High-temperature-resistant xylanase mutant

By mutation screening of xylanases, a xylanase mutant with improved heat resistance was constructed, which solved the problem of the reduction of existing xylanase activity under high temperature conditions, and achieved wider application in the feed field.

CN120098969AActive Publication Date: 2025-06-06QINGDAO VLAND BIOTECH GRP CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202311656996.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-06
Publication Date
2025-06-06
Estimated Expiration
2043-12-06

AI Technical Summary

Technical Problem

The existing xylanase activity decreases under high temperature conditions, limiting its wide application in the feed field.

Method used

By mutation screening of xylanase, xylanase mutants containing mutation sites such as S15C, N43T, Q124E, and F179N were designed and constructed, which significantly improved their enzyme activity retention rate at 75°C and 80°C.

Benefits of technology

The heat resistance of the mutant was significantly improved, with the enzyme activity retention rate increased by 16.85%-67.85% and 9.9%-55.7% respectively after treatment at 75°C and 80°C. Among them, the F179N mutant showed the strongest heat resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004589223820000061
    Figure BDA0004589223820000061
  • Figure BDA0004589223820000062
    Figure BDA0004589223820000062
  • Figure BDA0004589223820000071
    Figure BDA0004589223820000071
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering and protein engineering modification, in particular to a high-temperature-resistant xylanase mutant and application thereof. The heat resistance of the xylanase mutants containing S15C, N43T, Q124E and F179N mutation sites is remarkably improved, the enzyme activity retention rate is generally improved by 16.85%-67.85% after the xylanase mutants are treated at 75 DEG C for 5 min, and the enzyme activity retention rate is generally improved by 9.9%-55.7% after the xylanase mutants are treated at 80 DEG C for 5 min. Wherein the xylanase mutant containing F179N has the strongest heat resistance, and after the xylanase mutant is treated at 75 DEG C and 80 DEG C for 5 minutes, the enzyme activity retention rates of the xylanase mutant are up to 69.3% and 55.7% respectively. The heat-resistant xylanase mutant provided by the invention can be widely applied to the field of feed production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering and protein engineering, and in particular to a thermostable xylanase mutant and application thereof. Background Art

[0002] Xylan is a hybrid polymer molecule, the main chain of which is composed of multiple pyranose groups connected by xylosidic bonds. The side chains are connected to a variety of short substituents of different sizes, mainly O-acetyl, 4-O-methyl-D-glucuronic acid residues, L-arabinose residues, etc. These side chains are covalently or non-covalently linked to several other structural polysaccharides in plant cells (such as lignin, cellulose, pectin, glucan, etc.), forming an important structure of plant cells-cell walls. Xylan is mainly found in the secondary wall of plant cells, between lignin and other polysaccharides, and plays a connecting role. It is precisely because of the differences in these side chains that the structure of xylan varies greatly, from linear polyxylose molecules connected only by β-1,4-glycosidic bonds to highly branched heterogeneous polysaccharides. Research on xylanase began as early as the 1960s, and a large number of xylanases of different types and functions have been isolated from microorganisms from different sources.

[0003] In practical production, the content of non-starch polysaccharides (NSP) such as xylan, pectin, and cellulose in wheat feed is relatively high, resulting in a decrease in the digestion, absorption, and utilization rate of nutrients in wheat by ruminants. It is reported that the addition of exogenous enzyme preparations to diets based on wheat, bran, and soybean meal can destroy plant cell walls, promote the development of the gastrointestinal tract of livestock and poultry, improve the digestion and absorption of nutrients, and thus improve the growth and development of the body. As a major fiber decomposing enzyme, xylanase plays an active role in destroying plant cell walls, eliminating anti-nutritional factors, reducing intestinal chyme viscosity, promoting the growth and development of livestock and poultry, and maintaining intestinal health. In monogastric animals, xylanase can improve the physical barrier and immune barrier function of the piglet intestine and improve the digestibility of nutrients in vitro. In aquatic animals, xylanase can improve the growth performance of grass carp, promote intestinal development, improve intestinal microorganisms, and enhance resistance to enteritis.

[0004] The application of xylanase in the food industry is mainly reflected in its ability to decompose xylo-oligosaccharides from natural food hemifibers such as cotton husks, bagasse, and corn husks. The amount of xylan contained in different plants is also different. Generally, hard wood contains more xylan than soft wood, accounting for 15% to 30% of the dry weight in hard wood and 7% to 10% of the dry weight in soft wood. Xylanase can degrade xylan into xylo-oligosaccharides. Xylo-oligosaccharides are difficult to digest, low in calories and will not cause obesity. They have high bifidobacterial proliferation activity and are the activation and proliferation factors of intestinal bifidobacteria, and are not easy to cause dental caries. In addition, xylo-oligosaccharides can be used to make foods of different sweetness, which can replace glucose as a therapeutic food for diabetics. The most effective way to produce xylo-oligosaccharides with the least side effects is to use xylanase. Therefore, the application of xylanase in the food industry has great potential.

[0005] Xylan in paper industry waste and agricultural waste can be converted into D-xylose monomers by xylanase. D-xylose can be converted into valuable fuel by bacteria, yeast and fungi. The energy crisis faced by the world will inevitably lead to a large demand for biological resources, so the application of xylanase in the energy industry has great potential.

[0006] In the past decade, with the continuous development and progress of biotechnology, especially the widespread application of genetic engineering technology and protein engineering technology, we have a deeper understanding of xylanase, and have screened natural and excellent strains that produce xylanase, purified xylanase, and analyzed its properties. So far, the xylanase genes of many kinds of microorganisms have been isolated and cloned, and a variety of xylanase products have been produced. Xylanase has shown broad application prospects in the feed industry, pulp and paper industry, food industry, and energy industry, and has attracted widespread attention from scientists. Summary of the invention

[0007] The present invention solves the problems in the prior art and provides a xylanase mutant and its application. The heat resistance of the xylanase mutant is significantly improved, which lays a foundation for its wide use in the feed field.

[0008] The present invention provides a xylanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO: 1, and comprising an amino acid substitution at at least one position selected from the following group: 15, 43, 124, 179 compared with SEQ ID NO: 1.

[0009] In some embodiments of the invention, the amino acid sequence of the mutant is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to SEQ ID NO:1.

[0010] In some more specific embodiments, the amino acid sequence of the mutant is at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identical to SEQ ID NO:1.

[0011] In some embodiments of the present invention, the mutant comprises a substitution or a combination of substitutions of at least one amino acid in the following group: S15C, N43T, Q124E, F179N, S15C / N43T, S15C / Q124E, S15C / F179N, N43T / Q124E, N43T / F179N, Q124E / F179N, S15C / N43T / Q124E, S15C / N43T / F179N, S15C / Q124E / F179N, N43T / Q124E / F179N, S15C / N43T / Q124E / F179N.

[0012] The present invention also relates to a DNA molecule encoding the above xylanase mutant.

[0013] The present invention also relates to a recombinant expression vector comprising the above DNA molecule.

[0014] The present invention also provides a host cell comprising the above recombinant expression vector.

[0015] The host cell is Trichoderma reesei.

[0016] The S15C, N43T, Q124E, and F179N mutation sites screened by the present invention can significantly improve the heat resistance of xylanase Xyn. Compared with the wild type, after being treated at 75°C for 5 minutes, the enzyme activity retention rate of the mutants generally increased by 16.85%-67.85%, and after being treated at 80°C for 5 minutes, the enzyme activity retention rate of the mutants generally increased by 9.9%-55.7%. Among them, the xylanase mutant containing F179N has the strongest heat resistance, and after being treated at 75°C and 80°C for 5 minutes, its enzyme activity retention rate is as high as 69.3% and 55.7%, respectively. The heat-resistant xylanase mutant provided by the present invention can be widely used in the field of feed production. DETAILED DESCRIPTION

[0017] The present invention discloses a xylanase mutant, a preparation method and application thereof, a DNA molecule encoding the xylanase mutant, a vector, and a host cell. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired effect. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0018] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, such as MOLECMLAR CLONING:ALABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS INMOLECMLAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, on the basis of the technical solutions described in the present invention, adopt other conventional methods, experimental schemes and reagents in this area, without being limited to the limitation of specific embodiments of the present invention.

[0019] Example 1 Screening of xylanase mutants

[0020] In order to improve the temperature tolerance of wild-type xylanase Xyn (amino acid sequence SEQ ID NO: 1, encoding nucleotide sequence SEQ ID NO: 2) from Trichoderma reesei, the applicant conducted a structural analysis of the protein. The protein is a GHI1 family xylanase, and its structure is a β-jelly roll structure, which is a right-handed half-grip composed of folded sheets, and the two catalytic residues are located in the crack formed by the highly twisted β-folded sheets that can accommodate xylan sugar chains. Without destroying the secondary structure and active center of the protein, the applicant screened a large number of mutations of the enzyme through directed evolution technology.

[0021] Design PCR primers Xyn-F1, Xyn-R1:

[0022] Xyn-F1: 5'-CGC GAATTC ACTATTCAACCTGGAACTGGATAC—3' (the underline indicates the recognition site of restriction endonuclease ECORI);

[0023] Xyn-R1: 5'-CTC GCGGCCGC TTATGAGACTGTGATAGAGGCAG—3' (the underline indicates the recognition site of restriction endonuclease NotI).

[0024] The Xyn gene (SEQ ID NO: 2) was used as a template and PCR amplification was performed using the above primers using a GeneMorph II random mutation PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and ligated with the pET21a vector digested with the same enzymes, transformed into Escherichia coli BL21 (DE3), spread on an LB+Amp plate, and cultured inverted at 37°C. After transformants appeared, they were picked up one by one with a toothpick into a 96-well plate, 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well, and the cells were cultured at 37°C and 220 rpm for about 6 hours. The supernatant was discarded after centrifugation, and the cells were resuspended in a buffer solution, and the cells were repeatedly frozen and thawed to obtain an Escherichia coli cell lysate containing xylanase.

[0025] Take out 30μL of lysate to two new 96-well plates respectively; treat one of them at 70℃ for 8min; then add 30μL of substrate to both 96-well plates, react at 37℃ for 30min, measure the reducing sugar generated by DNS method, and calculate the enzyme activity level of different mutants after high temperature treatment. Finally, the applicant obtained the mutation sites that can significantly improve the heat resistance of the xylanase mutant Xyn without significantly affecting its enzyme activity and original enzymatic properties: S15C, N43T, Q124E, F179N.

[0026] The invention provides single point mutants respectively comprising the mutation sites of S15C, N43T, Q124E and F179N on the basis of the wild-type xylanase Xyn.

[0027] Example 2 Expression of xylanase in Trichoderma reesei

[0028] First, according to the codon preference of Trichoderma, the gene sequences of xylanase Xyn and its mutants were optimized. The optimized gene sequences were synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, KpnI and MluI, were added to the 5' and 3' ends of the synthetic sequence respectively.

[0029] 2.1 Construction of expression vector

[0030] The synthesized plasmids were digested with restriction endonucleases KpnI (Fermentas) and MluI (Fermentas) respectively; the plasmid pTGII was digested with restriction endonucleases KpnI and XbaI at the same time; the digestion products were purified using a gel purification kit, and the two digestion products were connected using T4 DNA ligase (Fermentas); the ligation products were transformed into Trans5α Escherichia coli (Transgen), selected with ampicillin, and several clones were sequenced (Invitrogen) to ensure accuracy. After the sequencing was correct, the recombinant plasmid containing the xylanase gene was obtained.

[0031] Plasmids were purified from E. coli clones with correct sequencing results using a plasmid midi-prep kit (Axygen).

[0032] 2.2 Protoplast preparation

[0033] A spore suspension of a host fungus Trichoderma reesei with a defective xylanase gene was inoculated on a PDA plate and cultured at 30°C for 6 days; after the spores were abundantly produced, a colony of about 1 cm×1 cm was cut and placed in a liquid culture medium containing 120 mL YEG+U (0.5% yeast powder, 1% glucose, and 0.1% uridine), and cultured at 30°C and 220 rpm for 14 to 16 hours; mycelium was collected by filtering with sterile gauze and washed once with sterile water; the mycelium was placed in a conical flask containing 20 mL 10 mg / mL lytic enzyme solution (Sigma L1412), and the culture was carried out at 30°C and 90 rpm for 1 to 2 hours; and the progress of protoplast transformation was detected by microscopic observation.

[0034] Pre-cooled 20 mL 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl 2 ) was added to the above-mentioned conical flask, gently shaken, filtered with sterile Miracloth filter cloth to collect the filtrate, centrifuged at 3000rpm, 4℃ for 10min; the supernatant was discarded, 5mL of pre-cooled 1.2M sorbitol solution was added to suspend the cells, and the cells were centrifuged at 3000rpm, 4℃ for 10min; the supernatant was discarded, and an appropriate amount of pre-cooled 1.2M sorbitol was added to suspend the cells and packaged (200μL / tube, the protoplast concentration is 10 8 / mL).

[0035] 2.3 Expression vector transformation and strain verification

[0036] The following operations were all performed on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution, and then 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl 2 ), flick the bottom of the tube to mix, and place on ice for 20 minutes; add 2 mL of 25% PEG, mix well, and place at room temperature for 5 minutes; add 4 mL of 1.2 M sorbitol, mix gently, and pour into the upper culture medium (0.1% MgSO 4 , 1% KH 2 PO 4 , 0.6% (NH 4 ) 2 SO 4, 1% glucose, 18.3% sorbitol, 0.35% agarose); gently mix and spread on the prepared lower medium plate (2% glucose, 0.5% (NH 4 ) 2 SO 4 , 1.5% KH 2 PO 4 , 0.06% MgSO4, 0.06% CaCl 2 , 1.5% agar), culture at 30℃ for 5-7 days until transformants grow out. Pick the transformants to the lower culture medium plate for rescreening, culture at 30℃ for 2 days, and the strains with smoother colony edges are positive transformants.

[0037] Take an appropriate amount of mycelium and place it in a 2 mL centrifuge tube, add 100 mg of sterile quartz sand and 400 μL of extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS); shake vigorously with a bead beater for 2 min; after 65 ° C water bath for 20 min, add 200 μL 10M NH 4 AC, ice bath for 10 minutes; centrifuge at 13000rpm for 10 minutes; take the supernatant, add 2 times the volume of anhydrous ethanol, and place at -20℃ for 30 minutes; centrifuge at 13000rpm for 10 minutes, discard the supernatant; wash twice with 70% ethanol; dry, dissolve in water, and store at -20℃.

[0038] The above-extracted transformant genomic DNA was used as a template and primers MF and MR were used to perform PCR amplification of the target gene for verification.

[0039] MF: ATGGTCAGCTTTACCTCCCTCCTC;

[0040] MR:TTATCAGGAGACACAAATTGAAGC.

[0041] The PCR amplification conditions were 94°C for 4 min; 94°C for 40 s; 58°C for 40 s, 72°C for 1 min, 30 cycles; 72°C for 7 min, 16°C; the PCR amplification products were recovered using a gel recovery kit and sequenced.

[0042] According to the above method, the applicant constructed and obtained engineered strains of Trichoderma reesei that recombinantly expressed xylanase Xyn and its mutants.

[0043] Example 3 Fermentation Verification

[0044] The engineered strains of Trichoderma reesei constructed above were inoculated on PDA solid plates and cultured at 30°C for 6 days. After the spores were abundant, two mycelium blocks with a diameter of 1 cm were inoculated into a 250 mL Erlenmeyer flask containing 50 mL of fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH 4 ) 2 SO 4 , 0.09%MgSO 4 , 2% KH 2 PO 4 , 0.04% CaCl 2 , 0.018% Tween-80, 0.018% trace elements), cultured at 30°C for 48 hours, and then cultured at 25°C for 48 hours. The fermentation broth was centrifuged to obtain fermentation supernatants containing xylanase Xyn and the mutants.

[0045] 3.1 Enzyme activity assay

[0046] (1) Definition of xylanase activity

[0047] Under the conditions of 37°C and pH 5.5, the amount of enzyme required to release 1 μmol of reducing sugar from a 5 mg / ml xylan solution per minute is one enzyme activity unit U.

[0048] (2) Xylanase activity determination method

[0049] Take 2 ml of 1% xylan substrate (prepared with pH 5.5 acetic acid-sodium acetate buffer), add it to a colorimetric tube, balance at 37°C for 10 minutes, then add 2 ml of acid xylanase solution appropriately diluted with pH 5.5 acetic acid-sodium acetate buffer and balanced at 37°C, mix well at 37°C, and react for 30 minutes. After the reaction is completed, add 5 ml of DNS reagent and mix well to terminate the reaction. Then boil in a boiling water bath for 5 minutes, cool to room temperature with tap water, add distilled water to make up to 25 ml, mix well, use the standard blank sample as a blank control, and measure the absorbance value A at 540 nm. E .

[0050] Enzyme activity calculation formula:

[0051]

[0052] Where: X D is the activity of xylanase in the diluted enzyme solution, U / mL; A E is the absorbance of the enzyme reaction solution; A B is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C 0is the intercept of the standard curve; M is the molar mass of xylose, 180.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme solution dilution multiple; 1000 is the conversion factor, 1 mmol = 1000 μmol.

[0053] (3) Enzyme activity assay results

[0054] The enzyme activity was detected according to the above method, and the results showed that the enzyme activity of the fermentation supernatant of the recombinant strain of Trichoderma reesei expressing xylanase Xyn and its mutants constructed above was 265-630 U / mL.

[0055] Example 4 Analysis of the heat resistance of xylanase

[0056] The crude enzyme solution obtained by fermentation in Example 3 was diluted to about 20 U / ml with acetic acid-sodium acetate buffer at pH 5.5, and treated at 75°C and 80°C for 5 min, respectively, and the retained enzyme activity was measured. The enzyme activity of the untreated sample was taken as 100%, and the enzyme activity retention rate was calculated. The specific results are shown in Table 1.

[0057] Table 1 Comparison of thermotolerance of xylanase mutants

[0058]

[0059]

[0060] From the results in Table 1, it can be seen that the S15C, N43T, Q124E, and F179N mutation sites screened by the present invention can significantly improve the heat resistance of xylanase. Compared with the wild type, after being treated at 75°C for 5 minutes, the enzyme activity retention rate of the mutants generally increased by 16.85%-67.85%, and after being treated at 80°C for 5 minutes, the enzyme activity retention rate of the mutants generally increased by 9.9%-55.7%. Among them, the xylanase mutant containing F179N has the strongest heat resistance, and after being treated at 75°C and 80°C for 5 minutes, its enzyme activity retention rate is as high as 69.3% and 55.7%, respectively, achieving unexpected technical effects.

[0061] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A xylanase mutant, It is characterized in that The mutant comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 1, and comprises an amino acid substitution at at least one position selected from the following group: 15, 43, 124, 179 compared to SEQ ID NO:

1.

2. The xylanase mutant according to claim 1, It is characterized in that The amino acid sequence of the mutant is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to SEQ ID NO:

1.

3. The xylanase mutant according to claim 2, It is characterized in that The amino acid sequence of the mutant is at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identical to SEQ ID NO:

1.

4. The xylanase mutant according to claim 1, It is characterized in that The mutant comprises a substitution or a substitution combination of at least one amino acid in the following group: S15C, N43T, Q124E, F179N, S15C / N43T, S15C / Q124E, S15C / F179N, N43T / Q124E, N43T / F179N, Q124E / F179N, S15C / N43T / Q124E, S15C / N43T / F179N, S15C / Q124E / F179N, N43T / Q124E / F179N, S15C / N43T / Q124E / F179N. .

5. A DNA molecule encoding the xylanase mutant according to any one of claims 1 to 4.

6. A recombinant expression plasmid comprising the DNA molecule of claim 5.

7. A host cell, It is characterized in that The host cell comprises the recombinant expression plasmid according to claim 6; the host cell is a non-plant cell.

8. The host cell according to claim 7, It is characterized in that The host cell is Trichoderma reesei ( Trichoderma reesei ).

9. Use of the xylanase mutant according to any one of claims 1 to 4 in feed production.

Citation Information

Patent Citations

  • Perhydrolase enzyme

    CN103333870A

  • Method for producing xylanase at high yield from trichoderma reesei and application of xylanase

    CN112961788A

  • Xylanase mutant and application thereof

    CN115725550A

  • High-specific-activity alkaline xylanase mutant and application thereof

    CN116218818A

  • Xylanase mutant having improved specific activity

    US20220380778A1