Thermophilic beta-1, 4-endoglucanase

Abstract

The invention discloses thermophilic beta-1, 4-endoglucanase, which comprises an amino acid sequence having at least 85% of identity with an amino acid sequence of SEQ ID No: 1, or an amino acid sequence having at least 92% of identity with an amino acid sequence of SEQ ID No: 2, or an amino acid sequence having at least 87% of identity with an amino acid sequence of SEQ ID No: 3, or an amino acid sequence having at least 89% of identity with an amino acid sequence of SEQ ID No: 4, or has an amino acid sequence having at least 84% or more identity with SEQ ID No: 5. The thermophilic beta-1, 4-endoglucanase disclosed by the invention has the activity of endohydrolysis of beta-1, 4-glucan, glucomannan, cellulose and other beta-1, 4-glycosidic bond-containing polysaccharides, and the enzyme activity is still kept at 50% or above after the thermophilic beta-1, 4-endoglucanase is placed at 60 DEG C, 70 DEG C and 80 DEG C for 72 hours. Under the optimum condition, the specific activity of the pure enzyme is 2018U / mg. The beta-1, 4-endoglucanase has a half-life period (T1 / 2) of 72 hours at 80 DEG C. Compared with the currently reported beta-1, 4-endoglucanase, the beta-1, 4-endoglucanase has better temperature stability and is beneficial to industrial application under high-temperature conditions.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to a thermophilic beta-1,4-endoglucanase. Background Art

[0002] β-1,4-endoglucanase (EC3.2.1.4) can specifically cleave β-1,4 glycosidic bonds. It is widely present in archaea, bacteria, fungi, animals and plants, and is widely used in the textile, papermaking, washing, feed and food industries.

[0003] In the textile industry, β-1,4-endoglucanase is mainly used for polishing and bio-stone washing of cellulose fabrics. Bio-polishing refers to the process of polishing the surface of cellulose cotton fabrics after enzyme treatment to achieve anti-pilling effect, reduce stiffness and rigidity, make the fabric surface smoother and the color brighter, and reduce the thickness of cell walls to make plant fibers softer. It is widely used in jeans and cellulose fabrics.

[0004] In the papermaking industry, β-1,4-endoglucanase can be used to improve the properties of pulp and deink waste paper. In the paper production process, enzymatic hydrolysis can reduce the beating degree of some pulp and the roughness of the fiber, thereby improving the water filtration performance of the paper. In the process of deinking waste paper, enzymatic hydrolysis can hydrolyze paper fibers and remove ink from the surface of waste paper, thereby achieving the effect of deinking.

[0005] In the laundry industry, enzymatic hydrolysis of β-1,4-endoglucanase can hydrolyze the granular structure of cellulose molecules, water and dirt, remove dirt from clothes, and achieve a good washing effect. Alkaline β-1,4-endoglucanase generally does not have exoenzyme activity, does not affect the strength and apparent degree of polymerization of cotton fabrics, and increases the color brightness and softness of clothes after washing.

[0006] In the food industry, the applications of β-1,4-endoglucan include: extracting gingerol from edible ginger, pigments from black bean skin, capsaicin from peppers, and pectin from grapefruit peels, etc. In addition, β-1,4-endoglucanase can also be used as a health product because it has physiological functions such as lowering blood lipids, lowering human cholesterol, and improving the body's immunity. In beer brewing, β-1,4-endoglucanase hydrolyzes to reduce viscosity, thereby improving filtration efficiency and beer quality.

[0007] Thermophilic β-1,4-endoglucanase has good thermal stability and can react under high temperature conditions, thereby avoiding microbial contamination during the catalytic process, enhancing the flow of the reaction system, and improving the reaction efficiency. Currently, there is no commercial thermophilic β-1,4-endoglucanase. Summary of the invention

[0008] The first purpose of the present invention is to provide a thermophilic β-1,4-endoglucanase. The thermophilic β-1,4-endoglucanase described in the present invention is derived from the hot spring metagenome of Yuanjiang Reshuitang Hot Spring. The natural β-glucanase gene EG is predicted, and its domains are reconstructed, including domain A and domain C. The AC-reconstructed β-1,4-endoglucanase is obtained by Alphafold2 protein modeling, whole gene synthesis and Escherichia coli heterologous expression.

[0009] The second object of the present invention is to provide an amino acid sequence encoding the β-1,4-endoglucanase. It includes an amino acid sequence having at least 85% identity with the amino acid sequence of SEQ ID No: 1, or an amino acid sequence having at least 92% identity with SEQ ID No: 2, or an amino acid sequence having at least 87% identity with SEQ ID No: 3, or an amino acid sequence having at least 89% identity with SEQ ID No: 4, or an amino acid sequence having at least 84% identity with SEQ ID No: 5. SEQ ID No: 1 is the amino acid sequence of the reconstructed enzyme of domain A and domain C.

[0010] The third object of the present invention is to provide the use of the amino acid sequence in the preparation of β-1,4-endoglucanase.

[0011] The present invention claims to protect the amino acid sequence of the β-1,4-endoglucanase, and the DNA sequence encoding the amino acid sequence.

[0012] In the present invention, the term "amino acid sequence identity" refers to the Per.Ident parameter of the BlastP search result in NCBI.

[0013] The novel thermophilic β-1,4-endoglucanase provided by the present invention has the activity of endohydrolyzing β-1,4-glucan, glucomannan and cellulose and other polysaccharides containing β-1,4-glycosidic bonds, among which the activity of hydrolyzing glucomannan is the best. After being placed at 60 ℃, 70 ℃ and 80 ℃ for 72 h, the residual enzyme activity is still maintained at more than 50%. Under the optimal conditions, the specific activity of the pure enzyme is 2018U / mg, which is much better than the natural β-1,4-endoglucanase. Its half-life (T1 / 2) at 80 ℃ is 72 h. Compared with the currently reported β-1,4-endoglucanase, it has better temperature stability and is conducive to industrial application under high temperature conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The 3D structural model diagram of the protein of β-1,4-endoglucanase, a is the 3D structural model of natural β-1,4-endoglucanase, b is the 3D structural model of the enzyme reconstructed by domain A, c is the 3D structural model of the enzyme reconstructed by domain AB, d is the 3D structural model of the enzyme reconstructed by domain AC, and e is the 3D structural model of the enzyme reconstructed by domain BC; Figure 2 Graph showing the effect of temperature on the activity of β-1,4-endoglucanase, wherein a is a graph showing the activity of β-1,4-endoglucanase domain AC reconstructed enzyme at different temperatures, and b is a graph showing the stability of domain AC reconstructed enzyme at different temperatures; Figure 3 The figure is a thin layer chromatogram of oat glucan hydrolyzed by the domain AC reconstructing enzyme of the present invention, wherein a is a standard: a mixed solution of glucose, glucobiose, glucotriose and glucopyratose; b is the hydrolysis product of natural β-1,4-endoglucanase; c is the hydrolysis product of the domain A reconstructing enzyme; d is the hydrolysis product of the domain AC reconstructing enzyme; and e is a control without enzyme addition. DETAILED DESCRIPTION

[0015] The present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments, but the present invention is not limited in any way. Any changes or improvements made based on the teachings of the present invention fall within the protection scope of the present invention.

[0016] The present invention is a novel thermophilic β-1,4-endoglucanase, which is a reconstructed enzyme of the A domain and the C domain in the natural β-1,4-endoglucanase. It includes an amino acid sequence having at least 87% amino acid identity with SEQ ID No: 1, or an amino acid sequence having at least 92% amino acid identity with SEQ ID No: 2, or an amino acid sequence having at least 87% amino acid identity with SEQ ID No: 3, or an amino acid sequence having at least 89% amino acid identity with SEQ ID No: 4, or an amino acid sequence having at least 83% amino acid identity with SEQ ID No: 5. SEQ ID No: 1 is the full-length amino acid sequence of β-1,4-endoglucanase. SEQ ID No: 6 is the amino acid sequence of the natural β-1,4-endoglucanase EG predicted from the metagenome.

[0017] The thermophilic β-1,4-endoglucanase has a theoretical molecular weight of 58.40 kDa and an isoelectric point of 6.686.

[0018] The optimum reaction temperature of the thermophilic β-1,4-endoglucanase is 95°C, and the optimum pH is 8; under the optimum conditions, the specific activity of the pure enzyme is 2018U / mg.

[0019] The present invention also provides an amino acid sequence encoding the beta-1,4-endoglucanase, a recombinant vector thereof, and a host cell transformed, transduced or transfected with the recombinant vector.

[0020] The present invention further provides application of the amino acid sequence in preparing β-1,4-endoglucanase.

[0021] Example 1 Expression of natural β-1,4-endoglucanase EG 1. Synthesis of natural β-1,4-endoglucanase EG gene The glucanase gene was predicted to be EG from the metagenome, encoding 856 amino acid residues (SEQ ID No: 6) with a theoretical molecular weight of 94.57 kDa. The DNA sequence of the EG gene synthesized by Sangon Biotech Co., Ltd. using codon-optimized Escherichia coli was shown in SEQ ID No: 7, and the recombinant vector pET49b-EG was obtained.

[0022] 2. Plasmid extraction: Use the SanPrep column-based plasmid DNA small-scale extraction kit according to the instructions to extract the recombinant plasmid pET49b-EG used for transformation.

[0023] 3. Transformation of E. coli competent cells: Heat shock transformation method was used. The recombinant plasmid powder (about 4 µg) pET49b-EG after gene synthesis was placed in a centrifuge at 12000 r / min for 2 min. 40 µL ddH 2 O, the final concentration of the recombinant plasmid is 100 ng / µL. Transfer to the prepared E. coli competent cells. When the E. coli competent cells are in an ice-water mixture, immediately take 20 µL of the recombinant plasmid and add it to the BL21 (DE3) competent cells, mix it with a pipette and then put it on ice for 30 minutes. After the ice bath, put the competent cells of the E. coli in a 42 ℃ water bath for 90 s (open the cell membrane and the plasmid enters the cell), immediately take it out and put it back on ice for 5 minutes (close the cell membrane). Add 500 µL of anti-LB liquid culture medium without antibiotics to the centrifuge tube, place the culture medium in a constant temperature shaker at 37 ℃, 220 r / min, and culture for 45 minutes. Mix well and take 200 µL of the above culture medium, use a sterile spreading rod to spread it on the solid LB medium containing kanamycin sulfate (final concentration 50 µg / mL), and place the inoculated culture medium upright in a 37 ℃ culture medium for 30 min, then invert and culture for 12 h-16 h to obtain the Escherichia coli BL21 (DE3) strain containing the recombinant plasmid.

[0024] 4. Inducible expression of recombinant β-1,4-endoglucanase Single clone small volume (5 mL) culture: Pick a single clone of recombinant E. coli BL21 (DE3) into a 10 mL centrifuge tube, add 5 mL LB resistance liquid medium (Kan 50 µg / mL), and culture overnight at 37 °C, 220 rpm, in a constant temperature shaker for 12-16 h to obtain the E. coli BL21 (DE3) seed solution containing the recombinant plasmid.

[0025] 5. Expansion culture (300 mL): Take 3 mL of bacterial solution (1% inoculum) and inoculate it into 300 mL of fresh LB liquid medium (Kan 50 µg / mL). Incubate at 37°C, 220 rpm, in a constant temperature shaker for 4 h to 6 h until the OD reaches 600 =0.4-0.6, add 714 μL IPTG (final concentration 0.5 mM), culture in a constant temperature shaker at 16 °C, 220 rpm for 20 h, then centrifuge at 8000 rpm / min for 5 min, discard the supernatant to collect the bacteria, ensure that 4.0 g of bacteria are collected in each centrifuge tube, and store at -20 °C to obtain Escherichia coli BL21 (DE3) bacteria that have completed the expression of natural β-1,4-endoglucanase EG.

[0026] 6. Obtaining crude enzyme: Add 4.0 g of bacteria collected in a 50 mL centrifuge tube to 20 mL of non-denaturing lysis buffer, mix with a pipette, centrifuge at 8000 r / min for 5 min, discard the supernatant, collect the bacteria, add 20 mL of non-denaturing lysis buffer and 20 µL of lysozyme, mix with a pipette, mix with a vortexer, and incubate on ice for 30 min. Use an ultrasonic disruptor for ultrasonic disruption, power 40w, amplitude 6, engineering 1, ultrasonic work 2 s, stop 8 s, the whole process is broken on ice for 30 min, centrifuge at 8000 r / min for 15 min, take the supernatant, preheat in a 70 ℃ constant temperature water bath for 2 h, centrifuge at 8000 r / min for 15 min, take the supernatant to remove most of the impurities in Escherichia coli to obtain a crude enzyme solution of natural β-1,4-endoglucanase EG that has been removed by high temperature.

[0027] Example 2 β-1,4-endoglucanase domain reconstruction Using Alphafold2 protein modeling, it was found that natural β-1,4-endoglucanase EG has three domains: A, B and C ( Figure 1 ), the catalytic domain was predicted to be domain A. Four reconstructed enzymes with domains AB, AC, BC and A were designed.

[0028] 1. Primer design The DNA sequence of the fully synthetic natural β-1,4-endoglucanase EG, pET28a-EG (SEQ ID No: 10), was used as a template for domain reconstruction. Table 1 shows the PCR primers used for domain reconstruction.

[0029] Table 1 PCR primers for domain reconstruction Primer name Primer sequence (5'→3') F-pET28a-EG-1 GTCGACATGGGCCGTCT F-pET28a-EG-2 CCTGGTGCCGCGCGGCAGCCATATGGTCGACATGGGCCGTCT R-pET28a-EG-1 ACGAACGTGAACGTACA R-pET28a-EG-2 AGTGGTGGTGGTGGTGGTGCTCGAGACGAACGTGAACGTAC R-pET28a-EG-A1 CATCAGAGACTGTAACAGC R-pET28a-EG-A2 AGTGGTGGTGGTGGTGGTGCTCGAGCATCAGAGACTGTAACAGC F- pET28a-EG-C1 CTGGGCTATCGCCTGTA F- pET28a-EG-C2 TGAACCCGGAACGTGGCTTCCTGGGCTATCGCCTGTA F-pET28a-EG-B1 ATGCAGGCACCGAGCGGCCA F-pET28a-EG-B2 GGTGCCGCGCGGCAGCCATATGATGCAGGCACCGAGCGGCCA R-pET28a-EG-B1 GCGATAGCCCAGGTCACGT R-pET28a-EG-B2 TGGTGGTGGTGGTGGTGCTCGAGGCGATAGCCCAGGTCACGT R-pET28a-EG-At1 GAAGCCACGTTCCGGGTTCA R-pET28a-EG-At2 GCAGGTACAGGCGATAGCCCAGGAAGCCACGTTCCGGGTTCA 2. Analysis of the EG domain of β-1,4-endoglucanase The β-1,4-endoglucanase gene EG has three domains, namely A, B, and C. Through the analysis of the Interpro online website, among the three domains of EG, the A domain is predicted to be the catalytic domain of glycoside hydrolase family 5 (GH5), while the functions of the B and C domains are unknown. In this experiment, four reconstructed enzymes A, AB, BC and AC were designed.

[0030] 3. High-fidelity amplification of target DNA fragments High-fidelity enzymes were used to obtain gene fragments of domains A (SEQ ID No: 11), AB (SEQ ID No: 12), AC (SEQ ID No: 13) and BC (SEQ ID No: 14): domain AC gene was cloned with At and C genes first, At = A + linker sequence (SEQ ID No: 15). Overlap PCR amplification was performed according to the instructions of the PrimeSTAR Max DNA Polymeras kit. The primers for the A fragment are: F-pET28a-EG-1 / R-pET28a-EG-A1, the primers for the AB fragment are: F-pET28a-EG-1 / R- pET28a-EG-B1, the primers for the BC fragment are: F- pET28a-EG-B1 / R- pET28a-EG-C1, the primers for the At fragment are: F- pET28a-EG-1 / R- pET28a-EG-At1; the primers for the C fragment are: F- pET28a-EG-C1 / R- pET28a-EG-2. After the reaction, 4 µL of the PCR product was taken for 1% agarose gel electrophoresis. The PCR reaction system and cycle parameters are as follows (25 µL amplification system): Reaction system: 1 µl DNA, 0.5 µl 20 µM forward and reverse primers, 11 µl ddH 2 O; The PCR reaction program was as follows: 98°C for 10 s, 55-60°C for 15 s, and 72°C for 150 s for 30 cycles; and finally stored at 4°C.

[0031] 4. Homologous recombination fragment amplification High-fidelity enzymes were used to obtain homologous recombination A, At, AB, BC, and AC genes: the homologous recombination AC gene required the cloning of At and C gene sequences first, and then Overlap PCR was used for amplification. The PrimeSTAR Max DNA Polymeras kit instructions were used for vector construction. The homologous recombination connection method was used. The primers were designed to extend the 5' segment to 25-30 bp of the vector fragment. The homologous recombination A gene primers were F-pET28a-EG-2 / R-pET28a-A2, the homologous recombination AB gene primers were F-pET28a-EG-1 / R- pET28a-EG-B2, the homologous recombination BC gene primers were F-pET28a-EG-B2 / R-pET28a-EG-2, the homologous recombination At gene primers were F-pET28a-EG-2 / R-pET28a-EG-At2, and the homologous recombination C gene primers were F-pET28a-EG-C2 / R-pET28a-EG-2, after the reaction, take 4 µL of PCR product for 1% agarose gel electrophoresis. The PCR reaction system and cycle parameters are as follows (50 µL amplification system): Reaction system: 1 µl template DNA, 1 µl 20 µM forward and reverse primers, 22 µl ddH 2 O; The PCR reaction program was as follows: 98°C for 10 s, 55-60°C for 15 s, and 72°C for 150 s for 30 cycles; and finally stored at 4°C.

[0032] 5. Construction of domain AC remodeling enzyme gene Overlap PCR to obtain AC gene: Using homologous recombination At and C gene sequences as PCR templates, using the homologous fragments between the two sequences, base pairing is performed to achieve connection between the fragments. Referring to the PrimeSTAR Max DNA Polymeras kit operating instructions, AC gene fragments are obtained, and its DNA is shown in SEQ ID No: 1. The PCR reaction system and cycle parameters are as follows (50 µL amplification system): Reaction system: 1 µl template DNA, 1 µl 20 µM forward and reverse primers, 21 µl ddH 2 O; The PCR reaction program was as follows: 98°C for 10 s, 55-60°C for 15 s, and 72°C for 150 s for 30 cycles; and finally stored at 4°C.

[0033] 6. Preparation of expression fragments of reconstructed enzymes A, AB, AC and BC.

[0034] (1) Extraction of expression vector pET28a plasmid The SanPrep column plasmid DNA small-scale extraction kit was used, and the specific steps were referred to the kit instructions.

[0035] The expression vector pET28a was linearized by double restriction enzyme digestion and selected N Ⅰ and XOt The vector was linearized at the restriction endonuclease I site. The reaction system (40 µL) was as follows: 32 µL of vector pET28a, QuickCut ™ N I2 µL, QuickCut ™ XOt I2 µL, 10xQuickCut Buffer 4 µL, incubate in a 37 ℃ constant temperature water bath for 75 min.

[0036] After plasmid extraction, 4 μL of the purified product was taken for 1% agarose gel electrophoresis.

[0037] (3) Vector fragment purification The SanPrep column DNA recovery kit was used. The specific steps were referred to the kit instructions. After purification, 3 µL of the purified product was taken for 1% agarose gel electrophoresis.

[0038] 7. Ligation of recombinant plasmid Connection of target fragments: The vectors pET28a-A, pET28a-AB, pET28a-AC and pET28a-BC were constructed by homologous recombination method. The in vitro homologous recombination method was constructed by referring to the Exnase one-step cloning kit (Vazyme). The reaction system (10 µL) was as follows: 2×Hieff Clone® Enzyme Premix 5 µL, linearized vector pET28a 4 µL, and 1 µL of A, AB, AC and BC gene fragments were inserted respectively. After the connection, the transformation step was immediately carried out or stored in a refrigerator at -20 ℃.

[0039] 8. Transformation of recombinant plasmid Heat shock transformation method: Take out the E. coli DH5α competent cells prepared in advance from the -80℃ refrigerator and place them on ice. When the ice-water mixture is added, 10 μL of recombinant plasmid DNA or cloned ligation product is added, gently mix, and place on ice for 30 minutes to obtain a transformed cell line. The specific steps refer to the transformation of E. coli competent cells in step 3 of Example 1.

[0040] 9. PCR verification of recombinant E. coli positive transformants (1) Pick a single clone and place it in a 1.5 mL centrifuge tube. Add 500 µL LB resistance liquid culture medium (Kan 50 µg / mL) and culture it in a constant temperature shaker at 37°C and 220 rpm for 3-4 h for bacterial liquid PCR verification.

[0041] (2) Premix Taq™ (TaKaRa Taq™ Version 2.0 plus dye) kit was used for bacterial liquid PCR verification. The commonly used PCR reaction system and cycle parameters are as follows (12.5 µL amplification system): The reaction system includes: 2x Premix Taq 6.25 µL, 20 µM forward and reverse primers 0.25 µL each, ddH 2 O4.75 µL; The PCR reaction procedure was as follows: pre-denaturation at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 150 s; and final storage at 4°C.

[0042] After the reaction was completed, 5 μL of PCR product was taken for 1% agarose gel electrophoresis.

[0043] The transformed cell lines verified by PCR were obtained.

[0044] 10. Inducible expression of domain A, AB, AC and BC reconstructed enzymes and preparation of crude enzymes The expression of the domain reconstructed enzyme and the preparation of the crude enzyme solution refer to steps 3, 4, 5 and 6 in Example 1. Finally, crude enzyme solutions of domain A, AB, AC and BC reconstructed enzymes with amino acid sequences of SEQ ID No: 7, SEQ ID No: 8, SEQ ID No: 9 and SEQ ID No: 1 were obtained.

[0045] Experimental Example 1 Detection of β-1,4-endoglucanase domain reconstructed enzyme activity The expression levels of four reconstructed enzymes of β-1,4-endoglucanase were determined by the dinitrosalicylic acid method (DNS). The crude enzyme solutions of domain A, AB, BC and AC reconstructed enzymes were pretreated in a constant temperature water bath at 70 °C for 2 h, centrifuged at 8000 rpm / min for 15 min, and the supernatant was diluted appropriately and 50 µL was added to a 96-well PCR plate. After 20 min of constant temperature water bath reaction at 95 °C and pH = 8, 100 µL DNS was added, and the color was developed in a constant temperature water bath at 90 °C for 10 min. The reaction solution was placed in an ice box and cooled to room temperature to obtain a reaction solution. 150 µL of deionized water was pre-added to the 96-well ELISA plate, and 50 µL of the reaction solution was added to the ELISA plate and mixed at OD 540 nm The absorbance of the sample was measured by an ELISA instrument. Enzyme activity unit (1 U) is defined as the amount of β-1,4-endoglucanase required to release 1 µmol of reducing sugar per minute at 95 °C and pH 8.

[0046] Results: As shown in Table 1, the enzyme reconstructed by domain BC had no activity, while the enzyme reconstructed by domains A and AC had the best activity. Among them, the enzyme reconstructed by domain AC had the highest expression level, reaching 10.97 U / ml, which was 305% of the natural β-1,4-endoglucanase EG.

[0047] Table 1 Expression levels of recombinant enzyme fermentation broth Recombinase Fermentation broth expression (U / mL) Natural β-1,4-endoglucanase EG 3.60 A 9.03 AB 4.54 AC 10.97 BC 0 The following experimental examples further study the performance of the domain AC reconstructed enzyme.

[0048] Experimental Example 2 Study on the Optimal Temperature and Thermal Stability of Domain AC Reconstructed Enzyme The reconstructed enzyme AC was diluted 1000 times with a pH 8 buffer, and 1 mL of the enzyme solution was taken into a 1.5 mL plastic centrifuge tube with a pipette. Five parallels were set for each sample. Each enzyme solution sample was kept in a constant temperature water bath at 60 ℃, 70 ℃, 80 ℃, and 90 ℃ for 1h, 2h, 4h, 6h, 8h, 12h, 24h, 48h, and 72h, and then the enzyme activity was detected at 90 ℃ and pH 8. The reaction system containing only enzyme solution without substrate treated at different temperatures was used as the blank control, and the ratio of the enzyme activity after temperature tolerance treatment to the untreated enzyme activity was used to characterize and calculate the residual enzyme activity. The enzyme activity without temperature tolerance treatment was defined as 100% enzyme activity.

[0049] Results: Figure 2As shown in a, the optimal temperature of the domain AC reconstructed enzyme is 95 °C, it shows an activity level higher than 50% within 80-95 °C, and still retains a relative enzyme activity of more than 15% at 110 °C. Step 6: Figure 2 As shown in Figure b, after the domain AC reconstructed enzyme was placed at 60 ℃, 70 ℃, and 80 ℃ for 72 h, the remaining enzyme activity still remained above 50%, and its half-life (T1 / 2) at 80 ℃ was 72 h. This indicates that the domain AC reconstructed enzyme is a β-1,4-endoglucanase with good temperature stability, which is conducive to industrial applications under high temperature conditions.

[0050] Experimental Example 3 Study on the substrate spectrum of the AC reconstructed enzyme of the β-1,4-endoglucanase structure domain of the present invention 1. Natural substrate activity detection The enzyme activity of the domain AC reconstructing enzyme was determined by the DNS method at 90 ℃ and pH = 8, using 0.5% konjac glucomannan, β-glucan, sodium carboxymethyl cellulose, pullulan, gardenia glycoside, arbutin, and bagasse solution as substrates.

[0051] Results: As shown in Table 2, the domain AC reconstructed enzyme of the present invention was active against konjac glucomannan, β-glucan and sodium carboxymethyl cellulose, and the relative enzyme activities of the three were 100%, 63.58% and 1.24%, respectively.

[0052] Table 2 Substrate specificity of the AC reconstructed enzyme of the β-1,4-endoglucanase domain of the present invention Substrate Relative enzyme activity (%) Konjac Glucomannan 100 β-Glucan 63.58 Sodium Carboxymethyl Cellulose 1.24 Bagasse ND Pullulan ND sucrose ND Gardenia glycoside ND Arbutin ND Note: “ND” means that the data set was not detected.

[0053] 2. pNP substrate activity detection 20 mM p-nitrophenol-β-D-pyranoglucoside (pNPG) and p-nitrophenol-β-D-pyranoglucoside (pNPG) were used to (oNPG) and p-nitrophenol-β-D-xylopyranoside (pNPX) were used as substrates. In this step, pNP substrate was obtained for substrate spectrum study. The enzyme activity was determined by hydrolyzing pNP at 90 °C and pH 8.

[0054] Results: The enzyme reconstructed with domain AC had no activity towards pNP-based artificial substrates.

[0055] Experimental Example 4 Purification and specific activity determination of the AC domain reconstructed enzyme of β-1,4-endoglucanase of the present invention 1. The crude enzyme of domain AC reconstructed enzyme is obtained in the same manner as step 6 in Example 1.

[0056] 2. Affinity chromatography: Take 1 mL of the mixed BeyoGold™ His-tag Purification Resin, centrifuge at 4 °C (1000 g × 10 s), discard the storage solution, add 0.5 mL of non-denaturing lysis buffer to the gel to resuspend and balance the gel, centrifuge at 4 °C (1000 g × 10 s), discard the liquid, repeat the balance 1-2 times, and discard the liquid. Add about 4 mL of bacterial lysate supernatant and shake slowly at 4 °C on a side-swing shaker or horizontal shaker for 90 min; load the mixture of lysate and BeyoGold™ His-tag Purification Resin into the empty column tube (3 mL) of the affinity chromatography column provided in the kit; open the lid at the bottom of the purification column, let the liquid in the column flow out under the action of gravity, and collect about 20 µL of flow-through for subsequent analysis; wash the column 15 times, adding 1 mL of non-denaturing washing solution (containing 20 mM imidazole) each time, and collect about 20 µL of the liquid flowing through the column each time for subsequent analysis and detection; elute the target protein 1-10 times, each time using 0.5 mL of non-denaturing elution buffer (containing 250 mM imidazole); collect the eluate each time into different centrifuge tubes, and the collected eluate is the enzyme solution for preliminary purification by affinity chromatography.

[0057] 3. Purification by AKTA Purifier: Collect 8 mL of the eluate after purification by nickel column His-tagged protein affinity chromatography, filter twice with a 0.22 µm filter membrane, and then chromatograph with a balanced gel column (buffer, 20 mM, pH 8), collect different absorption peaks, and store at -20 °C to obtain the purified domain AC reconstructed enzyme. The pressure is 0.44 MPa, the flow rate is 0.9 mL / min, and the injection volume is 5 mL.

[0058] 4. Determination of the concentration of purified protein: Use the BCA protein concentration determination kit (Shanghai Sangon Biotechnology Co., Ltd.) and use bovine serum albumin (BSA) as the standard protein for determination.

[0059] ELISA plate assay process: a. Use a 96-well PCR plate and add 5 µL of the standard protein solution of the corresponding concentration to each well, and add 5 µL of sample dilutions of different concentrations to the remaining wells.

[0060] b. Add 5 µL of Solution F to each well of the PCR plate and incubate in a 37 ℃ constant temperature water bath for 30 min.

[0061] c. Add 200 µL of BCA working solution to each well, mix quickly, and keep in a 37 ℃ constant temperature water bath for 30 minutes.

[0062] d. After cooling to room temperature, measure the absorbance at OD562 nm on a microplate reader. Use different BSA standard solution concentrations as the horizontal axis and the corresponding OD562 nm absorbance as the vertical axis to draw a protein concentration standard curve using Origin2024 software.

[0063] It was determined that the pure enzyme protein concentration of the domain AC reconstructed enzyme of the present invention was 0.013 mg / mL.

[0064] 5. Detection of pure enzyme activity and specific activity The detection method is the same as that in Experimental Example 1.

[0065] It was determined that the enzyme activity of the domain AC reconstructing enzyme of the present invention was 26.23 U / mL. The enzyme activity was divided by the pure enzyme protein concentration of 0.013 mg / mL, and the specific activity of the domain AC reconstructing enzyme was 2018 U / mg.

[0066] Experimental Example 5 Detection of the activity of hydrolyzing konjac glucoside by domain AC reconstructed enzyme The sol viscosity of konjac glucomannan is very high and its fluidity is poor. After konjac glucomannan is hydrolyzed, small molecular oligosaccharides are generated and the sol viscosity decreases rapidly. Therefore, the change in viscosity can be used to characterize the degree of hydrolysis of konjac glucomannan.

[0067] Detection method: a. Preheat 500 mL of 1% konjac glucomannan as the total reaction system and add 1 U (38 µL) of the crude enzyme of domain AC reconstructing enzyme obtained in step 2 of Experimental Example 4.

[0068] b. Under the reaction conditions of 90 ℃ and pH 8, stirring with a constant temperature magnetic stirrer, the effect of different enzymatic hydrolysis times on the viscosity change of konjac glucomannan sol was measured at 0 min, 1 min, 2 min, 3 min, 4 min and 5 min respectively.

[0069] Results: As shown in Table 3, the initial viscosity of the konjac glucomannan sol was 32106 mPa.s. After 1 min of enzymatic hydrolysis, the viscosity of the konjac glucomannan decreased to 2263 mPa.s, and then decreased to 5.2 mPa.s after 3 min, and then tended to stabilize, indicating that the domain AC reconstructed enzyme of the present invention has good hydrolysis activity for konjac glucomannan and can be used for the production of konjac glucomannan oligosaccharides.

[0070] Table 3 Effect of domain AC reconstructed enzyme on KGM hydrolyzed sol viscosity Enzymatic hydrolysis time (min) 0 1 2 3 4 5 Viscosity (mPa.s) 32106 2263 425 5.2 4.4 4.1 Experimental Example 6 Detection of the activity of oat glucan hydrolyzed by domain AC reconstructed enzyme Oat glucan is formed by the polymerization of glucose through β-1,3-glucosidic bonds and 1,4-glucosidic bonds, with the ratio of the two being approximately 2.1:1.

[0071] Detection method: 10 mL of 0.5% oat-derived β-glucan solution was prepared with a pH = 8 buffer as the reaction system, preheated to 90 °C, and 1 U of domain AC reconstructing enzyme crude enzyme solution was added. The enzyme was hydrolyzed for 1 h using a constant temperature magnetic stirrer. The hydrolyzate was analyzed by thin layer chromatography. The oat-derived β-glucan solution without enzyme ( Figure 3 e), natural β-1,4-endoglucanase EG ( Figure 3 b) and domain A remodeling enzyme ( Figure 3 c) is the control.

[0072] Results: Figure 3 As shown, compared with the control group without enzyme, the main products of oat glucan hydrolyzed by the domain AC reconstructing enzyme of the present invention are disaccharides, trisaccharides and tetrasaccharides (( Figure 3 d)), indicating that the domain AC reconstructed enzyme has the ability to hydrolyze oat glucan to produce oligosaccharides.

Claims

1. A thermophilic β-1,4-endoglucanase comprising an amino acid sequence having at least 85% identity with the amino acid sequence of SEQ ID No: 1, or an amino acid sequence having at least 92% identity with SEQ ID No: 2, or an amino acid sequence having at least 87% identity with SEQ ID No: 3, or an amino acid sequence having at least 89% identity with SEQ ID No: 4, or an amino acid sequence having at least 84% identity with SEQ ID No:

5.

2. A DNA sequence encoding the amino acid sequence of the thermophilic β-1,4-endoglucanase according to claim 1.

3. A recombinant vector of the DNA sequence as claimed in claim 2.

4. A host cell transformed, transduced or transfected with the recombinant vector according to claim 3.

5. Use of the DNA sequence according to any one of claim 2 in the preparation of β-1,4-endoglucanase.

Images