cells in 100-150 μL of pre-cooled sorbitol (1 mol / L).
[0030] 3.2.2 Transformation and screening The recombinant expression plasmids constructed in 3.1 were linearized with Sac I, and the linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. The recombinant Pichia pastoris strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).
[0031] The obtained transformants were transferred to BMGY medium, shaken and cultured at 30°C and 250rpm for 1 day; then transferred to BMMY medium, shaken and cultured at 30°C and 250rpm; 0.5% methanol was added every day to induce expression for 4 days; centrifuged at 9000rpm for 10 minutes to remove the bacteria, and the fermentation supernatant containing lipase PSL and its single-point mutant was obtained. The lipase activity and protein content in the fermentation supernatant were detected according to the following method, and the specific activity was calculated.
[0032] 1. Lipase activity determination method (1) Definition of lipase activity unit 1g solid enzyme powder (or 1mL liquid enzyme), under certain temperature and pH conditions, hydrolyzes the substrate for 1min to produce 1μmol of titratable fatty acid, which is one enzyme activity unit, expressed as u / g (u / mL).
[0033] (2) Lipase activity determination method Take two 100mL Erlenmeyer flasks, add 4.00mL of substrate solution and 5.00mL of phosphate buffer to the blank bottle (A) and sample bottle (B) respectively, then add 15.00mL of 95% ethanol to bottle A, preheat it in a 40℃±0.2℃ water bath for 5min, then add 1.00mL of the enzyme solution to be tested to bottles A and B respectively, mix well and start timing immediately, after accurate reaction for 15min, immediately add 15.00mL of 95% ethanol to bottle B to terminate the reaction, and take out; add two drops of phenolphthalein indicator solution to each of the blank and sample solutions, titrate with sodium hydroxide standard solution until it turns slightly red and store for 30s. The titration endpoint is when it does not fade, and the volume of sodium hydroxide standard solution consumed is recorded.
[0034] The formula for calculating lipase activity was: X1 = [(V1–V2) × C × 50 × n] / 0.05 × 1 / 15.
[0035] Where: X1——enzyme activity of sample, u / g; V 1 ——Volume of sodium hydroxide standard solution consumed when titrating the sample, mL; V 2 ——Volume of sodium hydroxide standard solution consumed during blank titration, mL; c——concentration of sodium hydroxide standard solution, mol / L; 50——1.00mL of 0.05mol / L sodium hydroxide solution is equivalent to 50μmol of fatty acid; n——enzyme solution dilution multiple; 0.05—conversion coefficient of sodium hydroxide standard solution concentration; 1 / 15——reaction time is 15min, calculated as 1min; The experimental results obtained are expressed to integers.
[0036] The absolute difference between two independent measurement results obtained under repeated conditions shall not exceed 2% of the arithmetic mean.
[0037] 2. Protein content determination method The Coomassie Brilliant Blue (Bradford) binding method for determining protein content is a composite method that combines colorimetry with pigmentation. Coomassie Brilliant Blue G-250 is brown-red in acidic solution, and turns blue when combined with protein. It conforms to Beer's law within a certain protein concentration range and can be measured colorimetrically at 595nm. A large amount of absorption is achieved in 3 to 5 minutes and is stable for at least 1 hour. In the range of 10 to 1000 μg / mL, the absorbance is proportional to the protein concentration.
[0038] The enzyme solution and Coomassie Brilliant Blue solution were mixed in a volume ratio of 1:5, and allowed to stand for 10 minutes. The protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method. 3. Specific activity calculation “Specific Activity” refers to the number of enzyme activity units per unit weight of protein, generally expressed as U / mg protein.
[0039] Specific activity calculation formula: specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).
[0040] The specific results are shown in Table 1.
[0041] Table 1 Comparison of specific activities of lipase mutants Lipase Specific activity (U / mg) Wild-type PSL 442 R170A single point mutant 544 It can be seen from the results in Table 1 that, compared with the wild-type lipase PSL, the lipase mutant containing the R170A single-point mutation provided by the present invention has a specific activity increased by 23.1%, achieving an unexpected technical effect.
[0042] In summary, the specific activity of the lipase mutant provided by the present invention is significantly improved, which is beneficial to reduce the production cost of the enzyme and promote its wide application in the fields of oil processing and the like.
Claims
1. A lipase mutant, characterized in that: The amino acid sequence of the mutant is SEQ ID NO:
5.
2. A DNA molecule, characterized in that The DNA molecule encodes the lipase mutant according to claim 1.
3. A recombinant expression plasmid, characterized in that: The recombinant expression plasmid comprises the DNA molecule according to claim 2.
4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.
5. The host cell according to claim 4, characterized in that The host cell is Pichia pastoris ( Pichia pastoris ).
6. Use of the lipase mutant according to claim 1 in oil and fat processing.
Citation Information
Patent Citations
Burkholderia lipase mutant and application thereof in whole-cell biocatalytic synthesis of sterol ester
CN116622677A
Lipase mutant with improved specific activity
CN118755696A
Lipase mutant and application thereof in grease processing
CN118773166A
Mutant of Burkholderia lipase as well as recombinant expression vector and application thereof
CN119639718A
Engineered lipase enzymes, manufacture and use thereof
US20240392270A1